Inferring genetic diversity from nextgeneration
|
|
- Spencer Henry
- 5 years ago
- Views:
Transcription
1 Inferring genetic diversity from nextgeneration sequencing data Milano-Bicocca April 16-17, 2012
2 Outline Part I: Detecting low-frequency single-nucleotide variants (SNVs) Genetic diversity NGS platforms and their error patterns Read alignment SNV calling Part II: Local haplotype inference and global quasispecies assembly Local haplotype inference via read clustering Global haplotype assembly 2
3 Intra-host genetic diversity of RNA viruses Evolutionary dynamics high mutation rate high turn-over large population size Disease progression Vaccine design (immune escape) Antiretroviral therapy (drug resistance) 3
4 RNA viruses exist as quasispecies population consensus sequence _x i = X a j q ij x j Áx i 4
5 Intra-patient genetic diversity of tumors Evolutionary dynamics mutation rate can be elevated (genetic instability) high turn-over large population size Disease progression Drug resistance Within-patient tumor phylogeny Gerlinger et al (N Engl J Med 2012) 5
6 Subclonal tumor cell populations Ene & Fine (Cancer Cell 2011) 6
7 Deep sequencing of heterogeneous samples deep sequencing Mixed sample Aligned reads 7
8 Deep sequencing of heterogeneous samples deep sequencing Mixed sample Aligned reads Single nucleotide variants Sequencing error 8
9 Sources of genetic variation in read data Biological variation Contamination PCR errors: single-base error recombination selective amplification Emulsion PCR errors: single-base error Sequencing errors: single-base errors indels GAGGTAGGCTTG CAGTTAGGGTAG CAGGTAGGCTAG GAGATAGGCTAG CAGTTAGGCTAG GAGGTAAGCTTG TAGATAGGCTTG CAGTTAGGGTAG errors 9
10 Most reads are incorrect Let us assume (454 data) a sequencing error of 0.2% per base pair, and an average read length of 500 bp. Then the fraction of reads with at least one error is 1 ( ) 500 = Thus, over 60% of the reads are incorrect! 10
11 NGS-based diversity estimation: Main challenges 1. Alignment (mapping) uncertainty 2. Confounding sources of variation (errors) of multiple types 3. Short read length relative to genomic region of interest 11
12 Spatial scale of diversity estimation global local SNV 12
13 Pyrosequencing sample preparation DNA isolation Fragmentation Strand separation Adapter ligation Emulsion PCR on beads ~1 fragment/bead ~10 million copies Enzymes for pyrophophate sequencing added on smaller beads ~1 bead loaded with single-stranded DNA clone per well ~1.6 million wells 44µm Margulies et al (Nature 2005) 13
14 Pyrosequencing base calling Sequencing by synthesis Determine DNA by detecting light emission associated with base incorporation The four bases are cycled in the order T A C G camera (Signal intensity) (No. of nucloetides incorporated) Margulies et al (Nature 2005) 14
15 Flowgram key Margulies et al (Nature 2005) 15
16 Pyrosequencing errors In long homopolymeric regions, linearity between signal intensity and number of nucleotides incorporated fails. Insertion errors (overcalls): some beads get ahead of the others (carry forward) due to left-over nucleotides Deletion errors (undercalls): some beads get behind the others (incomplete extension) Margulies et al (Nature 2005), Balzer et al (Bioinf 2010) 16
17 Low-quality reads contribute disproportionally to the overall error rate Huse et al (Genome Biol 2007) 17
18 Error rates increase with read length homopolymeric regions (A, T, G, C) Gilles et al (BMC Genomics 2011) 18
19 Additional factors Position in reference sequence Sequence type (organism, genomic region) Region on PicoTiterPlate Distance to region center (chemicals) Distance to plate center (camera) Gilles et al (BMC Genomics 2011) 19
20 Quality scores, Q = log 10 (error rate) Original 454 score (v1.1.*) represents only the probability of overcall, given the observed signal intensity. Improved quality score accounts for Local noise (compare flow with rounded flow) Overall read noise (overlap of 0-mer and 1-mer distributions) Homopolymer count Loss-of-synchrony noise (likelihood of incomplete extension) Position on read Brockman et al (Genome Res 2008) 20
