Immune gene profiles in Atlantic salmon (salmo salar L.) post-smolts infected with SAV3 by bath-challenge show a
|
|
- Ami Freeman
- 6 years ago
- Views:
Transcription
1 Immune gene profiles in Atlntic slmon (slmo slr L.) post-smolts infected with SAV3 y th-chllenge show delyed response nd lower levels of gene trnscription compred to injected fish L. J. Moore 1, J. Jrungsripisit 1,3, T. O. Nilsen 2, S. Stefnsson 3, G. L. Trnger 1, C.J. Secomes 4, H. C. Morton 1 nd S. Ptel 1* 8 1 Institute of Mrine Reserch, P.O. Box 1870, Nordnes, 5817 Bergen, Norwy 9 2 Uni Reserch Environment, Uni Reserch, Thormøhlensgt. 49B 5006 Bergen, Norwy 10 3 Deprtment of Biology, University of Bergen, P.O. Box 7803, 5020 Bergen, Norwy Scottish Fish Immunology Reserch Centre, University of Aerdeen, Zoology Building, Tillydrone Avenue, Aerdeen AB24 2TZ, Scotlnd, UK 13 *corresponding uthor 14 Contriuted eqully 15 Keywords Slmonid lphvirus, pncres disese, gene expression, interferon, th immersion, infection route. 18
2 Highlights: 1. The route of SAV3 infection ffects the innte response in Atlntic slmon postsmolts recently trnsferred to sewter 2. SAV3 th immersion chllenge induces lower nd more sustined innte immune response compred to injection chllenge 3. Recently smoltified Atlntic slmon hve poor interferon response to slmonid lphvirus. 26
3 Astrct Slmonid lphvirus (SAV) cuses pncretic disese (PD) in slmonids in Northern Europe which results in lrge economic losses within the quculture industry. In order to etter understnd the underlying immune mechnisms during SAV3 infection Atlntic slmon post-smolts were infected y either i.m.-injection or th immersion nd their immune responses compred. Anlysis of virl lods showed tht y 14 dpi i.m.-injected nd th immersion groups hd 95.6% nd 100% prevlence respectively nd tht oth groups hd developed the severe pthology typicl of PD. The immune response ws evluted y using RT-qPCR to mesure the trnscription of innte immune genes involved in the interferon (IFN) response s well s genes ssocited with inflmmtion. Our results showed tht IFN trnscription ws only wekly upregulted, especilly in the th immersion group. Despite this, high levels of the IFN-stimulted genes (ISGs) such s Mx nd viperin were oserved. The immune response in the i.m.-injected group s mesured y immune gene trnscription ws generlly fster, nd more pronounced thn the response in the th immersion group, especilly t erlier time-points. The response in the th immersion group strted lter s expected nd ppered to lst longer often exceeding the response in the i.m-injected fish t lter time-points. High levels of trnscription of mny genes indictive of n ctive innte immune response were present in oth groups Introduction Slmonid lphvirus (SAV) lso known s slmon pncres disese virus (SPDV) cuses pncretic disese (PD) in Atlntic slmon nd rinow trout in fresh nd slt wter in Northern Europe. There re severl su-types (SAV1-6) which show distinct geogrphicl distriutions [1, 2]. Until recently, ll Norwegin PD outreks were shown to e cused y
4 SAV3 [3]. In 2010, SAV2 ws introduced to Norwy nd in the lst few yers this isotype hs een shown to e responsile for n incresing numer of PD outreks [4]. SAV is positive sense, single strnded RNA virus tht cn ct s n mrna nd e directly trnslted fter entry. The 12k genome hs two open reding frmes encoding 4 structurl, cpsid/memrne proteins (E1-3 nd 6K) nd 4 non-structurl proteins (nsp1-4) SAV cuses inflmmtion nd cellulr necrosis in trget orgns, initilly in exocrine pncres followed y hert nd then skeletl muscle. Mortlity cn e difficult to reproduce experimentlly, ut ppers to e excerted y stressors such s fish trnsport nd the hndling ssocited with nti-lice tretment [5]. In humns lphvirus infections re controlled y oth humorl nd cellulr immune responses, ut the innte immune response, strting with interferon (IFN) production is centrl to controlling the cute phse [6-8]. The clssicl IFN response promotes nd mintins n nti-virl stte in two steps, with the first step resulting in the production of IFN. The second step mintins n nti-virl stte y stimulting the trnscription of myrid of IFN stimulted genes (ISGs) of which there re over 300 known in mmmls [9]. Incresed trnscription of interferon in fish hs een oserved in SAV infections nd other virl infections [10-13]. The interferon response hs een studied in experimentl SAV infections instigted y oth injection nd cohittion [14-16] In mmmls the pthwy from virus ttchment nd internliztion to chnges in gene trnscription including interferon production hs een well chrcterised [17, 18]. Since mny of the sme genes hve teleost counterprts it should e possile to study this pthwy in similr detil during SAV infection of Atlntic slmon [12]. The entry route of SAV in Atlntic slmon is unknown, ut once SAV hs gined ccess to permissive cells, molecules detecting the single strnded virl RNA (ssrna) form the first line of defence. As pthogen
5 ssocited moleculr pttern (PAMP), virl ssrna intercts with pttern recognition receptors (PRRs) such s toll-like receptors (TLRs) triggering IFN production. The ccompnying inflmmtory response cn e oth eneficil nd detrimentl to the host. Mny of the genes involved in these pthwys hve een chrcterised in slmonids nd hve previously een shown to e modulted during virl infections [14-16, 19]. In humn lphvirus infections ptients cn e left with chronic polyrthrlgi [20] nd in fish, recovered individuls often fil to thrive nd cn exhiit poor fillet qulity t slughter [21] We hve recently estlished th-immersion infection model for SAV3 in Atlntic slmon in sewter [22]. This model provides oth nturl route of infection nd synchronistion of the time of infection, y limiting the exposure time to 6 hours. Also, since in Norwy SAV3 most commonly ffects Atlntic slmon during their first summer, which cn e shortly fter se trnsfer for spring smolts, it ws lso relevnt to exmine the immune response to this virus shortly fter sewter trnsfer In the study presented here, we hve compred the trnscription levels of pnel of innte immune genes mny of which hve een shown to e modulted during virl infections in fish. The immune gene trnscription ws compred etween fish infected with SAV3 vi th-immersion nd those infected y i.m.-injection. Our results reveled importnt differences in the kinetics nd durtion of the immune responses triggered y SAV3 infection following either th-immersion or i.m.-injection Mterils nd Methods Atlntic slmon post-smolts (verge weight 41 g) were infected with SAV3 y i.m. injection (IM) with10 4 TCID50 per fish or y th immersion (BI) 2 weeks fter trnsfer to sewter. Slinity ws mintined t 34.5 for whole experimentl period. Se wter contining virus
6 for the BI group ws produced y shedder fish injected with 10 4 TCID50 SAV3 per fish one week efore the experiment strted. A third group ws injected with non-infected cell culture superntnt s control group (CT). They were held in triplicte tnks t 12 ºC nd 8 fish were smpled from ech tnk of 65 fish. This corresponded to 24 fish from ech tretment group, t 1, 3, 7, 14, 21 nd 28 dpi (Fig. 1) The virus prepred for use in this experiment ws susequently discovered to e contminted with infectious pncres necrosis virus (IPNV). However, hed kidney smples from BI fish were negtive for IPNV RNA t ll smpling points nd lthough 25% of the IM fish were positive the Ct vlues were on verge 36 indicting very low levels of virus. Thus, it is unlikely tht the IPNV present hd mjor effects on the interprettion of the results in this study More detils regrding the fish, virus nd experimentl procedures hve een descried in our previous study [22].
