Mechanisms of antagonism of HIVspecific CD4+ T cell responses BSRI
|
|
- Robyn Gregory
- 5 years ago
- Views:
Transcription
1 Mechanisms of antagonism of HIVspecific CD4+ T cell responses BSRI
2 Problems Virus escape from immune recognition Antagonism of T cell responses
3 Peptide-MHC-TCR interaction
4 T cell antagonism Variants of a peptide recognized by a T cell can block recognition of the original peptide
5 Classes of peptides Alexander et al. J. Immunol 1993
6 CD4+ T cell antagonism Alexander et al., J Immunol 1993 DeMagistris et al., Cell 1992 Ostrov et al., J Immunol 1993 Racciopi et al., J Exp Med 1993
7 Mechanism of action of TCR antagonism No dominant negative signal in CD8+ T cells Dominant negative signal in CD4+ T cells De Magistris et al., Cell 1992 Daniels et al., J Immunol 1999 Stotz et al., J Exp Med 1999 Robertson et al., J Immunol 1999
8 Antagonism in HIV infection Antagonism of CTL response in HIV Antagonism of HIV Vaccine response Klenerman et al., Nature 1994 Kent et al., J Immunol 1997
9 T cell antagonism by a variant peptide shorter than the full length epitope
10 Viral peptide in HLA Binding Groove HLA Class II molecule HLA Class II molecule
11 Clone AC-01 Clone 1 AC-01 Clone 2 AC-25 Clone 3 161J Clone 4 CTS01 Clone 5 HLA restriction DQ5 DQ7 DR1 DR4 DQ7 Minimum epitope EEKAFSPEVIP ( ) EPRGSDIAGT ( ) PEVIPMSALSEGATP ( ) EVIPMFSALS ( ) VHAGPIAPG ( ) Norris et al., AIDS Res Hum Retrovirus 2004
12 SFC/million Net CPM OD (405) Shorter peptide PG13 not active IFN-γ Proliferation Serine esterase PP PG Concentration (μg/ml) Concentration (μm) Norris et al., Molecular Immunol. 2006
13 % inhibition Antagonism by shorter peptide PG PG13 Flu IFN-gamma Proliferation Esterase release Norris et al., Molecular Immunol. 2006
14 Why is the shorter peptide PG 13 an antagonist?
15 Tetramer staining Biotinylated MHC molecule Peptide SA-PE T cell Streptavidin coupled fluorochrome T cell receptor
16 PG 13 tetramer binds with less avidity than PP16 MFI PP16 TFR IP13 PG13 PG PG13 TFR TFR PG13 IP Tet concentration (μg/ml) Norris et al., Molecular Immunol. 2006
17 Does binding of shorter vs. longer peptide reveal function?
18 P1 P4 P6 P9
19
20 Zavala-Ruiz et al., PNAS 2004
21 Zavala-Ruiz et al., PNAS 2004
22 Glycine turn abolished GLY PRO Norris et al., Molecular Immunol. 2005
23 % inhibition Engineered antagonist peptide Flu PG P--- Norris et al., Molecular Immunol. 2005
24 Conclusions I Residues outside the MHC binding core can interact with and activate the T cell Partial T cell receptor engagement results in antagonism Antagonist peptide-mhc maintains ability to bind TCR with lower affinity than agonist
