Supplemental Materials

Transcription

1 Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R. Somerville A WT B shv3svl ½MS d 6 mm Suc cd 6 mm Glc 6 mm Fru d 12 mm Sor ½MS 6 mm Suc c 6 mm Glc 6 mm Fru d 12 mm Sor C ces6 D co ½MS 6 mm Suc c 6 mm Glc 6 mm Fru 12 mm Sor ½MS 6 mm Suc 6 mm Glc 6 mm Fru 12 mm Sor Supplementl Figure S1. Comprison of growth of seedlings on medi contining 6 mm Suc, 6 mm Glc/6 mm Fru, nd 12 mm Sor. Seedlings were grown for 5 d in the drk. A, WT (Men of n = 223 ± SEM). B, shv3svl1 (Men of n = 1421 ± SEM). C, ces6 (Men of n = 1421 ± SEM). D, co (Men of n = 1622 ± SEM). In ech pnel, columns not shring common letter differ (P <.5) y one wy ANOVA nd Tukey s multiple comprison test. 1

2 MS Sor Glc Fru Glc Fru Suc Sugr (6 mm) Supplementl Figure S2. Effect of vrious exogenous sugrs on hypocotyl elongtion of suc1 in the drk. suc1 seedlings were grown for 5 d in the drk (Men of n = 2636 ± SEM). Columns not shring common letter differ (P <.5) y one wy ANOVA nd Tukey s multiple comprison test. 2

3 fer 15 5 ½MS 6 mm Suc 6 mm Glc 6 mm Fru 12 mm Sor c Supplementl Figure S3. Growth of fer seedlings on medi contining 6 mm Suc, 6 mm Glc/6 mm Fru, nd 12 mm Sor. Seedlings were grown for 5 d in the drk. (Men of n = 1519 ± SEM). Columns not shring common letter differ (P <.5) y one wy ANOVA nd Tukey s multiple comprison test. 3

4 A B C 5 mm WT shv3svl1 suc1 D E F shv3svl1sss1 shv3svl1sss2 fer Supplementl Figure S4. DMSO controls for esculin uptke experiments. 4 d old seedlings of the indicted genotypes (AF) were incuted for 3 min with ½ MS medi with 6 mm sucrose nd 1% (v/v) DMSO, equivlent to the conditions used in the experiments shown in Figure 8. shv3svl1 nd fer exhiit fluorescence consistent with ectopic lignifiction, ut the intensity is negligile compred to tht oserved with esculin uptke. Contrst ws eqully djusted for ll pnels of this figure nd Figure 8 (C H). 4

5 At5g672 At3g135 (DUF239) At5g5573 FLA1 At1g85 AT5G5156 At3g1356 (GH17) At3g5637 At3g1784 At3g868 At1g6942 (Zinc Finger) At5g5548 SVL1 At5g2 SIRK1 At4g327 PERK14 At1g4848 At5g4852 AUG3 At2g4547 FLA8 At5g73 (Protese) At4g2374 At1g355 (fucosyltrnsferse) At2g579 (GH17) At2g2673 Supplementl Figure S5. SVL1 coexpression network. The gene coexpression network of SVL1 ws otined from ATTED II ( Oyshi et l., 27). Node colors indicte TrgetP predicted protein locliztion (Cyn = secretory, white = cytosol, green = chloroplst), edge thickness indictes coexpression mutul rnk (Thicker lines indicte lower mutul rnk score nd closer coexpression). 5

6 A SHV3mychis Endo H f PNGse F B HO PIPLC GDPD O P O O GDPD N Glycerophosphocholine (GroPC) MW (kd) HO O P O O HO PIPLC O R 1 O O P O R 2 O O HO O R 1, R 2 = Ftty cids Glycerophosphoinositol (GroPI) Phosphtidylinositol (PtdIn) C GDPD Enzyme SHV3mychis D PIPLC Enzyme SHV3mychis Enzyme Enzyme Enzyme Enzyme Sustrte GroPI GroPC EIC m/z Intensity 6 6 ph = ph = ph = ph = ph = ph = ph = ph = ph = ph = 5.5 Sustrte GroPI PtdIn EIC m/z Intensity 6 6 ph = ph = ph = ph = ph = ph = ph = ph = ph = ph = ph = ph = ph = ph = Retention Time (min) Retention Time (min) Supplementl Figure S6. Assys of recominnt SHV3 enzyme ctivity. (full cption on next pge) 6