7 Bth immersion dose Sewter (1 litre) ws smpled from ech of the three shedder tnks on the dy of th immersion. It ws filtered, concentrted nd eluted in lysis uffer [22]. The SAV3 RNA mesured in these sewter smples using one-step RT-qPCR ssy represents the th immersion dose. The verge Ct vlue of 1 litre of filtered/concentrted sewter from shedder tnks ws 28, nd the Ct vlue of 100 µl of the SAV3 stock used to inject the IM group, ws This SAV3 stock ws diluted 1:100 efore use, pproximting Ct vlue of 28. Since the fish oth drink sewter nd filter it through their gills during the 6 hour exposure there ws proly little difference etween the IM dose nd the BI exposure. 2.2 Smpling nd RNA extrction Pncres nd hert tissue smples were fixed nd processed for histologicl exmintion from 4 of the 8 fish smpled t 7, 14 nd 21 dpi [22]. Hert nd hed kidney tissue smples for RTqPCR nlysis were flsh frozen in liquid nitrogen nd totl RNA isolted using Trizol s previously pulished [22]. RNA concentrtion nd qulity ws estimted using Nnodrop ND Five percent of the RNA smples from tissues were rndomly chosen nd checked for integrity on Bionlyser (Agilent Instruments), resulting in RINs of 9 for ll smples tested. 2.3 cdna synthesis nd RT-qPCR One-step RT-qPCR (AgPth, Amion) ws employed to detect SAV3 RNA in hert using modified TqMn nsp1 ssy [23] with sense proe. Hert hs een previously een shown to e trget orgn for SAV where the virl RNA persists longest indicting infection long fter the reltively short viremic phse nd recovery of histopthologicl chnges in the pncres [24]
8 cdna ws trnscried from 1 µg totl hed kidney RNA in 20 μl rection using qscript SuperMix (Qunt Biosciences) including priming with oth rndom hexmers nd OligodT s descried in the mnufcturer s instructions. cdna ws diluted 1:10 efore use s RTqPCR on pooled cdna showed tht this ws n optiml dilution. Assys for TLR7, TLR81, MyD88, MDA5, LGP2, IRF7, IFN, Mx, IFNγ, CXCL11-L1, IL-1β, CRFB5, IL-8 nd IL- 4/13A were designed for use in this study. In ddition, n ssy for viperin ws dpted from previously pulished study [14]. All primers nd ssy dt re listed in Tle 1. All hed kidney cdna smples were nlysed with the ove mentioned ssys. Assys were designed with primers on 2 exons or where t lest one primer spnned n exon oundry. Some ssys were generic, such s tht encoding the IFN receptor chin CRFB5 which ws designed to detect ll 3 isoforms, nd c [25]. The Mx ssy detects Mx1, 2 nd 3, wheres the LGP2 ssy would not detect LGP2 [26]. The TLR8 isotypes (TLR81 nd 2) were undetectle in the pooled cdna used to screen immune ssys nd further isotype of TLR8 (TLR82) hd etween 10 nd100 times less trnscription, which is greement with in vitro studies [27]. Hence only TLR81 [28] ws chosen for immune gene nlysis in this study. Activtion of oth the innte immune response nd of inflmmtory genes hs een noted previously nd the genes chosen for nlysis helped evlute these importnt pthwys. All ssy products were visulized on 3% MetPhor Agrose gel (Lonz) nd sequenced to verify the specificity of the ssy. Efficiencies were lso clculted for ech primer set using triplictes of five point, 4 x dilution series of the pooled cdna. Elongtion fctor 1A [29] ws used for normliztion nd is considered the est option of severl endogenous reference genes evluted for use with Atlntis slmon during SAV infection [30] RT-qPCR ws run in 384 pltes using Brillint III Ultr-Fst SYBR Green mster mix (Agilent) nd Applied Biosystems 7900HT Fst Rel-Time PCR system in 7 µl rection
9 volume contining 2 µl diluted cdna nd 400 nm of ech primer. The running conditions were s recommended y the mnufcturer nd included melting curve nlysis for ech run Dt Anlysis The Ct vlues were normlized using Ct vlues from the elongtion fctor 1A ssy run on the sme plte for ech individul (ΔCt). Fold chnge of trnscription for ech gene ws clculted y sutrcting normlized Ct vlues for ech gene from control fish smpled efore dy 0 nd used s clirtors (2 -ΔΔCt ) [31]. Outliers were present in ll groups, ut not removed from ny of the dt sets for either nlysis or presenttion in the figures s they represent the rel iologicl diversity of these groups One-wy ANOVA ws clculted fter trnsforming the dt (+1, log10) followed y Neumns Keul s post hoc test using Sttistic version 12.7 to exmine differences etween tretments nd tnks. Although these methods use verges in their clcultions ecuse of the symmetric distriution of the dt, medins were used for discussion nd visul representtion of the dt. 174 Figures hve een prepred using Prism 6.0 (Grphpd.com) nd Excel Results Identifiction of differences in the infection sttus nd in the immune response etween the IM nd BI groups were nlysed y estimtion of the SAV3 RNA in hert tissue nd y mesurement of 15 immune genes in hed kidney tissue using RT-qPCR. There were no significnt chnges in the trnscription of the immune genes mesured etween the experimentl groups t 1 or 3 dpi, nd therefore 1 dpi results re not shown. The elongtion
10 fctor used for normliztion of trnscription hd n verge Ct vlue of 18.3 t 3 dpi rising slightly to 18.5 t 28 dpi with 90% of ll smples lying etween 17.5 nd PD sttus PD sttus ws determined y nlyzing the trnscription of SAV3 RNA in hert tissue nd y histologicl exmintion of hert nd pncretic tissue smples. The percentge prevlence ws clculted from the numer of fish per group t ech time point tht were positive for SAV3 RNA in hert tissue (Fig. 2). Prevlence ws higher in the IM group t 3 nd 7 dpi, with 12 (50%) nd 21(87.5%) of 24 fish positive for SAV3 respectively, compred to only 2 (8.3%) nd 16 (66.7%) of 24 fish in the BI group t these two erly time-points (Fig. 2A). Additionlly, the mount of virus (SAV3 RNA) ws higher in the IM group thn in the BI group t these time-points (Fig. 2B). By 14 dpi the prevlence in the IM nd BI groups ws 95.8% (23 of 24) nd 100%, respectively (Fig. 2A). At lter time-points, when ll the BI group fish were positive (100% prevlence), only 1-2 fish were negtive in the IM group (Fig. 2A). Interestingly, lthough oth virl lod nd prevlence ws lower in the BI group thn in the IM group until 14 dpi, the BI group showed significntly higher mounts of SAV3 t 21 nd 28 dpi (p 0.05, Fig. 2B). At 14 dpi lthough prevlence ws mximl in oth groups, virl lod ws still lower in the BI group. Histologicl exmintion showed loss of exocrine pncretic tissue nd cell infiltrtion t 7 nd 14 dpi in the IM nd BI groups, respectively (Figs. 2C nd D). Hert tissue showed lesions typicl for PD with necrotic foci present t 14 nd 21 dpi in IM nd BI groups respectively (Figs. 2E nd F). We lso noted tht four (3.3%) of the control fish tested positive for nsp1. This ws most likely due to contmintion during smpling or nlysis, since these fish showed no increse in immune gene trnscription nd pre-screening prior to the strt of the experiment hd shown these fish to e negtive for oth SAV nd IPNV.
11 Immune gene trnscription Hed kidney smples were nlysed for 15 genes ssocited with the innte immune response. The IM group showed pek up-regultion t 7 dpi for mny genes. Conversely, the BI group filed to up-regulte relevnt immune genes s quickly, ut y 21 or 28 dpi when the trnscription of mny genes in the IM group hd returned to control levels the BI group exhiited pek fold increses for mny of the sme genes (Figs. 3-5). Interestingly, fish negtive for SAV3 in hert tissue frequently showed immune gene trnscription levels in hed kidney comprle to positive individuls. This phenomenon could e seen t 3 dpi in the IM group nd t 7 dpi in the BI groups, when prevlence ws 50% nd 66.6% respectively (S.1). Since prevlence reched 100% for oth groups fter this erly phse, ll fish re included in the nlyses nd presenttion of the immune gene results Genes encoding PRRs Two genes encoding PRRs ssocited with endosoml memrnes, TLR7 nd TLR81, nd two PRRs tht reside in the cytosol, LGP2 nd MDA5, were exmined. Both TLRs were upregulted with mximum trnscription t 7 dpi in the IM group, nd t 21 dpi in the BI group, lthough TLR7 showed higher trnscription thn TLR81 for oth groups (Fig. 3). TLR7 peked with 7.2-fold increse in the IM group t 7 dpi nd with 5.7-fold increse in the BI group t 21 dpi. MDA5 nd LGP2 tht interct with virl dsrna in the cytoplsm showed similr ptterns of trnscription. LGP2 ws one of the genes showing the highest fold increse in trnscription, with 29 nd 21-fold increses in IM t 7 dpi, nd BI t 14 dpi respectively (Fig. 3). MDA5 showed more moderte fold increses of 5.8-fold t 7 dpi in the IM group nd 4-fold t 21 dpi, in BI group. All these PRRs were significntly highly upregulted in oth infected groups compred to the CT group t 7, 14 nd 21 dpi. Mny of the genes were lso significntly differently regulted etween the IM nd BI groups (S.3)
12 MyD88 nd IRF7 The uiquitous dptor molecule MyD88, ws the most highly constitutively expressed immune gene exmined. The trnscription of MyD88 peked t 7 dpi for the IM group nd t 21 dpi for the BI group (Fig. 3). The downstrem trnscription fctor, IRF7 showed similr profile to the PRRs with mximum fold increse of 9.8 in IM t 7 dpi, nd 8.5 in BI groups, t 21 dpi (Fig. 3) Genes encoding immune-modulting proteins Genes encoding effector molecules such s viperin nd Mx were the most highly upregulted genes mesured in this study. Some individuls in the IM group showed more thn 200-fold increse t 7 dpi for viperin, while the medin vlue ws 100-fold. The mximum trnscription for viperin in the BI group ws 35-fold t 14 nd 21 dpi. Mx peked t pproximtely 92 nd 48-fold t 7 nd 14 dpi, in IM nd BI groups respectively. These genes lso followed pttern of mximum up-regultion of trnscription t 7 dpi for the IM group while the BI group hd lter, lower, ut sustined up-regultion of trnscription of oth viperin nd Mx. (Fig. 4) IFN s one of the min immune-modultors responsile for stimulting mny ISGs ws y contrst only modertely incresed (5.4-fold t 7 dpi in IM group) nd ws never more thn 2-fold incresed in the BI group Genes encoding cytokines ssocited with the inflmmtory response Genes ssocited with the inflmmtory response IFNγ nd CXCL11-L1 were more highly trnscried in the IM thn in the BI group. The IM group peked t 7dpi where trnscription of IFNγ ws incresed 5.3-fold nd CXCL11_L1 8.3-fold (Fig. 5). Some individuls in the BI group showed high fold trnscription increses of these genes t 7 nd 14 dpi, ut the highest medin vlues were 1.8 nd 2.7-fold t 14 dpi for IFNγ nd CXCL11-L1 respectively (Fig.
13 ). IL-1β, tht we hypothesised my lso e involved in the inflmmtory response to SAV3, did not disply incresed trnscription t ny time point in ny of the experimentl groups (S.2). However, t 14 nd 21 dpi there were significnt differences in IL-1β trnscription levels etween the control group nd the infected groups coinciding with severe necrosis, oserved histologiclly in the pncres (Figs 2C nd 2D nd S.3). The trnscription of CRFB5 (encoding n IFN type I receptor chin), IL-8 nd IL-4/13A showed negligile regultion during the smpling period in ll tretment groups (S.2 nd S.3) Mgnitude of trnscription All the genes ssyed nd their reltive trnscription levels etween the tretment groups re compred using one-wy ANOVA. The trnscription of IL-1β, CRFB5, IL-8 nd IL-4/13A ws reltively unregulted throughout the experiment in ll tretment groups (S.2 nd S.3). At 7, 14 nd 21 dpi ll other genes in oth infected groups were significntly upregulted compred to the CT group (p 0.01) (S.3). At 7 dpi, when IM genes were t their pek ll genes hd significntly higher fold trnscriptions thn oth CT nd BI groups (p 0.01, except for LGP2, p 0.05). At 14 dpi the fold increse in trnscription for oth infected groups ws significntly higher thn in the CT group (p 0.001, except for IM vs CXCL11- L1, p 0.01). However, t 14 dpi mny genes displyed similr fold chnges etween the infected groups since the fold chnges in trnscription of genes in the IM group were mostly decresing nd in the BI group they were mostly incresing (Figs. 3-5). Thus, t 14 dpi only TLR7 showed significnt difference (p 0.001) etween the infected groups (S.3). At 21 dpi the trnscription of genes in the BI group hd significntly higher fold increses thn the IM group for ll genes (p 0.001). At 28 dpi some genes including, TLR7, MDA5 nd IRF7 were still significntly more highly trnscried in oth infected groups compred to the CT group.