25 What gene pathways are disrupted after antagonist peptide exposure?
26 STAT signaling pathway
27 Activation truncated by antagonist Time (min) S T A T 3 S T A T 5
28 Activation truncated by antagonist
29 Multiplex detection of secreted cytokines Jacobs et al., Retrovirology 2014
30 Genes with 1.5 fold greater difference in expression between Ag and Ag+Ant B. B. Ag < Ag + Ant Ag< Ag+Ant *** *** C. Ag Ag> > Ag+Ant + Ant *** *** A. *** ** C. C. *** *** *** Jacobs et al., Retrovirology 2014
31 IPA Comparison of gene array data Yellow = Ag, Green = Ag + Ant, Predicted Activation Blue = Ant p-value Activation z-score Annotated Function State # Molecules activation of T lymphocytes 2.93E E E-09 Decreased differentiation of lymphocytes 1.67E E E expansion of T lymphocytes 3.65E E E proliferation of lymphocytes 3.88E E E proliferation of T lymphocytes 9.20E E E T cell homeostasis 3.94E E E function of T lymphocytes* 8.27E-17 Increased E stimulation of leukocytes* 4.53E-13 Increased E-05 Decreased stimulation of lymphocytes* 1.07E-14 Increased E-06 Decreased stimulation of T lymphocytes* 1.74E-14 Increased E-06 Decreased * These functions did not match to Ag + Ant condition with a significant p value. Jacobs et al., Retrovirology 2014
32 Ag Ag Ag Ag + Ant IPA Comparison of gene array data Jacobs et al., Retrovirology 2014
33 Gene expression profile of T cell stimulation matches that of SIV vaccine trial Fukazawa et al., Nat Med 2012 Jacobs et al., Retrovirology 2014
34 Conclusions II Antagonism results in aborted activation due to a dominant negative signal Link to existing vaccine study where Ag + Ant treatment showed similar profile to vaccine failure
35 Acknowledgments BSRI John Heitman Dale Hirschkorn Evan Jacobs Harvard Howell Moffett Margaret Clark Eric Rosenberg Bruce Walker University of Massachusetts Thomas Cameron Zarixia Zavala-Ruiz Jennifer Stone Larry Stern University of Toronto Des Persad Luoling Xu Longsi Ran David Kelvin
Lecture 6. Burr BIO 4353/6345 HIV/AIDS. Tetramer staining of T cells (CTL s) Andrew McMichael seminar: Background
Lecture 6 Burr BIO 4353/6345 HIV/AIDS Andrew McMichael seminar: Background Tetramer staining of T cells (CTL s) 1. Vβ 19: There are 52 T cell receptor (TCR) Vβ gene segments in germ line DNA (See following
More informationSupplementary Figure 1. Enhanced detection of CTLA-4 on the surface of HIV-specific
SUPPLEMENTARY FIGURE LEGEND Supplementary Figure 1. Enhanced detection of CTLA-4 on the surface of HIV-specific CD4 + T cells correlates with intracellular CTLA-4 levels. (a) Comparative CTLA-4 levels
More informationHow HIV Causes Disease Prof. Bruce D. Walker
How HIV Causes Disease Howard Hughes Medical Institute Massachusetts General Hospital Harvard Medical School 1 The global AIDS crisis 60 million infections 20 million deaths 2 3 The screen versions of
More informationDeterminants of Immunogenicity and Tolerance. Abul K. Abbas, MD Department of Pathology University of California San Francisco
Determinants of Immunogenicity and Tolerance Abul K. Abbas, MD Department of Pathology University of California San Francisco EIP Symposium Feb 2016 Why do some people respond to therapeutic proteins?