21 Illumina bridge amplification Multiple cycles of annealing, extension and denaturation to form clusters Initial priming and extending of single strand template Bridge amplification of immobolized template with adjacent primers Metzker (Nat Rev Genet 2011) 21
22 Illumina reversible terminators C A T C G T C C C C C C Metzker (Net Rev Genet 2011) 22
23 Mismatch rate increases with cycle number Bustard Ibis Kircher et al (Genome Biol 2009) 23
24 Mismatch rate depends on Sequence context and Substitution type Dohm et al (Nucl Acids Res 2008) 24
25 Quality scores Kircher et al (Genome Biol 2009) 25
26 Read coverage vs. GC content Dohm et al (Nucl Acids Res 2008) 26
27 NGS platforms Metzker (Nat Rev Genet 2011) 27
28 Comparing NGS platforms Harismendy et al (Genome Biol 2009) 28
29 Filtering reads ~300x Reumers et al (Nat Biotech 2011) 29
30 Read alignment (mapping) Task: Find the location of each read in a given reference genome in the presence of errors millions to billions dominated by sequencing errors, genetic diversity of the sequenced species, and uncertainty in reference genome assembly By comparison, traditional alignment finds matches in (remote) homologous sequences in large databases (Smith-Waterman, BLAST, FASTA) uses evolutionary models (DNA/protein substitution models, phylogenetic trees) 30
31 Read mapping Challenges: many short reads long genomes errors repetitive DNA Read mappers are based on indexing techniques to locate reads, followed by high-quality local alignments. Around 50 mapping programs currently available see wikipedia list Trapnell & Salzberg (Nat Biotech 2009) 31
32 De novo read assembly successful with Sanger sequencing data (800bp reads) better data structure for NGS data MacLean et al (Nat Rev Microbiol 2009) 32
33 Read mapping of diverse populations at high coverage Goals: 1. Multiple alignment of all reads 2. Error correction Strategies: Mapping to reference genome Mapping to consensus sequence Pairwise local alignments (Smith-Waterman) to reference or consensus Multiple sequence alignment (MSA) De novo assembly Account for quality scores, error patterns In practice, strategies are often combined. 33
34 MSA of reads 34
35 Example: HIV env gene 1. Locate reads by k-mer matching on reference (template) sequence (here: HIV-1 HXB2) 2. Build MSA in windows of size 70nt with overlap 20nt 3. Generate in-frame consensus sequences, concatenate 4. Align reads locally to consensus sequence (Smith-Waterman) 5. Remove indels causing frameshifts Archer et al (PLoS Comput Biol 2010) 35
36 Consensus versus reference template Archer et al (PLoS Comput Biol 2010) 36
37 SNV detection 37
38 SNV detection in a mixed sample Let q be the per-site error rate. The number of errors at position i is n i = 19 X i» Binom(n i ; q) where n i is the coverage. With i := n i q = E[X i ], approximately, X i» Pois( i) x = 3 For calling an allele observed x times, consider P (X i x) = 1 x 1 X k=0 ki e i k! 38
39 SNV detection via comparative sequencing Task: For each allele, decide whether its frequency in the tumor is higher than in normal control tissue. If so, the allele is called (i.e., likely to be a true biological variant), otherwise it is more likely to be an experimental error (i.e., noise). Requires a statistical framework for comparing allele counts 39
40 Simple approach (Varscan 2) For each allele, Fisher s exact test on No. of variant alleles No. of all other alleles Tumor Normal / 16 P = 0.34 Correct for multiple testing 1 / 18 Koboldt et al (Genome Res 2012) 40
41 Independent Poisson distributions (vipr) Allele count in tumor: X i» Pois(¹ i = n i q) Allele count in normal control: Y i» Pois( i = m i q) 3 / 16 For calling an allele observed x times in the tumor and y times in the control, consider P (X i Y i x y) = 1 x y 1 X k= 1 where Skel is the Skellam distribution. Skel(k j ¹ i ; i) 1 / 18 Altmann et al (Bioinformatics 2011) 41