14 Tnk effects Some of the fish in one of the triplicte tnks in the IM group t 7 dpi displyed strong upregultion of IFN, viperin, nd MyD88 together with much lower trnscriptions of Mx, LGP2 nd IFNγ compred to individuls from the other 2 replicte tnks. This is pprent y the wide rnge of vlues t this time-point in the IM group (Figs. 3-5). The IM group t 7 dpi ws the only time point where this phenomenon ws present. It is possile tht y smpling t 3, 7 nd 14 dpi similr picture of gene trnscription ws present efore or fter the 7 dpi smpling, in the other 2 replicte tnks. Also 3 of the 8 individuls smpled from this tnk were negtive while the other 2 tnks showed 100% prevlence indicting tht the fish in this tnk were displying slightly delyed disese progression. However, if this tnk is removed from susequent sttisticl nlysis only LGP2 is ffected eing then not significntly different to the BI group t this time-point (results not shown) Correltion etween virl lod nd immune gene trnscription Since the infection y SAV ws driving the immune response, some positive correltion etween the virl lod (Ct vlue of nsp1) nd the mgnitude of trnscription (fold increses) might e expected, for t lest some of the immune genes mesured. However, this ws rrely the cse nd only four genes (IFNγ, CXCL11-L1, MDA5 nd Mx) t two time-points (7 nd 21 dpi) showed correltion of R 2 > 0.5 (Tle 2). Interestingly, the correltion with the IM group ws lwys lower thn for the corresponding gene in the BI group (Tle 2) regrdless of how poor tht correltion ws.
15 Discussion We hve studied immune gene responses to the Norwegin su-type of SAV in Atlntic slmon post-smolts, recently trnsferred to sewter, using newly estlished th immersion model nd compred it to n i.m. infection model. We hve mesured the trnscription of 15 genes involved in the innte immune response, prticulrly those involved in the clssicl interferon response leding to the trnscription of mny ISGs. There re cler differences in the immune gene trnscription etween fish infected y i.m. injection nd those infected y th immersion. The defined time-of-infection, the similr dose given to oth infection groups nd the lrge numer of individul fish tht were smpled gives this study the sttisticl strength to explore the mechnisms in detil SAV sttus The mount of SAV RNA present in hert tissue incresed during the experimentl period in oth infected groups, nd lmost 100% prevlence ws pprent in hert from oth groups y 14 dpi. Recent nlyses in our lortory indicte tht the rnge of Ct vlues reported here (etween 20 nd 30) corresponds to nsp1 copy numers in the rnge 4 x 10 2 to 4 x 10 5 (dt not shown) There ws little difference in the trnscription of most of the genes etween positive nd negtive fish t erlier smpling points (S.1) possily ecuse lthough the fish were infected, the virl repliction hd not yet reched detectle level in hert tissue. Fish which tested negtive y RT-qPCR could still hve een viremic, s previously demonstrted [22, 32]. Moreover, oth infected groups reched 100% prevlence t lter time-points indicting tht ll fish were infected nd were responding with individul vrince.
16 A dose of 10 4 TCID50 SAV3 per fish in the IM group induced mximum levels of immune gene trnscription t 7 dpi, wheres the mximum virl lod ws t 14dpi. In the BI group, mximum levels of trnscription were oserved t 14 or 21 dpi more ccurtely coinciding with the pek virl lod t 21 dpi. The nturl route of infection in the BI group shows etter correltion etween the mximum levels of gene trnscription nd the peks of oth virl lod nd prevlence. This is supported y the higher correltion coefficients etween the SAV3 RNA levels nd the trnscription of immune genes in the BI group. Correltion coefficients where R 2 >0.5 were only present in the BI group. In greement with our BI group result, other studies using cohittion model hve lso concluded tht the mximum trnscription of innte immune genes occurs t the sme time s mximum virl lod [16, 33] The expression of immune genes over time in hed kidney during SAV infections is dose dependent. The dose of 10 4 TCID50 SAV3 used in the present study produced mximl trnscription t 7 dpi in the IM group nd 14 or 21 dpi for the BI group. When high intrperitonel injection dose of 10 7 TCID50 SAV1 ws used, mximl trnscription followed t 3 dpi [15], wheres cohittion model using only 10 3 TCID50 SAV3 in shedder fish took 3.5 weeks to oserve increses in gene trnscription [34]. Johnsen et l. [34] lso stte tht the grdul increse of positive fish is typicl of cohittion infection, wheres our study clerly shows rpid ccumultion of positive fish during th chllenge model comprle to i.m. models. In order to evlute the immune response in ll its complexities it is clerly dvntgeous to hve n infection model with synchronized time-of-infection which is of sufficient infectivity to chieve 100% prevlence during the initil stge of infection. Lower doses in n infection model cuse stggered rther thn synchronized infection due to infected fish shedding virus nd exposing nïve fish not infected t time zero [32]. This mkes it difficult to relte the immune response to the time of infection. In the
17 present study, compring the overll trnscription ptterns (represented y trend-lines on the figures) for oth chllenge models consistent ptterns for most genes cn e seen, indicting single synchronized point of infection (Figs. 3-6). The synchronized nture of the 2 infected groups is further illustrted y the rther nrrow rnges t mny time-points. Thus, even smll fold chnges in the trnscription of immune genes etween the experimentl groups cn e significntly different (eg etween IM nd BI groups t 14 dpi for TLR7, Fig 3 nd tle 3) The nti-virl response The i.m. dministrtion of the infective dose pprently triggered much stronger initil immune response with high, ut trnsient fold increses in the trnscription of mny genes. In the BI group, the SAV infection took longer to cuse elevted trnscription of mny of the genes. This indictes tht the virus, due perhps to the route of infection, took longer time to mplify in the host nd rech the virl RNA lods necessry to trigger n immune response. This delyed increse in the trnscription of the immune genes in the BI group ws possily the cuse of the high virl lods tht exceeded virl lods in the IM group t 21 nd 28 dpi nd of the typicl PD histopthology seen t lter time-points. Even though the immune response in the IM group ws reltively swift nd strong, it still filed to prevent disese progression nd the development of the typicl PD pthology, The mgnitude of IFN trnscription in the IM group ws similr to previous in vivo studies which lso showed progression to PD [16, 35]. The negligile IFN response in the BI group hs een oserved previously in cohittion infections with SAV [14]. In recent study, recominnt IFN pplied simultneously with SAV3 to TO cell culture ws le to induce the rpid trnscription of ISGs resulting in 20-fold reduction of SAV3 RNA compred to cells not treted with IFN [36]. Clerly the more rpid the induction of IFN the etter
18 protection the host hs ginst SAV. Alterntively, IFN production my e locked or inhiited in our study since immune suppression or evsion y terrestril lphviruses is well documented [37, 38]. Similrly, SAV3 hs recently een shown to modulte the JAK/STAT pthwy in vitro, cusing down-regultion of oth Jk2 nd Tyk2 (downstrem signling components of the IFN receptor) tht could inhiit trnscription of ISGs [36]. Slmonids lso possess mny other type I IFN genes including IFN nd IFNc tht were not mesured in the current study, ut hve een shown to increse more drmticlly thn IFN during virl infection [39]. Hence, it is possile tht these other IFNs could hve een orchestrting the sustined increses of mny genes seen t 21 dpi in the BI group The induction of IRF7 is linked to IFN production nd since IRF7 ws highly expressed y oth infected groups in this study, the IFN production could e vi this pthwy. However, IFN trnscription in the IM group ws trnsient (dropping t 14 dpi) despite high trnscription of PRRs nd IRF7 t this time-point, suggesting inhiition y virl mechnisms The IFN receptor gene CRFB5 displyed only minor chnges in trnscription in this study. This hs lso een oserved for the IFN receptor 2 gene (IFNR2) [35] Of the two endosoml PRRs mesured, TLR7 ws more highly expressed thn TLR81, lthough TLR81 hd pproximtely 5 to10-fold higher resting/constitutive trnscription. Conversely, it hs recently een reported tht SAV3 infection of TO cells, which hve dendritic/mcrophge-like gene expression profile, upregulted only TLR8 nd TLR3 nd not TLR7, during SAV3 infection [40] It hs een suggested tht the cytosolic virl RNA sensing molecules (LGP2 nd MDA5) ct in prllel nd do not compete llowing high levels of oth during virl infection [26]. However, in this study the trnscription of LGP2 ws much higher thn tht for MDA5 in oth infected groups t ll time-points, suggesting tht MDA5 ws either inhiited y LGP2
19 or did not interct with SAV3 RNA sufficiently to cuse up-regultion. The ltter explntion seems unlikely since MDA5 hd the strongest correltion with levels of SAV3 RNA of ll the immune genes studied. Similrly, in previous study LGP2 exhiited higher fold increses in trnscription thn MDA5 in response to IFN nd SAV in vitro [41] The two key molecules tht might hve een expected to protect ginst PD, viperin nd Mx were oth highly, ut trnsiently expressed in the IM group. Conversely, trnscription of oth Mx nd viperin ws modertely incresed in the BI group compred to the IM group. Grove et l. [14] showed tht fish reltively resistnt to ISAV hd significntly higher constitutive expression of mny relevnt genes in hed kidney such s viperin, Mx, TLR8, CXCL11-L1 nd IFN in cohittion experiment using SAV3. This is in greement with in vitro experiments where IFN ws only found to e protective if present efore infection [42, 43]. Thus despite rpid induction of these effector genes in the IM group, in this study, it ws pprently too lte to control the virus sufficiently to prevent disese development. ISG induction of oth Mx nd viperin hs lso een reported in fish cell lines without IFN involvement [44] mechnism tht could ccount for the reltively high levels of these 2 trnscripts in the sence of roust IFN response in the present study Due to the severe necrosis seen histologiclly in pncres nd hert especilly t lter timepoints, inflmmtory genes were considered of interest. There ws incresed trnscription of IFNγ nd CXCL11-L1, ut reltively little for IL-1β similr to slmon infected ISAV or IPNV [45]. IFNγ cuses trnscription of CXCL11-L1 nd the regultion of these genes in this study showed similr profiles which is comprle to erlier studies [14]. In ddition, lthough PD is systemic disese, this could lso e due to locl effects since the inflmmtion is occurring in hert nd pncres, while these immune genes were mesured in hed kidney.