More informationAntigen Presentation and T Lymphocyte Activation. Abul K. Abbas UCSF. FOCiS
1 Antigen Presentation and T Lymphocyte Activation Abul K. Abbas UCSF FOCiS 2 Lecture outline Dendritic cells and antigen presentation The role of the MHC T cell activation Costimulation, the B7:CD28 family
More informationMHC Tetramers and Monomers for Immuno-Oncology and Autoimmunity Drug Discovery
MHC Tetramers and Monomers for Immuno-Oncology and Autoimmunity Drug Discovery Your Partner in Drug Discovery and Research MHC Tetramer Background T-Cell Receptors recognize and bind to complexes composed
More informationRAISON D ETRE OF THE IMMUNE SYSTEM:
RAISON D ETRE OF THE IMMUNE SYSTEM: To Distinguish Self from Non-Self Thereby Protecting Us From Our Hostile Environment. Innate Immunity Acquired Immunity Innate immunity: (Antigen nonspecific) defense
More informationThe Major Histocompatibility Complex (MHC)
The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens
More informationRapid perforin upregulation directly ex vivo by CD8 + T cells is a defining characteristic of HIV elite controllers
Rapid perforin upregulation directly ex vivo by CD8 + T cells is a defining characteristic of HIV elite controllers Adam R. Hersperger Department of Microbiology University of Pennsylvania Evidence for
More informationLecture 11. Immunology and disease: parasite antigenic diversity
Lecture 11 Immunology and disease: parasite antigenic diversity RNAi interference video and tutorial (you are responsible for this material, so check it out.) http://www.pbs.org/wgbh/nova/sciencenow/3210/02.html
More informationHelminth worm, Schistosomiasis Trypanosomes, sleeping sickness Pneumocystis carinii. Ringworm fungus HIV Influenza
Helminth worm, Schistosomiasis Trypanosomes, sleeping sickness Pneumocystis carinii Ringworm fungus HIV Influenza Candida Staph aureus Mycobacterium tuberculosis Listeria Salmonella Streptococcus Levels
More informationDEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED
DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED Viv Peut Kent Laboratory, University of Melbourne, Australia WHY ENVELOPE? Env subject to both humoral and cellular immune responses Perhaps
More informationSupplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints
Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide
More informationScott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION
Scott Abrams, Ph.D. Professor of Oncology, x4375 scott.abrams@roswellpark.org Kuby Immunology SEVENTH EDITION CHAPTER 11 T-Cell Activation, Differentiation, and Memory Copyright 2013 by W. H. Freeman and
More informationCommercially available HLA Class II tetramers (Beckman Coulter) conjugated to
Class II tetramer staining Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to PE were combined with dominant HIV epitopes (DRB1*0101-DRFYKTLRAEQASQEV, DRB1*0301- PEKEVLVWKFDSRLAFHH,
More informationVaccine Design: A Statisticans Overview
GoBack : A Statisticans Overview. Surajit Ray sray@samsi.info Surajit Ray Samsi PostDoc Seminar: Nov 2: 2004 - slide #1 The Chinese are credited with making the observation that deliberately infecting
More informationRAISON D ETRE OF THE IMMUNE SYSTEM:
RAISON D ETRE OF THE IMMUNE SYSTEM: To Distinguish Self from Non-Self Thereby Protecting Us From Our Hostile Environment. Innate Immunity Adaptive Immunity Innate immunity: (Antigen - nonspecific) defense
More informationSupplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in
Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Fig. 2 Substitution Sequence Position variant Sequence original APNCYGNIPL original APNCYGNIPL
More informationDefining the directionality and quality of influenza virus specific CD8 + T cell cross-reactivity in individuals infected with hepatitis C virus
Research article Defining the directionality and quality of influenza virus specific CD8 + T cell cross-reactivity in individuals infected with hepatitis C virus Victoria Kasprowicz, 1 Scott M. Ward, 2
More informationSupporting Information
Supporting Information Sui et al..7/pnas.997 Pre-CLP CM9 LA9 SL Tat# Pol Vif % Tetramer + CD + CD + Vac+IL- +IL- Vac Fig. S. Frequencies of six different CD + CD + Mamu-A*-tetramer + cells were measured
More informationT Cell Activation, Costimulation and Regulation
1 T Cell Activation, Costimulation and Regulation Abul K. Abbas, MD University of California San Francisco 2 Lecture outline T cell antigen recognition and activation Costimulation, the B7:CD28 family
More informationImmune surveillance: The immune system can recognize and destroy nascent malignant cells
Immune surveillance: The immune system can recognize and destroy nascent malignant cells Control Escape APC T C T H B NKT NK Innate Tumor T cells are believed to play a major role in controlling tumor
More informationTumors arise from accumulated genetic mutations. Tumor Immunology (Cancer)
Tumor Immunology (Cancer) Tumors arise from accumulated genetic mutations Robert Beatty MCB150 Mutations Usually have >6 mutations in both activation/growth factors and tumor suppressor genes. Types of
More informationDefensive mechanisms include :
Acquired Immunity Defensive mechanisms include : 1) Innate immunity (Natural or Non specific) 2) Acquired immunity (Adaptive or Specific) Cell-mediated immunity Humoral immunity Two mechanisms 1) Humoral
More informationSUPPLEMENTARY INFORMATION
Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice
More informationHow T cells recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do? Monoclonal antibody approach
How T cells recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do By the early 1980s, much about T cell function was known, but the receptor genes had not been identified
More informationA second type of TCR TCR: An αβ heterodimer
How s recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do By the early 1980s, much about function was known, but the receptor genes had not been identified Recall
More informationThe Adaptive Immune Responses
The Adaptive Immune Responses The two arms of the immune responses are; 1) the cell mediated, and 2) the humoral responses. In this chapter we will discuss the two responses in detail and we will start
More informationNTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc.
NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc. Cytokines Properties of Cytokines Cytokines are proteins with specific roles
More informationHD1 (FLU) HD2 (EBV) HD2 (FLU)
ramer staining + anti-pe beads ramer staining a HD1 (FLU) HD2 (EBV) HD2 (FLU).73.11.56.46.24 1.12 b CD127 + c CD127 + d CD127 - e CD127 - PD1 - PD1 + PD1 + PD1-1 1 1 1 %CD127 + PD1-8 6 4 2 + anti-pe %CD127
More informationEBV Infection and Immunity. Andrew Hislop Institute for Cancer Studies University of Birmingham
EBV Infection and Immunity Andrew Hislop Institute for Cancer Studies University of Birmingham EBV Introduction Large ds DNA virus Spread by saliva contact Lifelong infection Predominantly B-lymphotropic
More informationInnate and Cellular Immunology Control of Infection by Cell-mediated Immunity
Innate & adaptive Immunity Innate and Cellular Immunology Control of Infection by Cell-mediated Immunity Helen Horton PhD Seattle Biomedical Research Institute Depts of Global Health & Medicine, UW Cellular
More informationCytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands
Cytotoxicity assays Rory D. de Vries, PhD 1 1 Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Anti-influenza immunity Humoral / CD4+ / CD8+ / NK? Function of CTL Elimination of virus-infected cells?
More informationEffector mechanisms of cell-mediated immunity: Properties of effector, memory and regulatory T cells
ICI Basic Immunology course Effector mechanisms of cell-mediated immunity: Properties of effector, memory and regulatory T cells Abul K. Abbas, MD UCSF Stages in the development of T cell responses: induction
More informationSupplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone.
Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. alpha beta ATGCTCCTGCTGCTCGTCCCAGTGCTCGAGGTGATTTTTACTCTGGGAGGAACCAGAGCC CAGTCGGTGACCCAGCTTGACAGCCACGTCTCTGTCTCTGAAGGAACCCCGGTGCTGCTG
More informationCellular Immunity in Aging and HIV: Correlates of Protection. Immune Senescence
Cellular Immunity in Aging and HIV: Correlates of Protection Janet E. McElhaney, MD Professor of Medicine Allan M. McGavin Chair in Research Geriatrics University of British Columbia Vancouver, BC and
More informationTest Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas
Test Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas Chapter 04: Antigen Recognition in the Adaptive Immune System Test Bank MULTIPLE CHOICE 1. Most T lymphocytes
More informationACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes
More informationTITLE: Development of Antigen Presenting Cells for adoptive immunotherapy in prostate cancer
AD Award Number: W8XWH-5-- TITLE: Development of Antigen Presenting Cells for adoptive immunotherapy in prostate cancer PRINCIPAL INVESTIGATOR: Mathias Oelke Ph.D. CONTRACTING ORGANIZATION: Johns Hopkins
More informationAlternate Antibody-Based Therapeutic Strategies To Purge the HIV Cell Reservoir
Alternate Antibody-Based Therapeutic Strategies To Purge the HIV Cell Reservoir Giuseppe Pantaleo, M.D. Professor of Medicine Head, Division of Immunology and Allergy Executive Director, Swiss Vaccine
More informationTITLE: Development of Antigen Presenting Cells for adoptive immunotherapy in prostate cancer
AD Award Number: W8-XWH-5-- TITLE: Development of Antigen Presenting Cells for adoptive immunotherapy in prostate cancer PRINCIPAL INVESTIGATOR: Mathias Oelke, Ph.D. CONTRACTING ORGANIZATION: Johns Hopkins
More informationTITLE: Development of Antigen Presenting Cells for adoptive immunotherapy in prostate cancer