7 Supplementl Figure S6. Assys of recominnt SHV3 enzyme ctivity. The mture coding sequence of SHV3 ws cloned into pgapzα nd trnsformed into Pichi pstoris X33 strin. After screening for productive trnsformnts y western lot nlysis of pilot scle cultures, the SHV3mychis protein ws purified y NiNTA ffinity chromtogrphy from medi fter three dys of growth t 16 C in uffered rich medi ( g L 1 yest extrct, 2 g L 1 peptone, 2 g L 1 csmino cids, 13.4 g L 1 yest nitrogen se, 2 g L 1 dextrose,.4 mg L 1 iotin, mm potssium phosphte, ph 6.). A, By SDSPAGE, the protein is resolved s diffuse nd round 18 kd, consistent with highly glycosylted product. Tretment with either Endo Hf or PNGse F to remove N glycns shifts the protein to 3 nds of ~89 kd indicting incomplete processing of the αfctor signl sequence during secretion (the expected mss of SHV3mychis without the αfctor signl sequence or glycns is 78 kd). Gel is stined with colloidl coomssie G25. B, The ctivity of SHV3mychis ws tested on three potentil sustrtes expected to e cleved y GDPD or PIPLC ctivity t the positions indicted with rrows. The ssys were prepred with 2 mm of indicted sustrte, 2 mm of uffer (sodium cette [ph 4 & 5.5] or MOPS [ph 7.]), 5 mm CCl2, 5 mm MgCl2,.4% (w/v) BSA, nd either µg ml 1 SHV3mychis, 1 U ml 1 PIPLC from Bcillus cereus (Thermo Fisher #P6466),.8 U ml 1 GDPD (Sigm #G1642), or lnk rection contining no enzyme. Rections were incuted for 4 h t 37 C nd terminted y ddition of cetic cid to finl concentrtion of 2 mm. Products were nlyzed y LCMS using Rezex RFQFst Acid H column (Phenomenex) eluted with.5% (v/v) queous formic cid into n Agilent 652 qtof mss spectrometer operting in negtive ion mode. Products were detected s [MH] ions of glycerol phosphte (m/z = ± ppm) or inositol phosphte (m/z = ± ppm). In the cse of rections with PtdIn s sustrte, 2% (w/v) Triton X ws included in the ssy nd wter solule products were clened from detergents nd lipids using n equl volume of chloroform:methnol:hcl (66:33:1 v/v/v), recovering the queous phse for nlysis. C, Test of GDPD ctivity indicting GDPD ctivity of the commercil enzyme for ph 5.5 on GroPC nd GroPI producing glycerol phosphte ut no detectle ctivity for SHV3 mychis. D, Test of PIPLC ctivity indicting PIPLC ctivity of the commercil enzyme for ll ph conditions on PtdIn nd GroPI producing inositol phosphte ut no detectle ctivity for SHV3mychis. 7

8 Supplementl Tle S1. Neutrl sugr nd uronic cid composition of shv3svl1 correcting for mss of strch mm Suc 6 mm Suc WT shv3svl1 WT shv3svl1 Fuc 3.4 ±.1 3.2* ± ±.2 4.2* ±.1 Rh 19.5 ± * ± ± * ±.4 Ar 29 ± 1 32 ± 2 33 ± 1 35 ± 1 Gl 65 ± 4 61 ± 3 71 ± 3 71 ± 2 Xyl 27 ± 1 25 ± 1 36 ± 1 31* ± 1 Mn 5.8 ± ±.2 7. ± ±.1 GlA 84 ± 4 74* ± 1 76 ± 3 66* ± 3 GluA 5.36 ± * ± ± ±.22 All vlues re expressed s µg mg 1 of AIR with the mss of strch sutrcted. * Indictes sttisticlly significnt difference compred to WT for the respective growth medium (Student s t test, P <.5). The dt re mens of 3 iologicl replictes ± SD. 8

9 Supplementl Tle S2. Neutrl sugr nd uronic cid composition of fer mm Suc 6 mm Suc WT fer WT fer Fuc 3.7 ± ± ±.3 2.7* ±.1 Rh 21 ± 1 21 ± 3 17 ± 2 12* ± 1 Ar 31 ± 3 39* ± 3 35 ± 4 32 ± 1 Gl 68 ± 5 53* ± 1 62 ± 5 42* ± 2 Xyl 28 ± 2 24* ± 1 3 ± 2 2* ± 1 Mn 6.9 ±.3 6.1* ± ± ±.8 GlA 84 ± 4 74 ± 5 89 ± 11 59* ± 6 GluA 6.7 ± ± ±.6 3.6* ±.5 All vlues re expressed s µg mg 1 of AIR. * Indictes sttisticlly significnt difference compred to WT for the respective growth medium (Student s t test, P <.5). The dt re mens of 3 iologicl replictes ± SD. 9

10 Supplementl Tle S3. Primers used in this study Nme Sequence (5 to 3 ) SUC1P1 CTCCATTCTCTCATCTCCTACATCACA SUC1P2 CAGACGACCCAAGGTTTATTAGATT SUC1P3 CGTCGTCCTTTCATCGCCA SUC1P4 CGGAGCAGCTTGAGAATATGGA SUC1P5 GGCGGCTAAGTCGGCTAAGA SUC1P6 GCCGGACCGAGCGCTAGT