20 There ws miniml regultion of IL-4/13A in this study. In recent study Wng et l. found tht IL-4/13B ws more ctively trnscried during infections while IL-4/13A hd higher constitutive expression perhps explining why there ws miniml regultion of IL-4/13A in the present study [46] Infections with SAV do led to the production of neutrlizing ntiodies tht oth protect nd cler viremi, [47, 48], ut the delyed nture of the dptive response in ectothermic teleosts mkes the innte response pivotl in immune defence. Furthermore, in vitro experiments with CHIKV [49] hve demonstrted tht high trnscription of host ISGs re not trnslted into incresed levels of the corresponding proteins nd similr mechnism could ccount for the severe pthology seen in the present study. There re few studies ddressing the teleost response to virl infection t protein level. Brcelnd et l. [50] hve nlysed ser of PD infected individuls, ut not immune prmeters. Mesurement of neutrlizing ntiodies is oth relevnt nd widespred [51-54], nd the presence of Mx protein hs een semi-quntittively nlysed in hert during SAV1 infection using immuno-histochemistry [15], ut clerly there is derth of quntittive protein nlysis of innte immune effectors such s Mx nd viperin in teleosts Smoltifiction sttus The fish infected with SAV3 in this study hd recently een trnsferred to sewter (experiment strt 2 wpt) nd therefore their immune responses could conceivly hve een compromised due in prt to the osmotic chllenges of dpting to new life in sewter. Chnges in oth immune cells nd ntiody levels ssocited with smoltifiction hve een previously reported [55, 56]. There is lso evidence tht during smoltifiction fish hve rised trnscription levels of oth IFN nd Mx tht could protect smolts from virus infection during this period [57]. However, these uthors lso reported tht these increses re negted shortly
21 fter sewter trnsfer, nd if present, were clerly not le to llevite infection in the present study. Gill ATPse levels were mesured in 12 fish from ech time-point nd ech group nd were within the expected rnge [22] indicting these groups of fish were good post-smolts. Differences in susceptiility nd immune gene trnscription hve een noted etween prr nd smolts for other viruses such s piscine orthoreovirus [19] nd ISAV [58]. Very recently mssive down-regultion of immune genes hs een reported immeditely following sewter trnsfer [59]. Thus, it cnnot e ruled out tht the stress involved in mintining osmotic prmeters my e one of the contriuting fctors to the poor immune response seen during these SAV3 infections Summry There re cler temporl differences in the immune response etween these two infection chllenge models. Fish in oth infected groups developed typicl PD pthology nd high SAV3 levels. By 14 dpi lmost ll fish in oth the infected groups were positive for SAV3. Histologicl exmintion of hert nd pncres showed typicl PD histopthology with dely of pproximtely 1 week for similr pthology to e oserved in the BI group. None of the immune genes in either infected group showed iologiclly significnt increses in trnscription until 7 dpi. In the IM group, most of the immune genes evluted showed fster, more pronounced, ut trnsient response. Conversely, in the BI group, immune gene trnscription exhiited slower, less pronounced, ut more prolonged response, often exceeding the IM response t the lter time-points for the sme genes. Therefore, the th immersion model more closely representing the nturl route of infection nd using n pproprite exposure to SAV for defined time period is useful model in which to study the immune response to SAV in slmon. We hve mesured the trnscription of genes involved in the pthwys leding to interferon secretion nd the production of ISGs, ut these re
22 difficult to compre to previous studies due to differences in oth dose nd experimentl design. It is pprent tht the immune response in these groups of infected fish ws insufficient to prevent the development of PD nd it is likely tht the recent trnsfer to sewter lso compromised their immune responses. To further elucidte immune responses during SAV infections the investigtion of protein levels for some of these immune genes is needed. Additionlly, it will e of gret interest to exmine the humorl nd cellulr dptive response in these groups of infected fish Acknowledgements This reserch ws funded y the Reserch Council of Norwy, Reserch grnt # /E40. The following people re thnked for their expert technicl ssistnce nd help during smpling; Ann Ctherine Bårdsgjære Einen, Stig Mæhle, Ingrid Fiksdl nd Mirim Cstillo Furné. Thnks lso to Ivr Helge Mtre t Mtre Reserch Sttion, IMR for the production of fish nd Jochim Nordø for fish husndry nd help with smpling. Øystein Evensen, Norwegin University of Life Sciences, is cknowledged for providing the SAV3 isolte. 480 Arevitions 481 cdna complementry DNA 482 IFN Interferon 483 IPNV Infectious pncres necrosis virus 484 ISG Interferon stimulted genes 485 RT-qPCR reverse trnscriptse quntittive polymerse chin rection 486 PPR pttern recognition receptor
23 PAMP pthogen ssocited moleculr pttern 488 SAV slmonid lphvirus 489 TCID50 50% tissue culture infective dose 490 TLR toll-like receptor
24 References [1] D.A. Grhm, E. Fringuelli, H.M. Rowley, D. Cockerill, D.I. Cox, T. Turnull, Geogrphicl distriution of slmonid lphvirus sutypes in mrine frmed Atlntic slmon, Slmo slr L., in Scotlnd nd Irelnd, J Fish Dis 35 (2012) [2] E. Fringuelli, H.M. Rowley, J.C. Wilson, R. Hunter, H. Rodger, D.A. Grhm, Phylogenetic nlyses nd moleculr epidemiology of Europen slmonid lphviruses (SAV) sed on prtil E2 nd nsp3 gene nucleotide sequences, J Fish Dis 31(11) (2008) [3] K. Hodnelnd, A. Brtlnd, K.E. Christie, C. Endresen, A. Nylund, New sutype of slmonid lphvirus (SAV), Togviride, from Atlntic slmon Slmo slr nd rinow trout Oncorhynchus mykiss in Norwy, Dis Aqut Orgn 66(2) (2005) [4] M.J. Hjorts, H.R. Skjelstd, T. Tksdl, A.B. Olsen, R. Johnsen, B. Bng-Jensen, I. Orpetveit, H. Sindre, The first detections of sutype 2-relted slmonid lphvirus (SAV2) in Atlntic slmon, Slmo slr L., in Norwy, J Fish Dis 36(1) (2013) [5] T. Svåsnd, Ø. Krlsen, B.O. Kvmme, L.H. Stien, G.L.Trnger nd K.K.Boxspen, Risikovurdering v norsk fiskeoppdrett (Risk ssessment of Norwegin Aquculture), Fisken og Hvet 2 (2016) [6] C.L. Grdner, C.W. Burke, S.T. Higgs, W.B. Klimstr, K.D. Rymn, Interferonlph/et deficiency gretly excertes rthritogenic disese in mice infected with wildtype chikunguny virus ut not with the cell culture-dpted live-ttenuted 181/25 vccine cndidte, Virology 425(2) (2012) [7] N. Wuquier, P. Becqurt, D. Nkoghe, C. Pdill, A. Ndjoyi-Miguino, E.M. Leroy, The cute phse of Chikunguny virus infection in humns is ssocited with strong innte
25 immunity nd T CD8 cell ctivtion, The Journl of infectious diseses 204(1) (2011) [8] Y. Zhng, C.W. Burke, K.D. Rymn, W.B. Klimstr, Identifiction nd chrcteriztion of interferon-induced proteins tht inhiit lphvirus repliction, J Virol 81(20) (2007) [9] S. Krki, M.M. Li, J.W. Schoggins, S. Tin, C.M. Rice, M.R. McDonld, Multiple interferon stimulted genes synergize with the zinc finger ntivirl protein to medite ntilphvirus ctivity, Plos One 7(5) (2012) [10] S.M. Jørgensen, D.L. Hetlnd, C.M. Press, U. Grimholt, T. Gjøen, Effect of erly infectious slmon nemi virus (ISAV) infection on expression of MHC pthwy genes nd type I nd II interferon in Atlntic slmon (Slmo slr L.) tissues, Fish & shellfish immunology 23(3) (2007) [11] A. Krsnov, G. Timmerhus, B.L. Schiotz, J. Torgersen, S. Afnsyev, D. Iliev, J. Jorgensen, H. Tkle, S.M. Jorgensen, Genomic survey of erly responses to viruses in Atlntic slmon, Slmo slr L, Moleculr Immunology 49(1-2) (2011) [12] C. Lngevin, E. Aleksejev, G. Pssoni, N. Plh, J.P. Levrud, P. Boudinot, The ntivirl innte immune response in fish: evolution nd conservtion of the IFN system, Journl of moleculr iology 425(24) (2013) [13] M.K. Purcell, K.J. Ling, J.R. Winton, Immunity to fish rhdoviruses, Viruses 4(1) (2012) [14] S. Grove, L. Austo, K. Hodnelnd, P. Frost, M. Lovoll, M. McLoughlin, H.L. Thim, S. Bren, M. Konig, M. Syed, J.B. Jorgensen, E. Rimstd, Immune prmeters correlting with reduced susceptiility to pncres disese in experimentlly chllenged Atlntic slmon (Slmo slr), Fish & shellfish immunology 34(3) (2013)