AD Award Number: W8-XWH-5-- TITLE: Development of Antigen Presenting Cells for adoptive immunotherapy in prostate cancer PRINCIPAL INVESTIGATOR: Mathias Oelke,. CONTRACTING ORGANIZATION: Johns Hopkins
More informationProfiling HLA motifs by large scale peptide sequencing Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009
Profiling HLA motifs by large scale peptide sequencing 2009 Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009 HLA Background The human leukocyte antigen system (HLA) is the
More informationDarwinian selection and Newtonian physics wrapped up in systems biology
Darwinian selection and Newtonian physics wrapped up in systems biology Concept published in 1957* by Macfarland Burnet (1960 Nobel Laureate for the theory of induced immune tolerance, leading to solid
More informationPotential cross reactions between HIV 1 specific T cells and the microbiome. Andrew McMichael Suzanne Campion
Potential cross reactions between HIV 1 specific T cells and the microbiome Andrew McMichael Suzanne Campion Role of the Microbiome? T cell (and B cell) immune responses to HIV and Vaccines are influenced
More informationSupplementary Table 1. Functional avidities of survivin-specific T-cell clones against LML-peptide
Supplementary Table 1. Functional avidities of survivin-specific T-cell clones against LML-peptide pulsed T2 cells. clone avidity by 4-hour 51 Cr-release assay 50% lysis at E:T 10:1 [LML peptide, M] #24
More informationT cell recognition. Statistics & Dynamics of Functional Sensitivity
T cell recognition Statistics & Dynamics of Functional Sensitivity C Molina-París LEEDS APPLIED MATHEMATICS G Lythe LEEDS APPLIED MATHEMATICS A K Sewell CARDIFF MEDICAL BIOCHEMISTRY & IMMUNOLOGY L Wooldridge
More informationScott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION
Scott Abrams, Ph.D. Professor of Oncology, x4375 scott.abrams@roswellpark.org Kuby Immunology SEVENTH EDITION CHAPTER 13 Effector Responses: Cell- and Antibody-Mediated Immunity Copyright 2013 by W. H.
More informationThey determine if there will be an immune response. Determine functions associated with immune response, but not specific to Ag.
Appendices A They determine if there will be an immune response. Antigen receptor genes in T cells (TCR) and B cell (Ig) Determine functions associated with immune response, but not specific to Ag. MHC
More informationCD25-PE (BD Biosciences) and labeled with anti-pe-microbeads (Miltenyi Biotec) for depletion of CD25 +
Supplements Supplemental Materials and Methods Depletion of CD25 + T-cells from PBMC. Fresh or HD precultured PBMC were stained with the conjugate CD25-PE (BD Biosciences) and labeled with anti-pe-microbeads
More informationTCR, MHC and coreceptors
Cooperation In Immune Responses Antigen processing how peptides get into MHC Antigen processing involves the intracellular proteolytic generation of MHC binding proteins Protein antigens may be processed
More informationAttribution: University of Michigan Medical School, Department of Microbiology and Immunology
Attribution: University of Michigan Medical School, Department of Microbiology and Immunology License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution
More informationThe T cell receptor for MHC-associated peptide antigens
1 The T cell receptor for MHC-associated peptide antigens T lymphocytes have a dual specificity: they recognize polymporphic residues of self MHC molecules, and they also recognize residues of peptide
More informationWhy are validated immunogenicity assays important for HIV vaccine development?