42 Strand specificity Sequencing errors often occur predominantly on one strand, GTAAAAA 5 GTAAAAGCGTATG 3 3 CATTTTCGCATAC 5 CGCATAC whereas true variants do not. Altmann et al (Bioinformatics 2011) 42
43 Independent, but non-identical, error rates Let q ik be the error rate at position i on read k. If E ik indicates an error at position i on read k, P(E ik = 1) = q ik, then X i = X n i E ik k=1 is, in general, not binomial, but its distribution can be computed recursively using the discrete convolution formula. In the special case that q ik = q i for all reads k, X i» Binom(n i ; q i ) Macalalad et al (PLoS Comput Biol 2012) 43
44 Non-independent and non-identical error rates Let E ijk indicate the joint occurrence of errors at positions i and j on read k, P(E ijk = 1) = q ijk. Then the distribution of the number of joint errors X ij = n ij X k=1 E ijk Position j can still be computed recursively using the discrete convolution formula. Positions i and j are phased. Software: V-Phaser Macalalad et al (PLoS Comput Biol 2012) 44
45 Unphased versus phased SNV calling X ij = n X ij E ijk k=1 Macalalad et al (PLoS Comput Biol 2012) 45
46 Beta-binomial model (deepsnv) For each strand s, position i, and nucleotide b: ½ s;i;b ½ s;i;b» Beta(q s;i;b ; ) Y s;i;b» Binom(m s;i ; ½ s;i;b ) ) Y s;i;b» BetaBin(m s;i ; q s;i;b ; ) E[Y s;i;b ] = m s;i q s;i;b Var[Y s;i;b ] = m s;i q s;i;b + (m s;i q s;i;b ) 2 = ; and CV ¼ 1= Gerstung et al (Nat Commun 2012) 46
47 Minor allele frequency test 2 log L(X s;i;b; Y s;i;b j H 0 ) L(X s;i;b ; Y s;i;b j H 1 )» Â2 1 Gerstung et al (Nat Commun 2012) 47
48 Overdispersion phix replicates tumor vs. normal = 1000 = 137 Gerstung et al (Nat Commun 2012) 48
49 Null model Gerstung et al (Nat Commun 2012) 49
50 Test data: Known mix of 5 clones mix control 1,512 nt, ~ 50 SNVs PCR amplification 33x Alignment with novoalign Base calling if Q>25 PHRED Coverage ~10 5 Gerstung et al (Nat Commun 2012) 50
51 Performance: ROC curves Gerstung et al (Nat Commun 2012) 51
52 Performance comparison Gerstung et al (Nat Commun 2012) 52
53 Application: Renal cell carcinoma SNVs SNPs Gerstung et al (Nat Commun 2012) 53
54 Application: Renal cell carcinoma Gerstung et al (Nat Commun 2012) 54
55 Loss of heterozygosity 14 SNPs Allele frequency ratio r = f A / f a ¼ 2 on chr. 3 ½ = r=r 0 1 r=r 0 + n 1 Gerstung et al (Nat Commun 2012) 55
56 Evolutionary history Gerstung et al (Nat Commun 2012) 56
57 Local haplotype inference 57
58 Phasing improves limit of detection Under simplifying assumptions, including an i.i.d. error rate q, the probability of miscalling a d-tuple of phased SNVs (i.e., a haplotype) of frequency p is smaller than calling it correctly, if and only if q < ³ 1 p p 1=d q or, approximately, q < p 1=d d = degree of phasing p 58
59 Clustering reads locally local 59
60 Local haplotype inference via read clustering INPUT OUTPUT GAGGTAGGCTTG CAGTTAGGGTAG CAGGTAGGCTAG GAGATAGGCTAG CAGTTAGGCTAG GAGGTAAGCTTG TAGATAGGCTTG CAGTTAGGGTAG GAAGTAGGCTTG GAGATAGGCTAG GAGGTAGGCTTG GAGGTAAGCTTG GAAGTAGGCTTG CAGTTAGGGTAG CAGGTAGGCTAG CAGTTAGGCTAG CAGTTAGGGTAG GAGATAGGCTAG TAGATAGGCTTG GAGATAGGCTAG GAGGTAGGCTTG 3/10 CAGTTAGGGTAG 4/10 GAGATAGGCTAG 3/10 reads read clusters haplotypes frequencies 60
61 Probabilistic clustering We assume an i.i.d. error rate 1 µ. Main problem: number of clusters (haplotypes) unknown Bayesian approach Dirichlet process mixture (Chinese restaurant process) Gibbs sampler GTCTGGTACGCCCGAA GTCCCGTACGTACGAA ATCCCCGTCCGTTCGAA Zagordi et al (J Comput Biol 2010) 61
62 Likelihood The probability of observed reads r, given haplotype assignments c and haplotypes h, is P (r j c; h) = Y k µ m k µ m 0 1 µ k jb 1j ; m k = X i;j I(r i;j = h k;j )I(c i = k) matches m 0 k = X i;j I(r i;j 6= h k;j )I(c i = k) mismatches where B is the alphabet size. 62
63 Chinese restaurant process new
64 Finite mixture model, K < 1 y i» KX j=1 ¼ j F (y i j µ j ) ; M G 0 ¼ c i µ i y i N y i j c i ; µ» F (y j µ ci ) c j ¼» Discrete(¼) µ i» G 0 (µ) ¼» Dir( ; M) 64