26 [15] T.K. Herth, K.D. Thompson, A. Adms, R.H. Richrds, Interferon-medited host response in experimentlly induced slmonid lphvirus 1 infection in Atlntic slmon (Slmo slr L.), Veterinry immunology nd immunopthology 155 (2013).9-20 [16] C. Xu, T.C. Guo, S. Mutoloki, O. Huglnd, O. Evensen, Gene expression studies of host response to Slmonid lphvirus sutype 3 experimentl infections in Atlntic slmon, Vet Res 43 (2012). [17] K.T. Chow, M. Gle Jr, SnpShot: Interferon Signling, Cell 163(7) (2015) e1. [18] T. Kwi, S. Akir, Innte immune recognition of virl infection, Nture immunology 7(2) (2006) [19] L.-H. Johnsen, M.K. Dhle, Ø. Wessel, G. Timmerhus, M. Løvoll, M. Røsæg, S.M. Jørgensen, E. Rimstd, A. Krsnov, Differences in gene expression in Atlntic slmon prr nd smolt fter chllenge with Piscine orthoreovirus (PRV), Moleculr Immunology 73 (2016) [20] J. Horu, M.C. Jffr Bndjee, P. Krejich Trotot, T. Ds, G. Li-Pt-Yuen, B. Dss, M. Denizot, E. Guichrd, A. Rier, T. Henni, F. Tllet, M.P. Moiton, B.A. Guzere, S. Bruniquet, Z. Jffr Bndjee, P. Moridelli, G. Mrtigny, M. Jolivet, F. Gy, M. Grnddm, H. Tolou, V. Vieillrd, P. Dere, B. Autrn, P. Gsque, Persistent chronic inflmmtion nd infection y Chikunguny rthritogenic lphvirus in spite of roust host immune response, Journl of immunology 184(10) (2010) [21] T. Tksdl, J. Wiik-Nielsen, S. Birkelnd, P. Dlgrd, T. Mørkøre, Qulity of rw nd smoked fillets from cliniclly helthy Atlntic slmon, Slmo slr L., following n outrek of pncres disese (PD), J Fish Dis 35(12) (2012) [22] J. Jrungsripisit, L.J. Moore, G.L. Trnger, T.O. Nilsen, H.C. Morton, I.U. Fiksdl, S. Stefnsson, P.G. Fjelldl, Ø. Evensen, S. Ptel, Atlntic slmon (Slmo slr L.) post-smolts
27 chllenged two or nine weeks fter sewter-trnsfer show differences in their susceptiility to slmonid lphvirus sutype 3 (SAV3), Virol J 13(1) (2016) [23] K. Hodnelnd, C. Endresen, Sensitive nd specific detection of Slmonid lphvirus using rel-time PCR (TqMn), J Virol Methods 131(2) (2006) [24] L. Andersen, A. Brtlnd, K. Hodnelnd, A. Nylund, Tissue tropism of slmonid lphviruses (sutypes SAV1 nd SAV3) in experimentlly chllenged Atlntic slmon (Slmo slr L.), Arch Virol 152(10) (2007) [25] B. Sun, L. Greiner-Tollersrud, B.F. Koop, B. Roertsen, Atlntic slmon possesses two clusters of type I interferon receptor genes on different chromosomes, which llows for lrger repertoire of interferon receptors thn in zerfish nd mmmls, Dev Comp Immunol 47(2) (2014) [26] M. Chng, B. Collet, P. Nie, K. Lester, S. Cmpell, C.J. Secomes, J. Zou, Expression nd functionl chrcteriztion of the RIG-I-like receptors MDA5 nd LGP2 in Rinow trout (Oncorhynchus mykiss), J Virol 85(16) (2011) [27] P.T. Lee, J. Zou, J.W. Hollnd, S.A. Mrtin, T. Knellos, C.J. Secomes, Identifiction nd chrcteriztion of TLR7, TLR82, TLR81 nd TLR82 genes in Atlntic slmon (Slmo slr), Dev Comp Immunol 41(2) (2013) [28] I. Skjevelnd, D.B. Iliev, G. Strndskog, J.B. Jorgensen, Identifiction nd chrcteriztion of TLR8 nd MyD88 homologs in Atlntic slmon (Slmo slr), Dev Comp Immunol 33(9) (2009) [29] P.A. Olsvik, K.K. Lie, A.-E.O. Jordl, T.O. Nilsen, I. Hordvik, Evlution of potentil reference genes in rel-time RT-PCR studies of Atlntic slmon, BMC Moleculr Biology 6(1) (2005) 1-9.
28 [30] M. Lovøll, L. Austo, J.B. Jorgensen, E. Rimstd, P. Frost, Trnscription of reference genes used for quntittive RT-PCR in Atlntic slmon is ffected y virl infection, Vet Res 42 (2011) [31] A. Biosystems, Guide to Performing Reltive Quntittion of Gene Expression Using Rel-Time Quntittive PCR, (2008) [32] J. Jrungsripisit, Moore, L. J., Mehle, S. Skr, C., Einen, A.C. B., Fiksdl, I., Morton, H. C., Stefnsson, S., Trnger, G. L. nd Ptel S., Reltionship etween virl dose nd outcome of infection in Atlntic slmon, Slmo slr L., post-smolts th-chllenged with slmonid lphvirus sutype 3, J. Vet.Res. 47 (1), 2016, 102. [33] Z. Heidri, J. Tinsley, R. Bickerdike, M.F. McLoughlin, J. Zou, S.A. Mrtin, Antivirl nd metolic gene expression responses to virl infection in Atlntic slmon (Slmo slr), Fish & shellfish immunology 42(2) (2014) [34] L.-H. Johnsen, H.L. Thim, S.M. Jørgensen, S. Afnsyev, G. Strndskog, T. Tksdl, K. Fremmerlid, M. McLoughlin, J.B. Jørgensen, A. Krsnov, Comprison of trnscriptomic responses to pncres disese (PD) nd hert nd skeletl muscle inflmmtion (HSMI) in hert of Atlntic slmon (Slmo slr L), Fish Shellfish Immun 46(2) (2015) [35] T.K. Herth, J.E. Bron, K.D. Thompson, J.B. Tggrt, A. Adms, J.H. Irelnd, R.H. Richrds, Trnscriptomic nlysis of the host response to erly stge slmonid lphvirus (SAV-1) infection in Atlntic slmon Slmo slr L, Fish & shellfish immunology 32(5) (2012) [36] C. Xu, Ø. Evensen, H.M. Munng ndu, A de novo trnscriptome nlysis shows tht modultion of the JAK-STAT signling pthwy y slmonid lphvirus sutype 3 fvors virus repliction in mcrophge/dendritic-like TO-cells, BMC genomics 17(1) (2016) 1-17.
29 [37] I. Akhrymuk, S.V. Kulemzin, E.I. Frolov, Evsion of the innte immune response: the Old World lphvirus nsp2 protein induces rpid degrdtion of Rp1, ctlytic suunit of RNA polymerse II, J Virol 86(13) (2012) [38] P.V. Aguilr, S.C. Wever, C.F. Bsler, Cpsid protein of estern equine encephlitis virus inhiits host cell gene expression, J Virol 81(8) (2007) [39] J. Zou, B. Gorgoglione, N.G. Tylor, T. Summthed, P.T. Lee, A. Pnigrhi, C. Genet, Y.M. Chen, T.Y. Chen, M. Ul Hssn, S.M. Mughl, P. Boudinot, C.J. Secomes, Slmonids hve n extrordinry complex type I IFN system: chrcteriztion of the IFN locus in rinow trout oncorhynchus mykiss revels two novel IFN sugroups, Journl of immunology 193(5) (2014) [40] C. Zu, Ø. Evensen, H. Mweem Munng ndu, De Novo Trnscriptome Anlysis Shows Tht SAV-3 Infection Upregultes Pttern Recognition Receptors of the Endosoml Toll-Like nd RIG-I-Like Receptor Signling Pthwys in Mcrophge/Dendritic Like TO- Cells, Viruses 8(4) (2015) [41] C. Xu, O. Evensen, H. Munng'ndu, De novo ssemly nd trnscriptome nlysis of Atlntic slmon mcrophge/dendritic-like TO cells following type I IFN tretment nd Slmonid lphvirus sutype-3 infection, BMC genomics 16(1) (2015) 96. [42] C. Xu, T.C. Guo, S. Mutoloki, O. Huglnd, I.S. Mrjr, O. Evensen, Alph interferon nd not gmm interferon inhiits slmonid lphvirus sutype 3 repliction in vitro, J Virol 84(17) (2010) [43] S.K. Ghlwt, A.E. Ellis, B. Collet, Expression of interferon nd interferon induced genes in Atlntic slmon Slmo slr cell lines SHK-1 nd TO following infection with Slmon AlphVirus SAV, Fish & shellfish immunology 26(4) (2009)