Why are validated immunogenicity assays important for HIV vaccine development? There is a need to compare immunogenicity of products in the pipeline, when similar or different in class when developed by
More informationLecture 4. T lymphocytes
Lecture 4 T lymphocytes Objectives Mention the types of T cells List the Types of T helper cell (CD4+) Discuss the Activation of T cells Define Interleukins Distinguish the Super Ag from ordinary Ag Show
More informationSignificance of the MHC
CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ
More informationMajor Histocompatibility Complex (MHC) and T Cell Receptors
Major Histocompatibility Complex (MHC) and T Cell Receptors Historical Background Genes in the MHC were first identified as being important genes in rejection of transplanted tissues Genes within the MHC
More informationTargeting the Trimolecular Complex for Immune Intervention. Aaron Michels MD
Targeting the Trimolecular Complex for Immune Intervention Aaron Michels MD Disclosures Research Grant from Novartis. Research Grant from NovoNordisk. Take Home Points Type 1 diabetes is an immunologic
More informationStructure and Function of Antigen Recognition Molecules
MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and
More informationSupplementary Table 1. Data collection and refinement statistics (molecular replacement).
Supplementary Table 1. Data collection and refinement statistics (molecular replacement). Data set statistics HLA A*0201- ALWGPDPAAA PPI TCR PPI TCR/A2- ALWGPDPAAA PPI TCR/A2- ALWGPDPAAA Space Group P2
More informationHost Genomics of HIV-1
4 th International Workshop on HIV & Aging Host Genomics of HIV-1 Paul McLaren École Polytechnique Fédérale de Lausanne - EPFL Lausanne, Switzerland paul.mclaren@epfl.ch Complex trait genetics Phenotypic
More informationMutational Escape in HIV-1 CTL Epitopes Leads to Increased Binding to Inhibitory Myelomonocytic MHC Class I Receptors
Mutational Escape in HIV-1 CTL Epitopes Leads to Increased Binding to Inhibitory Myelomonocytic MHC Class I Receptors The MIT Faculty has made this article openly available. Please share how this access
More informationSUPPLEMENTARY INFORMATION
Supplementary Notes 1: accuracy of prediction algorithms for peptide binding affinities to HLA and Mamu alleles For each HLA and Mamu allele we have analyzed the accuracy of four predictive algorithms
More informationAntigen Presentation to T lymphocytes
Antigen Presentation to T lymphocytes Immunology 441 Lectures 6 & 7 Chapter 6 October 10 & 12, 2016 Jessica Hamerman jhamerman@benaroyaresearch.org Office hours by arrangement Antigen processing: How are
More informationEpitope Specific CD8 + T Cell Responses Predict Spontaneous Control of HIV Replication
Epitope Specific CD8 + T Cell Responses Predict Spontaneous Control of HIV Replication Florencia Pereyra, MD Partners AIDS Research Center Harvard Medical School Boston, MA Background HIV -1 elicits HLA
More informationHeterosubtypic immunity. Professor Ajit Lalvani FMedSci Chair of Infectious Diseases 14/07/2014
Protective cellular immune correlates against pandemic influenza: implications for universal vaccines 2 nd WHO Meeting on development and clinical trials of broadly protective influenza vaccines 5th 7th
More informationImmunology Lecture 4. Clinical Relevance of the Immune System
Immunology Lecture 4 The Well Patient: How innate and adaptive immune responses maintain health - 13, pg 169-181, 191-195. Immune Deficiency - 15 Autoimmunity - 16 Transplantation - 17, pg 260-270 Tumor
More informationAlessandra Franco MD PhD UCSD School of Medicine Department of Pediatrics Division of Allergy Immunology and Rheumatology
Immunodominant peptides derived from the heavy constant region of IgG1 stimulate natural regulatory T cells: identification of pan- HLA binders for clinical translation Alessandra Franco MD PhD UCSD School
More informationstaining and flow cytometry
Detection of influenza virus-specific T cell responses by intracellular by cytokine intracellular staining cytokine staining and flow cytometry Detection of influenza virus-specific T cell responses and
More informationMedical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University
Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1175194/dc1 Supporting Online Material for A Vital Role for Interleukin-21 in the Control of a Chronic Viral Infection John S. Yi, Ming Du, Allan J. Zajac* *To whom
More informationAdaptive immune responses: T cell-mediated immunity
MICR2209 Adaptive immune responses: T cell-mediated immunity Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will discuss the T-cell mediated immune response, how it is activated,
More informationIAS 2015 Towards an HIV Cure symposium Vancouver Immune recognition following latency reversal
IAS 2015 Towards an HIV Cure symposium Vancouver Immune recognition following latency reversal Marcus Altfeld Professor of Medicine Outline Immune recognition of HIV-1-infected cells Kinetics of antigen
More informationImmunology and the middle ear Andrew Riordan
Immunology and the middle ear Andrew Riordan The Immune system is NOT there; To baffle medical students To keep Immunologists in a job To encourage experiments on mice The Immune system IS there as a defence
More informationLG-APM s for MHC-Peptide Screening
LG-APM s for MHC-Peptide Screening S. Stanley*, I. A. Dodi* #, C.R. Evans*, S. J. Paston #, R.C. Rees*, C.J. Percival $, Glen McHale* and M.I Newton* *School of Biomedical & Natural Sciences, Nottingham
More informationNatural Killer Cells: Development, Diversity, and Applications to Human Disease Dr. Michael A. Caligiuri
Natural Killer Cells: Development, Diversity, November 26, 2008 The Ohio State University Comprehensive Cancer Center The James Cancer Hospital and Solove Research Institute Columbus, Ohio, USA 1 Human
More informationLESSON 2: THE ADAPTIVE IMMUNITY
Introduction to immunology. LESSON 2: THE ADAPTIVE IMMUNITY Today we will get to know: The adaptive immunity T- and B-cells Antigens and their recognition How T-cells work 1 The adaptive immunity Unlike
More informationMina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia
Mina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia AIDSvaccine conference, 14 th September 2011 IMGT HLA database July 2011 >5000 class
More informationAntigen capture and presentation to T lymphocytes
Antigen capture and presentation to T lymphocytes What T lymphocytes see Innate Immunity Immediately available or Very broad specificity rapidly recruited Adaptive Immunity Rare and naïve cells require
More informationPro5 MHC Pentamers. Dr. Jeremy Fry. Copyright ProImmune Limited All Rights Reserved
Pro5 MHC Pentamers Dr. Jeremy Fry Pro5 MHC Pentamers The most consistent technology for detecting antigenspecific T cells The most-cited commercially available MHC Multimer Used by most-leading academic
More informationUse of BONSAI decision trees for the identification of potential MHC Class I peptide epitope motifs.
Use of BONSAI decision trees for the identification of potential MHC Class I peptide epitope motifs. C.J. SAVOIE, N. KAMIKAWAJI, T. SASAZUKI Dept. of Genetics, Medical Institute of Bioregulation, Kyushu
More informationIMMUNOINFORMATICS: Bioinformatics Challenges in Immunology
Bioinformatics 1 -- Lecture 22 IMMUNOINFORMATICS: Bioinformatics Challenges in Immunology Most slides courtesy of Julia Ponomarenko, San Diego Supercomputer Center or Oliver Kohlbacher, WSI/ZBIT, Eberhard-Karls-
More informationFOCiS. Lecture outline. The immunological equilibrium: balancing lymphocyte activation and control. Immunological tolerance and immune regulation -- 1
1 Immunological tolerance and immune regulation -- 1 Abul K. Abbas UCSF FOCiS 2 Lecture outline Principles of immune regulation Self-tolerance; mechanisms of central and peripheral tolerance Inhibitory
More informationImmunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells
Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Andrew H. Lichtman, M.D. Ph.D. Department of Pathology Brigham and Women s Hospital and Harvard
More informationChapter 11 CYTOKINES
Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune
More informationAntigen Presentation and T Lymphocyte Activation. Shiv Pillai MD, PhD Massachusetts General Hospital Harvard Medical School. FOCiS