65 Dirichlet process mixture, K 1 G y 0 i j µ i» F (y j µ i ) G µ i y i µ i j G» G(µ) N G» DP( ; G 0 (µ)) P (c i = c j c 1:i 1 )! P (c i 6= c j for all j < i j c 1:i 1 )! n i;c i 1 + i
66 Example: 19 reads of length 3 66
67 Gibbs sampler: 2000 reads, 100 haplotypes 67
68 Output: haplotypes, frequencies, posterior Haplotype frequency Posterior probability (confidence) haplotype index Zagordi et al (Nucl Acids Res 2010) 68
69 Performance of haplotype reconstruction, ROC curve (control experiment of 10 cloned viruses) Recall (ability to detect haplotypes) cut-off ( default 50) posterior ( default 0.9) PCR --- no PCR Precision (accuray of all haplotype calls) Zagordi et al (Nucl Acids Res 2010) 69
70 Haplotype frequency estimation no PCR PCR Frequency (estimated) Frequency (direct mapping) Zagordi et al (Nucl Acids Res 2010) 70
71 Clustering flograms (AmpliconNoise) CCAAATG Observed flowgrams f are obtained from ideal flowgrams u subject to noise (which is estimated from control data). P (f j u = n) T: A: C: G: Flowgrams are clustered (around ideal flowgram centers) with the distance measure d(f; u) = 1 M using an EM algorithm. MX i=1 log P (f i j u i ) Quince et al (Nat Meth 2009, BMC Bioinformatics 2011) 71
72 Application: HIV-1 B/C superinfection subtype B subtype C HIV pol gene average 72
73 Hepatitis C virus (HCV) Transmission bottlenecks Sequential bottlenecks during early acute infection Wang et al (J Virol 2010), Bull et al (PLoS Pathogens 2011) 73
74 Application: Dating infections with the coalescent Poon et al (AIDS 2011) 74
75 Application: rare variants 75
76 Application: quasispecies phenotypes predicted level of resistance 76
77 Application: HIV coreceptor use HIV can use CCR5 (R5 viruses) or CXCR4 (X4 viruses). The entry inhibitor Maraviroc targets only R5 viruses. Coreceptor use can be predicted from the env V3-loop sequence. Does the viral quasispecies contain X4 viruses? 77
78 X4 viruses emerge from pre-existing subpopulations prior to maraviroc treatment R5 X4 Archer et al (PLoS Comput Biol 2010) 78
79 Global haplotype assembly 79
80 Global haplotype assembly global 80
81 Global haplotype reconstruction: read graph GAGGTAGC GAGGTAGG CAGGTAAG GAGG GAGG CAGG GGTA GGTA GGTA TAGC TAGG TAAG GAGG GAGG CAGG GGTA GGTA GGTA TAGC TAGG TAAG GAGG CAGG GGTA TAGC TAGG TAAG begin GAGG CAGG GGTA TAGC TAGG TAAG end 81
82 Each path is a potential haplotype begin GAGG CAGG GGTA TAGC TAGG TAAG end begin GAGG CAGG GGTA TAGC TAGG TAAG end begin GAGG CAGG GGTA TAGC TAGG TAAG end begin GAGG CAGG GGTA TAGC TAGG TAAG end begin GAGG CAGG GGTA TAGC TAGG TAAG end begin GAGG CAGG GGTA TAGC TAGG TAAG end 82
83 Global quasispecies assembly methods Combinatorial assembly, based on the read graph Network flow Minimal path cover Greedy paths sampling (Prosperi et al., 2011, 2012) Graph coloring (Huang et al., 2012) Probabilistic assembly, based on HMM Integrating alignment (Jojic et al., 2008) Local-to-global using constraint-based DPM (Prabhakaran et al., 2010) Modeling recombinants 83
84 Probability of an edge u v in the read graph (which is transitively reduced, i.e., the Hasse diagram) length L q haplotypes u v N reads overhang Δ P (u! v; > k) = Ã 1 N Lq! k ¼ e kn Lq P (u! v; = k) = N Lq P (u! v; > k 1) Westbrooks et al (ISBRA 2008) 84
85 Quasispecies assembly via network flows (ViSpA) The value of the flow f through a read edge (b r, e r ) is the number of haplotypes that contain the read r. The cost function is derived from the overhang probability. Minimum Cost Parsimonious Quasispecies Assembly: Westbrooks et al (ISBRA 2008), Astrovskaya et al (BMC Bioinf 2011) 85
86 Quasispecies assembly as a minimal path cover Theorem (Dilworth, 1950; Hopcroft and Karp, 1973) (1) Every minimal cover of the read graph has the same cardinality (2) A minimal path cover can be computed in time O(N 3 ) Eriksson et al (PLoS Comput Biol 2008) 86
87 Chain decomposition 1000 reads from 5 haplotypes at 3% diversity 87
88 Chain decomposition 1000 reads from 5 haplotypes at 5% diversity 88