30 [44] S.J. DeWitte-Orr, J.-A.C. Leong, N.C. Bols, Induction of ntivirl genes, Mx nd vig-1, y dsrna nd Chum slmon reovirus in rinow trout monocyte/mcrophge nd firolst cell lines, Fish Shellfish Immun 23(3) (2007) [45] A.J.A. McBeth, M. Snow, C.J. Secomes, A.E. Ellis, B. Collet, Expression kinetics of interferon nd interferon-induced genes in Atlntic slmon (Slmo slr) following infection with infectious pncretic necrosis virus nd infectious slmon nemi virus, Fish Shellfish Immun 22 (2007) [46] T. Wng, Johnsson, P. Aós, B. Holt, A. Tfll, C. Jing, Y. Wng, A. Xu, Q. Qi, Z. Hung,W. Cost, M.M. Diz-Rosles, P, Hollnd, J.W, Secomes, C. J., First in-depth nlysis of the novel Th2-type cytokines in slmonid fish revels distinct ptterns of expression nd modultion ut overlpping ioctivities, Oncotrget 7(10) (2016) [47] D.A. Grhm, H.R. Rowley, P. Frost, Cross-neutrliztion studies with slmonid lphvirus sutype 1-6 strins: results with ser from experimentl studies nd nturl infections, J Fish Dis 37 (2014) [48] G. Houghton, A.E. Ellis, Pncres disese in Atlntic slmon: serum neutrlistion nd pssive immunistion, Fish Shellfish Immun 6 (1996) [49] L.K. White, T. Sli, D. Alvrdo, E. Gtti, P. Pierre, D. Strelow, V.R. DeFilippis, Chikunguny Virus Induces IPS-1-Dependent Innte Immune Activtion nd Protein Kinse R-Independent Trnsltionl Shutoff, J Virol 85(1) (2011) [50] M. Brcelnd, R. Bickerdike, J. Tinsley, D. Cockerill, M.F. Mcloughlin, D.A. Grhm, R.J. Burchmore, W. Weir, C. Wllce, P.D. Eckersll, The serum proteome of Atlntic slmon, Slmo slr, during pncres disese (PD) following infection with slmonid lphvirus sutype 3 (SAV3), J Proteom 94 (2013)
31 [51] K.E. Christie, D.A. Grhm, M.F. McLoughlin, S. Villoing, D. Todd, D. Knppskog, Experimentl infection of Atlntic slmon Slmo slr pre-smolts y i.p. injection with new Irish nd Norwegin slmonid lphvirus (SAV) isoltes: comprtive study, Dis Aqut Orgn 75(1) (2007) [52] D.A. Grhm, P. Frost, K. McLughlin, H.M. Rowley, I. Gestd, A. Gordon, M.F. McLoughlin, A comprtive study of mrine slmonid lphvirus sutypes 1-6 using n experimentl cohittion chllenge model, J Fish Dis 34(4) (2011) [53] D.A. Grhm, V.A. Jewhurst, H.M. Rowley, M.F. McLoughlin, H. Rodger, D. Todd, Longitudinl serologicl surveys of Atlntic slmon, Slmo slr L., using rpid immunoperoxidse-sed neutrliztion ssy for slmonid lphvirus, J Fish Dis 28(6) (2005) [54] M.F. McLoughlin, Rowley H. M. nd Doherty, C. E., A serologicl survey of slmon pncres disese virus (SPDV) ntiodies in frmed Atlntic slmon, Slmo slr.l., J Fish Dis 21 (1998) [55] G.O. Melingen, S.O. Stefnsson, A. Berg, H.I. Wergelnd, Chnges in Serum-Protein nd Igm Concentrtion during Smolting nd Erly Post-Smolt Period in Vccinted nd Unvccinted Atlntic Slmon (Slmo slr L), Fish Shellfish Immun 5(3) (1995) [56] E.F. Pettersen, M. Ulvenes, G.O. Melingen, H.I. Wergelnd, Peripherl lood nd hed kidney leucocyte popultions during out-of-seson (0+) prr-smolt trnsformtion nd sewter trnsfer of Atlntic slmon (Slmo slr L.), Fish Shellfish Immun 15(5) (2003) [57] B.K. Ds, B. Collet, M. Snow, A.E. Ellis, Expression of interferon type I nd II, Mx nd gmm IP genes in the kidney of Atlntic slmon, Slmo slr, is induced during smolting, Fish Shellfish Immun 23(3) (2007)
32 [58] K.A. Glover, C. Skår, K.E. Christie, J. Glette, H. Rudr, Ø. Skl, Size-dependent susceptiility to infectious slmon nemi virus (ISAV) in Atlntic slmon (Slmo slr L.) of frm, hyrid nd wild prentge, Aquculture 254 (2006), [59] L.-H. Johnsson, Timmerhus, G., Afnsyev, S., Jørgensen, S. M. nd Krsnov, A, Smoltifiction nd sewter trnsfer of Atlntic slmon (Slmo slr L.) is ssocited with systemic repression of the immune trnscriptome., Fish Shellfish Immun 58, (2016),
33 Figure legends Fig. 1 Experimentl set-up All experimentl groups of fish were trnsferred to sewter 1 week efore i.m. injection of the shedder fish. On the dy the experiment strted, (0 dpi or 2 wpt, weeks post sewter trnsfer) the CT group ws i.m. injected with non-infected cell culture superntnt, the IM group ws i.m injected with 10 4 TCID50 SAV3, similrly to the shedders nd the BI group ws thed in wter contining shed virus from the shedder fish (shedder wter). The experiment ws performed in triplicte tnks for ll tretment groups, 65 fish in ech tnk. Smpling of 8 fish per tnk (24 fish per tretment group) ws crried out t 1, 3, 7, 14, 21 nd 28 dpi Fig. 2 PD sttus of the infected groups A. Percentge prevlence of SAV3 RNA in IM (drk grey rs) nd BI (light grey rs) groups t ll time-points. Numers ove the columns indicte the numer of positive fish per group where prevlence ws less thn 100%, n = 24 for ll group nd time-points (except for BI t 14 dpi n = 22). B. Averge ± SE, Ct vlues of nsp-1 ssy plotted in reverse, represent virl lod, in IM group (solid line) nd BI group (dshed line) t ech time point. Asterisks (*) indicte significnt differences in virl lod (Ct vlue) etween the 2 groups (p 0.05). C nd D. Histologicl sections of pncretic tissue for IM fish t 7 dpi (C) nd for BI fish t 14 dpi (D) showing loss of exocrine pncres tissue nd necrosis ( ). Br = 50μm. E nd F. Histologicl sections of hert tissue for IM fish t 14 dpi (E) nd for BI fish t 21 dpi (F) showing necrotic crdiomyocytes ( ). Br = 50μm 709
34 Fig 3. Innte gene trnscription The y xis represents normlized, fold trnscription increse for ech tretment group compred to clirtor fish smpled efore dy 0. Boxes represent the 25 th nd 75 th percentiles for ech group with the medin vlue shown y lck r in this ox. The whiskers represent the mximum nd minimum vlues for ech group. Open rs represent control fish, drk grey rs the IM group nd light grey rs the BI group. Trend lines indicte trnscriptionl chnges over time; solid line IM group nd dshed line the BI group. Verticl scles hve een kept constnt s fr s possile to llow comprison etween genes. Sttisticlly significnt differences etween the mens of the experimentl groups (p < 0.05) re indicted y lower cse letters in column to the left of ech time-point. Lower cse letters denote the CT group, lower cse, itlic letters the IM groups nd lower cse, underlined letters the BI group Fig 4. Trnscription of IFN nd effector genes, viperin nd Mx The y xis represents normlized, fold trnscription increses for ech tretment group compred to clirtor fish smpled efore dy 0. Boxes represent the 25 th nd 75 th percentiles for ech group with the medin vlue shown y lck r in this ox. The whiskers represent the mximum nd minimum vlues for ech group. Open rs represent control fish, drk grey rs the IM group nd light grey rs the BI group. Trend lines indicte trnscriptionl chnges over time; solid line IM group nd dshed line the BI group Sttisticlly significnt differences etween the mens of the experimentl groups (p < 0.05) re indicted y lower cse letters in column to the left of ech time-point. Lower cse
35 letters denote the CT group, lower cse, itlic letters the IM groups nd lower cse, underlined letters the BI group 734 Fig 5. Trnscription of cytokine genes ssocited with the inflmmtory response Verticl scles represent normlized, fold trnscription increses for ech tretment group compred to clirtor fish smpled efore dy 0. Boxes represent the 25 th nd 75 th percentiles for ech group with the medin vlue shown y lck r in this ox. The whiskers represent the mximum nd minimum vlues for ech group. Open rs represent control fish, drk grey rs the IM group nd light grey rs the BI group. Trend lines indicte trnscriptionl chnges over time; solid line IM group nd dshed line the BI group. Verticl scles hve een kept constnt s fr s possile to llow comprison etween genes Sttisticlly significnt differences etween the mens of the experimentl groups (p < 0.05) re indicted y lower cse letters in column to the left of ech time-point. Lower cse letters denote the CT group, lower cse, itlic letters the IM groups nd lower cse, underlined letters the BI group S.1 Immune genes in Positive nd Negtive fish Trnscription of immune genes (fold chnge in trnscription) of ll individuls t 3 dpi in the IM group nd of ll individuls t 7 dpi in the BI group. At these time-points prevlence ws 50% in the IM group nd 66% in the BI group nd llows comprison of immune gene trnscription etween individuls positive or negtive for SAV RNA. IL-8, IL-4/13A nd CRFB5 were only very slightly regulted nd re therefore omitted for clrity. The lck rs represent the medin vlue for ech group. The y xis is Log10 scle to render the individul dt points more visile.
