Life Science 1A Practice Midterm Exam 2. November, 2006

Transcription

1 Name: TF: Section Time Life Science 1A Practice Midterm Exam 2 November, 2006 Pease write egiby in the space provided beow each question. You may not use cacuators on this exam. We prefer that you use non-erasabe pen when writing your answers. A significant number of competed exams wi be photocopied by the teaching staff. Pease write your name on each page of the exam. There are SIX muti-part questions in this exam. We recommend that you first read through a questions and begin with the questions that are easiest for you. Be sure to take a ook at a questions before the end of the exam! A written responses shoud fit within the space provided. Pease write your TF s name and section time on the front page ony. Question 1 Question 2 Question 3 Question 4 /XX /XX /XX /XX

2 1. Isoeucy-tRNA synthetase (IeRS) catayzes the attachment of isoeucine to its appropriate trna. a. Draw the structure of isoeucine. b. What type(s) of interactions woud you expect to take pace between the side chain of the substrate isoeucine and the residues ining the isoeucine binding pocket of IeRS? c. The amino acid binding pocket of IeRS does not bind Gy or Aa. In ight of the structures of these amino acids, propose an expanation for this binding seectivity. 1

3 d. You discover a mutant IeRS and set up a series of reactions to compare its activity to that of the norma IeRS. You observe the foowing resuts. Reaction Amino acid trna synthetase 1 Ie Norma Ie Mutant Va Norma 0 4 Va Mutant 7 Reative amount of trna-amino acid produced Based on these resuts, what activity of the enzyme has been compromised as a resut of the mutation? Expain your answer. e. You isoate a second mutant of IeRS and repeat the experiments from part c. You observe the foowing resuts: Reaction Amino acid trna synthetase 1 Ie Norma Ie Mutant 10 3 Va Norma 0 4 Va Mutant 0 Reative amount of trna-amino acid produced Further experiments show that the mutant enzyme binds its substrates just as we as the norma enzyme. Based on these resuts, what activity of the enzyme has been compromised as a resut of the mutation? Expain your answer. 2

4 2. The HIV has a genome that is composed of RNA instead of DNA. This feature of the virus determines severa critica steps in the vira ife cyce. a. Treatment of HIV-infected ces with AZT can bock vira repication. However, at the eve of an individua ce, bockage of vira repication is most effective if the AZT treatment occurs within 12 hours of infection. Expain this observation. b. To confirm that HIV carries an enzyme that can synthesize DNA, you disrupt HIV virions to reease their contents. When the disrupted virus mixture is added to a soution containing dntps, a ~10 kb nuceic acid product is observed. When you treat the product with either ribonucease, deoxyribonucease, or hydroxide, you observe the foowing resuts: Treatment Ribonucease (Hydroyzes RNA ony) Deoxyribonucease (Hydroyzes DNA ony) Hydroxide (OH -, a strong base) Resut Product present Product absent Product present From these resuts, was the nuceic acid product RNA or DNA? What resuts woud you expect if the reaction had produced the other product (e.g. DNA instead of RNA or RNA instead of DNA)? Expain your answer. 3

5 c. When you add both AZT and dntps to the disrupted virus mixture described above, you sti observe the production of nuceic acid products. However, instead of products with a consistent ~10 kb size, you observe a compex mixture of far smaer products. Expain this observation given what you know about AZT s mechanism of action. d. Since nuceic acid products are sti produced in the presence of AZT, why does this drug bock vira repication? e. Severa mutations have been identified in the reverse transcriptase genes of AZT-resistant strains. Many AZT-resistant strains can repicate as rapidy as AZT-sensitive strains in the absence of AZT. Woud you expect the RT of AZT-resistant strains to have decreased RNA binding affinity? Justify your answer. 4

6 3. BOS1 is a eukaryotic gene encoding a protein invoved in vesice trafficking. Beow is the DNA sequence of the 5 end of the BOS1 gene The TATA box and the transcriptiona start site are in bod TGTGCTGGCTATAATAGACAGGATCGACGCTGT TGAGGGGGGAATGAACGCTCTT-3 3 -ACACGACCGATATTATCTGTCCTAGCTGCGACA ACTCCCCCCTTACTTGCGAGAA CCCGTATGTTTGATCGCGGAGGCATCTTTTCTCATTATTGCTTACAACCATGCTGTGAAG -GGGCATACAAACTAGCGCCTCCGTAGAAAAGAGTAATAACGAATGTTGGTACGACACTTC a. Briefy describe the function of the TATA box for transcription and/or transation. b. Write the first 15 bases of the RNA that woud be transcribed. Specify 5' and 3' ends. c. Write the amino acid sequence that this RNA sequence encodes. Specify N- and C-termini. d. When Bos1 protein is sequenced, the first four amino acids agree with the predicted transation from the coding strand of DNA. However, amino acids 5 through 15 do not correspond to those predicted by codons 5 through 15 of the DNA. Provide a ogica expanation. e. Bos1 is invoved in the budding of vesices from the ER. What are two casses of proteins required for vesicuar trafficking? 5

7 f. To investigate the function of Bos1, severa Bos1-GFP fusion proteins were made and anayzed. The constructs and resuts are shown beow. Wid-type Bos1-GFP N- -C Stretch of 6 hydrophobic amino acids GFP Stretch of 18 hydrophobic amino acids Mutant 1-GFP N- -C Mutant 2-GFP N- -C Protein Locaization of GFP-fusion proteins Wid-type Bos-1-GFP ER membrane, vesices, cis-gogi membrane Mutant 1-GFP Cytoso Mutant 2-GFP ER umen Expain why Mutant 1-GFP and Mutant 2-GFP are misocaized. Incude in your answer one possibe function for each deeted domain. 6

8 g. Cam1 is another protein invoved in ER to Gogi transport. Cam1 is primariy ocated on the membranes of the cis-gogi network. When Bos1-GFP is expressed in wid-type ces and ces without functiona Cam1 (Cam1 mutant), the foowing resuts are observed. Locaization of Bos1-GFP Ce Type ER Membrane Vesice Membrane Cis-Gogi Membrane Wid-type Cam1 mutant Moreover, more vesices with Bos1-GFP are seen in the Cam1 mutant ces. Given a of the provided data (parts a-g) what type(s) of proteins are Bos1 and Cam1? Expain your reasoning. 7

9 4. You have the abiity to record the ocation of a singe protein moving within a ipid biayer. Beow are the data you obtain from two such experiments in which you record the ocation ( ) of protein A at fixed time intervas. The ipid composition of the biayer is the same in both experiments, but in one experiment the biayer contains choestero whie in the other it does not. X and X* are the distances between two recorded ocations of protein A. The time interva between recordings is the same in both experiments. X X* Experiment 1 Experiment 2 a. You observe that X > X*. If these experiments were carried out at high temperature, which ipid biayer (Experiment 1 or 2) woud you guess contains choestero? Briefy expain your reasoning. b. Woud your answer change if the experiments were conducted at ow temperature? Briefy expain your reasoning. 8

10 c. Draw the FRAP traces (recovery graphs) you woud expect for these two experiments 1 and 2. Labe the axes appropriatey. Experiment 1 Experiment 2 time time 9

11 The Genetic Code 10