89 Chain decomposition 1000 reads from 5 haplotypes at 7% diversity 89
90 Haplotype frequencies: Generating reads from a (small) set of candidate haplotypes Estimate haplotype frequencies ¼p h using the EM algorithm ¼ h p(r) = X h2h ¼ h p(r j h) Eriksson et al (PLoS Comput Biol 2008) 90
91 ShoRAH Local Global Zagordi et al (BMC Bioinformatics 2010) 91
92 ShoRAH: Performance of haplotype reconstruction Ten haplotypes at equal frequencies, varying distances Eriksson et al (PLoS Comput Biol 2008) 92
93 Hidden Markov model generators haplotypes observed reads 93
94 Recombination generators haplotypes observed reads 94
95 Jumping hidden Markov model Many parameters requires strong regularization generators generator choice haplotypes observed reads Zagordi, Töpfer et al (RECOMB 2012) 95
96 Example: 3 generators + 24 recombinants Model selection Performance BIC score Fraction explained recombination no recombination Number of generators Hamming distance Zagordi, Töpfer et al (RECOMB 2012) 96
97 Summary Next-generation sequencing can be used to assess the diversity of mixed populations (e.g., tumors, RNA viruses) if sequencing errors are treated properly. Detecting low-frequency SNVs relies on careful modeling of count data and benefits from clonal control experiments. Local haplotype inference exploits phasing and results in improved error correction and in local diversity estimates of the population. Global quasispecies assembly is based either on HMMtype models or on combinatorial analysis of the read graph. It is limited by sequencing errors and population diversity. Software is available, but not yet fail-safe to use. 97
98 Review articles Beerenwinkel, N. & Zagordi, O. Ultra-deep sequencing for the analysis of viral populations. Current Opinion in Virology, 2011, 1, Vrancken, B.; Lequime, S.; Theys, K. & Lemey, P. Covering all bases in HIV research: unveiling a hidden world of viral evolution. AIDS Rev, 2010, 12, Barzon, L.; Lavezzo, E.; Militello, V.; Toppo, S. & Palù, G. Applications of next-generation sequencing technologies to diagnostic virology. Int J Mol Sci, 2011, 12, Metzker, M. L. Sequencing technologies - the next generation. Nat Rev Genet, 2010, 11,
99 99
De Novo Viral Quasispecies Assembly using Overlap Graphs
De Novo Viral Quasispecies Assembly using Overlap Graphs Alexander Schönhuth joint with Jasmijn Baaijens, Amal Zine El Aabidine, Eric Rivals Milano 18th of November 2016 Viral Quasispecies Assembly: HaploClique
More informationDETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester
DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING John Archer Faculty of Life Sciences University of Manchester HIV Dynamics and Evolution, 2008, Santa Fe, New Mexico. Overview
More informationarxiv: v2 [q-bio.pe] 21 Jan 2008
Viral population estimation using pyrosequencing Nicholas Eriksson 1,, Lior Pachter 2, Yumi Mitsuya 3, Soo-Yon Rhee 3, Chunlin Wang 3, Baback Gharizadeh 4, Mostafa Ronaghi 4, Robert W. Shafer 3, and Niko
More informationResearch Strategy: 1. Background and Significance
Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity
More informationTowards Personalized Medicine: An Improved De Novo Assembly Procedure for Early Detection of Drug Resistant HIV Minor Quasispecies in Patient Samples
www.bioinformation.net Volume 14(8) Software Model Towards Personalized Medicine: An Improved De Novo Assembly Procedure for Early Detection of Drug Resistant HIV Minor Quasispecies in Patient Samples
More informationTo test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
More informationChIP-seq data analysis
ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional
More informationClinical utility of NGS for the detection of HIV and HCV resistance
18 th Annual Resistance and Antiviral Therapy Meeting v Professor Janke Schinkel Academic Medical Centre, Amsterdam, The Netherlands Thursday 18 September 2014, Royal College of Physicians, London Clinical
More informationFuture applications of full length virus genome sequencing