36 S.2 Genes showing reltively little chnge in trnscription Fold chnge in trnscription of CRFB5, IL-8, IL-4/13A nd IL-1β. The y xis represents normlized, fold trnscription for ech tretment group compred to clirtor fish smpled efore dy 0. Boxes represent the 25 th nd 75 th percentiles for ech group with the medin vlue shown y lck r in this ox. The whiskers represent the mximum nd minimum vlues for ech group. Open rs represent control fish, drk grey rs the IM group nd light grey rs the BI group. Trend lines indicte trnscription over time; solid line IM group nd dshed line the BI group. Verticl scles hve een kept constnt s fr s possile to llow comprison etween genes. Sttisticlly significnt differences etween groups re shown in tle
37 Tle 1 Primers Primers used in the nlysis of immune genes together with their mplicon sizes, reltive efficiencies nd the Genenk ccession numer used for primer design or the reference for previously pulished ssys. Trget gene Amplicon Forwrd primer 5'-3' Reverse primer 5'-3' length Efficiency Reference/Genenk ccession No. (ps) Viperin AGCAATGGCAGCATGATCAG TGGTTGGTGTCCTCGTCAAAG Grove 2013 [14] IFN CCTGTGTATCACCTGCCATGAA GCCTGTGCACTGTAGTTCATTT NM_ MyD88 CGTGGATAGAAAAGACGTTGTG CAGGGTGATGCCTTGTCTTT EF TLR7 CGCATGACGAGGTCAGAAT GTCCTCTCTCAGTGCAATCTA HF97058 TLR81 GGCTTTCAAAATCTCACAAGGAA CCTTAATGTCACATGGAAAGT NP_ IRF7 GGACTCAAACGACCCCCATA GGTTCAGGTCTAGGTGGTTCAA NM_ MDA5 CTCGTGAACTACTCAAGAGAATCG CCTGGCTCATCTATCAAGTTAT NM_ * CXCL11_L1 GCTCCATTTGCCAAGAAAA GGCACTGACTCAACTGTGGTAA BT CRFB5 CACCCAGGGCTCCATGAA CACCAGGTTGTTGCTAGAGT KF IL-8 GAGGATTTCTAGTAGGATCATCT ATGAGTCTACCAATTCGTCTGC NM_ IL-1β GAGAGGTTAAAGGGTGGCGA TGCTTCCCTCCTGCTCGTAG NM_ IL4_13A CCGACATCTGAGGGTTTACAA GCATTGTGTGGAGTTGGTGTA AB IFNγ GGTCCACTATAAGATCTCCAAGGA CTGGCAAGATACTCCGATACAC AY LGP2 GACCCAGAATGAGCAGAAGGA CACCACAGAGTAAACGCTGTCACT NM_ Mx GGTGGTTGTGCCATGCAA TGGTCAGGATGCCTAATGTC U66475/6 ELF1 CCCCTCCAGGACGTTTACAAA CACACGGCCCACAGGTACA Olsvik 2006 [19] rinow trout* nd corresponding genomic sequence from Atlntic slmon AGKD
38 Tle 2 Correltion coefficients Correltion coefficients etween the fold increse in trnscription for the different immune genes nd the virl lod (Ct vlue for nsp-1). All correltion coefficients where R 2 > 0.5 were in the BI group nd re shown together with the corresponding R 2 for the IM group for the sme gene nd smpling time-point (dpi) Assy dpi R 2 BI group R 2 IM group IFNγ CXCL11_L MDA MDA Mx Tle 3 Significnt differences The dt for ech gene nd time-point nd for ll fish ws trnsformed (+1, Log10). One-wy ANOVA nd Post Hoc Neumn Keul s ws pplied to the dt. The tle shows ll significnt differences etween tretment groups t ech smpling point nd for ech gene ssyed: - no significnt difference, p < 0.05 grey, p < 0.01 lck nd p < old
39 7 dpi 14 dpi 21 dpi 28 dpi Gene ssy TLR7 TLR81 MDA5 LGP2 MyD88 IRF7 IFN Viperin Mx IFNγ Tretment CT IM BI CT IM BI CT IM BI CT IM BI control (CT) injection (IM) Bth (BI) control (CT) injection (IM) Bth (BI) control (CT) injection (IM) Bth (BI) control (CT) injection (IM) Bth (BI) control (CT) injection (IM) Bth (BI) control (CT) injection (IM) Bth (BI) control (CT) injection (IM) Bth (BI) control (CT) injection (IM) Bth (BI) control (CT) injection (IM) Bth (BI) control (CT) injection (IM)
40 35 CXCL- 10 IL-1β CRFB5 IL-8 IL4_13A Bth (BI) control (CT) injection (IM) Bth (BI) control (CT) injection (IM) Bth (BI) control (CT) injection (IM) Bth (BI) control (CT) injection (IM) Bth (BI) control (CT) injection (IM) Bth (BI)
41 Fig. 1
42 Fig. 2 A B * * C IM D BI Pncres E F hert
EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationMartinez-Rubio et al. BMC Genomics 2014, 15:462
Mrtinez-Rubio et l. BMC Genomics 2014, 15:462 RESEARCH ARTICLE Open Access Effects of functionl feeds on the lipid composition, trnscriptomic responses nd pthology in hert of Atlntic slmon (Slmo slr L.)
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationINFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA
Pthology nd Hygiene INFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA Kulcsár G. 1, Fáián K. 1 *, Brn T. 1, Virág Gy.
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationTLR7 induces anergy in human CD4 + T cells
TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationTHE EFFECT OF DIFFERENT STIMULI ON MEAGRE (Argyrosomus regius) FEEDING BEHAVIOUR.
THE EFFECT OF DIFFERENT STIMULI ON MEGRE (rgyrosomus regius) FEEDING EHVIOUR. Ionnis E. Ppdkis, Nikos Ppndroulkis, lkioni Sfendourki, Veronic Cmporesi 3, Mnolis Vsilkis, Constntinos C. Mylons Institute
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationConsumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationPNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :
PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationBioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM
Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms
More informationsupplementary information
DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationEffect of fungicide timing and wheat varietal resistance on Mycosphaerella graminicola and its sterol 14 α-demethylation-inhibitorresistant
Effect of fungicide timing nd whet vrietl resistnce on Mycospherell grminicol nd its sterol 14 α-demethyltion-inhiitorresistnt genotypes Didierlurent L., Roisin-Fichter C., Snssené J., Selim S. Pltform
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationWSU Tree Fruit Research and Extension Center, Wenatchee (509) ext. 265;
FINAL REPORT WTFRC Project # AH-1-5 WSU Project # 13C-355-3 Project title: PI: Orgniztion: Coopertors: of Sunburn in Apples with RAYNOX Lrry Schrder, Horticulturist WSU Tree Fruit Reserch nd Extension
More informationCheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer
CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn
More informationScholarly Research Exchange
Scholrly Reserch Exchnge Volume 9 Article ID 7959 doi:1.3814/9/7959 Reserch Article Different Dietry Levels of Protein to Lipid Rtio Affected Digestive Efficiency, Skeletl Growth, nd Muscle Protein in
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationInvasive Pneumococcal Disease Quarterly Report. July September 2017
Invsive Pneumococcl Disese Qurterly Report July September 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Rebekh Roos Helen Heffernn October 2017 Acknowledgements This report
More informationDR. MARC PAGÈS Project Manager R&D Biologicals - Coccidia Projects, HIPRA
DR. MARC PAGÈS Project Mnger R&D Biologicls - Coccidi Projects, HIPRA Dr. Mrc Pgès Bosch otined Microiology nd Genetics degree t the University of Brcelon in 1998. He otined his PhD working on the synptoneml
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationEffect of environmental stress on biochemical and physiological features in cultured fish
Effect of environmentl stress on biochemicl nd physiologicl fetures in cultured fish Toshiki Nkno, Toshiysu Ymguchi, nd Yoshihiro Ochii Grd. Sch. Agric. Sci., Tohoku Univ., Sendi, Jpn Fmous Smuri Mr. Msmune
More informationSYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT
Finl Arevited Clinicl Study Report Nme of Sponsor/Compny: Bristol-Myers Squi Ipilimum Individul Study Tle Referring to the Dossier (For Ntionl Authority Use Only) Nme of Finished Product: Yervoy Nme of
More informationAgilent G6825AA MassHunter Pathways to PCDL Software Quick Start Guide
Agilent G6825AA MssHunter Pthwys to PCDL Softwre Quick Strt Guide Wht is Agilent Pthwys to PCDL? Fetures of Pthwys to PCDL Agilent MssHunter Pthwys to PCDL converter is stnd-lone softwre designed to fcilitte
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More informationBackground Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield.
Nnjing Agriculturl University Potssium enhnces the sugr ssimiltion in leves nd fruit y regulting the expression of key genes involved in sugr metolism of Asin pers Cixi Dong, Chngwei Shen, Yngchun Xu College
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationSingle-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
More informationInvasive Pneumococcal Disease Quarterly Report July September 2018
Invsive Pneumococcl Disese Qurterly Report July Septemer Introduction Since 17 Octoer 2008, invsive pneumococcl disese (IPD) hs een notifile to the locl Medicl Officer of Helth under the Helth Act 1956.
More informationComparative analysis of early immune responses induced by two strains of Newcastle disease virus in chickens
Received: 22 April 2018 Revised: 28 June 2018 Accepted: 3 July 2018 DOI: 10.1002/mo3.701 ORIGINAL ARTICLE Comprtive nlysis of erly immune responses induced y two strins of Newcstle disese virus in chickens
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationComparison of pro- and anti-inflammatory responses in paired human primary airway epithelial cells and alveolar macrophages
Murk et l. Respirtory Reserch (2018) 19:126 https://doi.org/10.1186/s12931-018-0825-9 RESEARCH Comprison of pro- nd nti-inflmmtory responses in pired humn primry irwy epithelil cells nd lveolr mcrophges
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationRecent advances in cryopreservation od salmonid fish semen. Andrzej Ciereszko
Recent dvnces in cryopreservtion od slmonid fish semen Andrzej Ciereszko Institute of Animl Reproduction nd Food Reserch, Polish Acdemy of Sciences in Olsztyn, Polnd Justifiction for the studies Poor performnce
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationAlex M. Zimmer C. Michele Nawata Chris M. Wood. than Na? influx itself, is critical to the facilitation of ammonia excretion.