1 Antigen Presentation and T Lymphocyte Activation Shiv Pillai MD, PhD Massachusetts General Hospital Harvard Medical School FOCiS 2 Lecture outline Overview of T cell activation and the rules of adaptive
More informationMadhav V. Dhodapkar, Joseph Krasovsky, Ralph M. Steinman, and Nina Bhardwaj
Mature dendritic cells boost functionally superior CD8 + T-cell in humans without foreign helper epitopes Rapid PUBLICATION Madhav V. Dhodapkar, Joseph Krasovsky, Ralph M. Steinman, and Nina Bhardwaj Laboratory
More informationMHC class I MHC class II Structure of MHC antigens:
MHC class I MHC class II Structure of MHC antigens: MHC class I antigens consist of a transmembrane heavy chain (α chain) that is non-covalently associated with β2- microglobulin. Membrane proximal domain
More informationNarrowed TCR repertoire and viral escape as a consequence of heterologous immunity
Research article Narrowed TCR repertoire and viral escape as a consequence of heterologous immunity Markus Cornberg, 1,2 Alex T. Chen, 1 Lee A. Wilkinson, 1 Michael A. Brehm, 1 Sung-Kwon Kim, 1 Claudia
More informationAntigen Presentation to T lymphocytes
Antigen Presentation to T lymphocytes Immunology 441 Lectures 6 & 7 Chapter 6 October 10 & 12, 2016 Jessica Hamerman jhamerman@benaroyaresearch.org Office hours by arrangement Antibodies and T cell receptors
More informationWhat to Measure, How to Measure It
Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health Monitoring Memory T-cells: What to Measure, How to Measure It Pratip K.
More informationAntigen Recognition by T cells
Antigen Recognition by T cells TCR only recognize foreign Ags displayed on cell surface These Ags can derive from pathogens, which replicate within cells or from pathogens or their products that cells
More informationAdoptive cell therapy using genetically modified antigen-presenting cells
Adoptive cell therapy using genetically modified antigen-presenting cells Naoto Hirano Ontario Cancer Institute Princess Margaret Cancer Centre University of Toronto UofT-USP Oncology Conference November
More informationPage 4: Antigens: Self-Antigens The body has a vast number of its own antigens called self-antigens. These normally do not trigger immune responses.
Common Characteristics of B and T Lymphocytes Graphics are used with permission of Pearson Education Inc., publishing as Benjamin Cummings (http://www.aw-bc.com). Page 1: Introduction While B and T lymphocytes
More informationImmune responses in autoimmune diseases
Immune responses in autoimmune diseases Erika Jensen-Jarolim Dept. of Pathophysiology Medical University Vienna CCHD Lecture January 24, 2007 Primary immune organs: Bone marrow Thymus Secondary: Lymph
More informationCellular Immune response. Jianzhong Chen, Ph.D Institute of immunology, ZJU
Cellular Immune response Jianzhong Chen, Ph.D Institute of immunology, ZJU Concept of adaptive immune response T cell-mediated adaptive immune response I. Concept of immune response A collective and coordinated
More informationThe Adaptive Immune Response. B-cells
The Adaptive Immune Response B-cells The innate immune system provides immediate protection. The adaptive response takes time to develop and is antigen specific. Activation of B and T lymphocytes Naive
More informationFor questions 1-5, match the following with their correct descriptions. (24-39) A. Class I B. Class II C. Class III D. TH1 E. TH2
Questions Made by SI ATTENDEES!! :) Page 1 of 6 Student-Made Practice Exam Activity All questions, answers, and slide numbers are based off of Monday s SI activity, where students/attendees created possible
More informationNIH Public Access Author Manuscript Science. Author manuscript; available in PMC 2008 March 12.
NIH Public Access Author Manuscript Published in final edited form as: Science. 2006 October 6; 314(5796): 126 129. Cancer Regression in Patients After Transfer of Genetically Engineered Lymphocytes Richard
More informationSupporting Information
Supporting Information Valkenburg et al. 10.1073/pnas.1403684111 SI Materials and Methods ELISA and Microneutralization. Sera were treated with Receptor Destroying Enzyme II (RDE II, Accurate) before ELISA
More information