Future applications of full length virus genome sequencing Paul Kellam Virus Genomics Revisiting early HIV resistance ideas AIDS 1991 Nature 1993 Virus genome sequencing Population or single genome Whole
More informationColorspace & Matching
Colorspace & Matching Outline Color space and 2-base-encoding Quality Values and filtering Mapping algorithm and considerations Estimate accuracy Coverage 2 2008 Applied Biosystems Color Space Properties
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationVIP: an integrated pipeline for metagenomics of virus
VIP: an integrated pipeline for metagenomics of virus identification and discovery Yang Li 1, Hao Wang 2, Kai Nie 1, Chen Zhang 1, Yi Zhang 1, Ji Wang 1, Peihua Niu 1 and Xuejun Ma 1 * 1. Key Laboratory
More information(ii) The effective population size may be lower than expected due to variability between individuals in infectiousness.
Supplementary methods Details of timepoints Caió sequences were derived from: HIV-2 gag (n = 86) 16 sequences from 1996, 10 from 2003, 45 from 2006, 13 from 2007 and two from 2008. HIV-2 env (n = 70) 21
More informationNEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY. 16th International WAVLD symposium, 10th OIE Seminar
NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY S. Van Borm, I. Monne, D. King and T. Rosseel 16th International WAVLD symposium, 10th OIE Seminar 07.06.2013 Viral livestock
More informationOncoPhase: Quantification of somatic mutation cellular prevalence using phase information
OncoPhase: Quantification of somatic mutation cellular prevalence using phase information Donatien Chedom-Fotso 1, 2, 3, Ahmed Ashour Ahmed 1, 2, and Christopher Yau 3, 4 1 Ovarian Cancer Cell Laboratory,
More informationIntroduction to Systems Biology of Cancer Lecture 2
Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology
More informationCharacterizing intra-host influenza virus populations to predict emergence
Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationHIV-1 acute infection: evidence for selection?
HIV-1 acute infection: evidence for selection? ROLLAND Morgane University of Washington Cohort & data S6 S5 T4 S4 T2 S2 T1 S1 S7 T3 DPS (days post symptoms) 3 (Fiebig I) 7 (Fiebig I) 13 (Fiebig V) 14 (Fiebig
More informationSupplementary Figure 1. Estimation of tumour content
Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent
More informationExploring HIV Evolution: An Opportunity for Research Sam Donovan and Anton E. Weisstein
Microbes Count! 137 Video IV: Reading the Code of Life Human Immunodeficiency Virus (HIV), like other retroviruses, has a much higher mutation rate than is typically found in organisms that do not go through
More informationP. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationReliable reconstruction of HIV-1 whole genome haplotypes reveals clonal interference and genetic hitchhiking among immune escape variants
Pandit and de Boer Retrovirology 2014, 11:56 RESEARCH Open Access Reliable reconstruction of HIV-1 whole genome haplotypes reveals clonal interference and genetic hitchhiking among immune escape variants
More informationReceived 4 August 2005/Accepted 7 December 2005
JOURNAL OF VIROLOGY, Mar. 2006, p. 2472 2482 Vol. 80, No. 5 0022-538X/06/$08.00 0 doi:10.1128/jvi.80.5.2472 2482.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Extensive Recombination
More informationMapping Evolutionary Pathways of HIV-1 Drug Resistance. Christopher Lee, UCLA Dept. of Chemistry & Biochemistry
Mapping Evolutionary Pathways of HIV-1 Drug Resistance Christopher Lee, UCLA Dept. of Chemistry & Biochemistry Stalemate: We React to them, They React to Us E.g. a virus attacks us, so we develop a drug,
More informationChronic HIV-1 Infection Frequently Fails to Protect against Superinfection
Chronic HIV-1 Infection Frequently Fails to Protect against Superinfection Anne Piantadosi 1,2[, Bhavna Chohan 1,2[, Vrasha Chohan 3, R. Scott McClelland 3,4,5, Julie Overbaugh 1,2* 1 Division of Human