DOI 10.1007/s00360-010-0488-4 ORIGINAL PAPER Physiologicl nd moleculr nlysis of the interctive effects of feeding nd high environmentl mmoni on rnchil mmoni excretion nd N + uptke in freshwter rinow trout
More informationRelationship between food availability, glycerol and glycogen levels in lowtemperature challenged rainbow smelt Osmerus mordax
866 The Journl of Experimentl Biology, 866-87 Published by The Compny of Biologists 7 doi:.4/jeb.749 Reltionship between food vilbility, glycerol nd glycogen levels in lowtemperture chllenged rinbow smelt
More informationThe Effect of Substituting Sugar with Artificial. Sweeteners on the Texture and Palatability of Pancakes
The Effect of Sustituting Sugr with Artificil NUTR 453 Sweeteners on the Texture nd Pltility of Pnckes Jmie Wldron, Rquel Reyes, nd Reecc Legi 1 I. Astrct The effects of replcing sugr with Stevi nd Splend
More informationOptimizing Metam Sodium Fumigation in Fine-Textured Soils
Optimizing Metm Sodium Fumigtion in Fine-Textured Soils Neil C Gudmestd University Distinguished Professor & Endowed Chir of Potto Pthology Deprtment of Plnt Pthology North Dkot Stte University Erly Dying
More informationSUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
More informationThe Dynamics of Varicella-Zoster Virus Epithelial Keratitis in Herpes Zoster Ophthalmicus
Chpter 2 The Dynmics of Vricell-Zoster Virus Epithelil Kertitis in Herpes Zoster Ophthlmicus The morphology of n individul VZV lesion reflects sequence of events triggered y the virus impct on cornel epithelil
More informationInflammatory responses in primary muscle cell cultures in Atlantic salmon (Salmo salar)
Pooley et l. BMC Genomics 213, 14:747 http://www.iomedcentrl.com/1471-2164/14/747 ESEACH ATICLE Open Access Inflmmtory responses in primry muscle cell cultures in Atlntic slmon (Slmo slr) Nichols J Pooley
More informationPreliminary investigation of antimicrobial effects of pomegranate (Punica granatum L.) leathery exocarp extract against some serious phytopathogens
Preliminry investigtion of ntimicroil effects of pomegrnte (Punic grntum L.) lethery exocrp extrct ginst some serious phytopthogens Elshfie H.S. 1,*, Skr S.H. 2, Mng S.M. 1, Frisullo S. 3, Cmele I. 1 1
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationAcknowledgements. Ranaviruses and Amphibians: outside the box of host-parasite relationships. 7/16/2011. Students Valérie St-Amour Pierre Echaubard
Rnviruses nd Amphiins: outside the ox of host-prsite reltionships. Dr. Dvid Lesrrères Acknowledgements Students Vlérie St-Amour Pierre Echurd Collortors Dr. Roert Dr. Chinchr Dr Grner Dr. Grner Bruce Puli
More informationVitamin D and Mushrooms: Enrichment With Pulsed UV Light. Michael Kalaras Department of Food Science The Pennsylvania State University
Vitmin D nd Mushrooms: Enrichment With Pulsed UV Light Michel Klrs Deprtment of Food Science The Pennsylvni Stte University Vitmin D Synthesis Source: http://vitmind.ucr.edu/imges/chem1.gif Vitmin D In
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationNicholas James Boddicker Iowa State University. Dorian J. Garrick Iowa State University, Raymond Rowland Kansas State University
Animl Science Pulictions Animl Science 2-2014 Vlidtion nd Further Chrcteriztion of Mjor Quntittive Trit Locus Associted with Host Response to Experimentl Infection with Porcine Reproductive nd Respirtory
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationCheck your understanding 3
1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the
More informationProducts for weaners Benzoic acid or the combination of lactic acid and formic acid
Products for weners Benzoic cid or the comintion of lctic cid nd formic cid Tril report no.: 490 Novemer, 000 Hnne Mrio, Lrs Egelund Olsen, Bent Borg Jensen 1 nd Nuri Miquel 1 The Ntionl Committee for
More informationHormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L.
Institute of Crop Science (34h) Hormonl networks involved in phosphte deficiencyinduced cluster root formtion of Lupinus lus L. For PSP5 in Montpellier, 214 Zhengrui Wng, A.B.M. Moshiur Rhmn, Guoying Wng,
More informationIntroduction. These patients benefit less from conventional chemotherapy than patients identified as MMR proficient or microsatellite stable 3-5
Nivolumb + Ipilimumb Combintion in Ptients With DNA Mismtch Repir-Deficient/Microstellite Instbility-High Metsttic Colorectl Cncer: First Report of the Full Cohort From CheckMte-142 Abstrct 553 André T,
More informationN. J. Boddicker*, D. J. Garrick*, R. R. R. Rowland, J. K. Lunney, J. M. Reecy* and J. C. M. Dekkers* Summary. Introduction. doi: /age.
Vlidtion nd further chrcteriztion of mjor quntittive trit locus ssocited with host response to experimentl infection with porcine reproductive nd respirtory syndrome virus N. J. Boddicker*, D. J. Grrick*,
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationENERGY CONTENT OF BARLEY
ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationXII. HIV/AIDS. Knowledge about HIV Transmission and Misconceptions about HIV
XII. HIV/AIDS Knowledge bout HIV Trnsmission nd Misconceptions bout HIV One of the most importnt prerequisites for reducing the rte of HIV infection is ccurte knowledge of how HIV is trnsmitted nd strtegies
More informationTemporal Target Integration Underlies Performance at Lag 1 in the Attentional Blink
Journl of Experimentl Psychology: Humn Perception nd Performnce 212, Vol. 38, No. 6, 1448 1464 212 Americn Psychologicl Assocition 96-1523/12/$12. DOI: 1.137/2761 Temporl Trget Integrtion Underlies Performnce
More informationEfficacy of Pembrolizumab in Patients With Advanced Melanoma With Stable Brain Metastases at Baseline: A Pooled Retrospective Analysis
Efficcy of Pembrolizumb in Ptients With Advnced Melnom With Stble Brin Metstses t Bseline: A Pooled Retrospective Anlysis Abstrct 1248PD Hmid O, Ribs A, Dud A, Butler MO, Crlino MS, Hwu WJ, Long GV, Ancell
More informationCharacterization of homologous and heterologous adaptive immune responses in porcine reproductive and respiratory syndrome virus infection
Díz et l. Veterinry Reserch 212, 43:3 http://www.veterinryreserch.org/content/43/1/3 VETERINARY RESEARCH RESEARCH Open Access Chrcteriztion of homologous nd heterologous dptive immune responses in porcine
More informationAnalysis of Regulatory of Interrelated Activity of Hepatocyte and Hepatitis B Viruses
Interntionl Journl of Biomedicl Mterils Reserch 8 6(): -7 http://www.sciencepublishinggroup.com/j/ijbmr doi:.648/j.ijbmr.86. ISSN: 33-756 (Print) ISSN: 33-7579 (Online) Anlysis of Regultory of Interrelted
More information3 Results RESULTS Cell growth and segregation in recombinant bioprocesses
RESULTS 3 3 Results In this thesis, yest α-glucosidse produced in E. coli ws used s model system in order to otin more comprehensive knowledge out cell physiology in response to overexpression of heterologous
More informationChapter 5: The peripheral nervous system Learning activity suggested answers
Chpter 5: The peripherl nervous system Lerning ctivity suggested nswers Lerning Activity 5.1 (p. 222) 1 Briefly descrie the two min functions of the somtic nervous system. Description should refer to:
More informationBMI and Mortality: Results From a National Longitudinal Study of Canadian Adults
nture publishing group BMI nd Mortlity: Results From Ntionl Longitudinl Study of Cndin Adults Hether M. Orpn 1, Jen-Mrie Berthelot 2,3, Mrk S. Kpln 4, Dvid H. Feeny 5,6, Bentson McFrlnd 7 nd Nncy A. Ross
More informationA FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM
IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND
More informationHealth-Related Quality of Life and Symptoms of Depression in Extremely Obese Persons Seeking Bariatric Surgery
Oesity Surgery, 15, 3-39 Helth-Relted Qulity of Life nd Symptoms of Depression in Extremely Oese Persons Seeking Britric Surgery Anthony N. Frictore, PhD; Thoms A. Wdden, PhD; Dvid B. Srwer, PhD; Myles
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationSUPPLEMENTARY INFORMATION
TM TM tip link horizontl top connectors 1 leucine-rich (21 %) otoncorin-like 1809 ntigenic peptides B D signl peptide hydrophoic segment proline/threonine-rich (79 %) Supplementry Figure 1. () The outer
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationGene expression phenotypic models that predict the activity of oncogenic pathways
3 Nture Pulishing Group http://www.nture.com/nturegenetics Gene expression phenotypic models tht predict the ctivity of oncogenic pthwys Erich Hung,, Seiichi Ishid,7, Jennifer Pittmn,3, Holly Dressmn,,4,
More informationA rt i c l e s. a Events (% of max)
Continuous requirement for the TCR in regultory T cell function Andrew G Levine 1,, Aron Arvey 1,,4, Wei Jin 1,,4 & Alexnder Y Rudensky 1 3 14 Nture Americ, Inc. All rights reserved. Foxp3 + regultory
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationAquaculture protein levels
Ž. Aquculture 189 2000 287 292 www.elsevier.nlrlocterqu-online Whole-ody mino cid pttern of F4 humn growth hormone gene-trnsgenic red common crp ž Cyprinus crpio/ fed diets with different protein levels
More informationSupplemental Materials
Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.
More informationReplacing Fish Meal with Soybean Meal and Brewer s Grains with Yeast in Diets for Australian Red Claw Crayfish, Cherax quadricarinatus
Replcing Fish Mel with Soyben Mel nd Brewer s Grins with Yest in Diets for Austrlin Red Clw Cryfish, Cherx qudricrintus Lur A. Muzinic*, Kenneth R. Thompson, & Crl D. Webster Introduction Soyben mel (SBM)
More informationARTICLE. E. Pavlova 1, N. Atanassova 1, C. McKinnell 2, R.M. Sharpe 2 1 Institute of Experimental Morphology, Pathology and Anthropology with Museum,
DOI:.554/5YRTIMB..3 OPPOSITE MODELS OF EXPRESSION OF ANDROGEN RECEPTOR (AR) AND RETINOIC ACID RECEPTOR-α (RAR-α) IN THE ONSET OF MALE GERM CELL DEVELOPMENT IN HORMONALLY MANIPULATED RATS E. Pvlov, N. Atnssov,
More informationSupplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2
Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,
More informationAssessment of Depression in Multiple Sclerosis. Validity of Including Somatic Items on the Beck Depression Inventory II
Assessment of Depression in Multiple Sclerosis Vlidity of Including Somtic Items on the Beck Depression Inventory II Peggy Crwford, PhD; Noh J. Webster, MA Signs nd symptoms of multiple sclerosis (MS)
More informationSupplemental Information. Lymphocytes Negatively Regulate NK Cell Activity. via Qa-1b following Viral Infection
Cell Reports, Volume 21 Supplementl Informtion Lymphocytes Negtively Regulte NK Cell Activity vi Q-1b following Virl Infection Hifeng C. Xu, Jun Hung, Aleksndr A. Pndyr, Elisbeth Lng, Yun Zhung, Christine
More informationRSV-specific airway resident memory CD8 þ T cells and differential disease severity after experimental human infection
Received Oct 15 Accepted 1 Nov 15 Pulished 1 Dec 15 DOI: 1.138/ncomms1 OPEN RSV-specific irwy resident memory CD8 þ T cells nd differentil disese severity fter experimentl humn infection Agnieszk Jozwik
More information