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationCitation for published version (APA): Von Eije, K. J. (2009). RNAi based gene therapy for HIV-1, from bench to bedside
UvA-DARE (Digital Academic Repository) RNAi based gene therapy for HIV-1, from bench to bedside Von Eije, K.J. Link to publication Citation for published version (APA): Von Eije, K. J. (2009). RNAi based
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationYUMI YAMAGUCHI-KABATA AND TAKASHI GOJOBORI* Center for Information Biology, National Institute of Genetics, Mishima , Japan
JOURNAL OF VIROLOGY, May 2000, p. 4335 4350 Vol. 74, No. 9 0022-538X/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Reevaluation of Amino Acid Variability of the Human
More informationDistinguishing epidemiological dependent from treatment (resistance) dependent HIV mutations: Problem Statement
Distinguishing epidemiological dependent from treatment (resistance) dependent HIV mutations: Problem Statement Leander Schietgat 1, Kristof Theys 2, Jan Ramon 1, Hendrik Blockeel 1, and Anne-Mieke Vandamme
More informationMultiple sequence alignment
Multiple sequence alignment Bas. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, February 18 th 2016 Protein alignments We have seen how to create a pairwise alignment of two sequences
More informationViral genome sequencing: applications to clinical management and public health. Professor Judy Breuer
Viral genome sequencing: applications to clinical management and public health Professor Judy Breuer Why do whole viral genome sequencing Genome sequencing allows detection of multigenic resistance in
More informationUvA-DARE (Digital Academic Repository)
UvA-DARE (Digital Academic Repository) Superinfection with drug-resistant HIV is rare and does not contribute substantially to therapy failure in a large European cohort Bartha, I.; Assel, M.; Sloot, P.M.A.;
More informationRajesh Kannangai Phone: ; Fax: ; *Corresponding author
Amino acid sequence divergence of Tat protein (exon1) of subtype B and C HIV-1 strains: Does it have implications for vaccine development? Abraham Joseph Kandathil 1, Rajesh Kannangai 1, *, Oriapadickal
More informationEvolution of influenza
Evolution of influenza Today: 1. Global health impact of flu - why should we care? 2. - what are the components of the virus and how do they change? 3. Where does influenza come from? - are there animal
More informationAn Evolutionary Story about HIV
An Evolutionary Story about HIV Charles Goodnight University of Vermont Based on Freeman and Herron Evolutionary Analysis The Aids Epidemic HIV has infected 60 million people. 1/3 have died so far Worst
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationInference of Isoforms from Short Sequence Reads
Inference of Isoforms from Short Sequence Reads Tao Jiang Department of Computer Science and Engineering University of California, Riverside Tsinghua University Joint work with Jianxing Feng and Wei Li
More informationHIV-1 Dual Infection and Neurocognitive Impairment
HIV-1 Dual Infection and Neurocognitive Impairment Gabriel Wagner, MD Assistant Professor of Medicine Infectious Diseases & Global Public Health UC San Diego HIV-Associated End Organ Damage Antiretroviral
More informationModule 3. Genomic data and annotations in public databases Exercises Custom sequence annotation
Module 3. Genomic data and annotations in public databases Exercises Custom sequence annotation Objectives Upon completion of this exercise, you will be able to use the annotation pipelines provided by
More informationAnalysis of the genetic diversity of influenza A viruses using next-generation DNA sequencing
See discussions, stats, and author profiles for this publication at: http://www.researchgate.net/publication/273470093 Analysis of the genetic diversity of influenza A viruses using next-generation DNA
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationDeep-Sequencing of HIV-1
Deep-Sequencing of HIV-1 The quest for true variants Alexander Thielen, Martin Däumer 09.05.2015 Limitations of drug resistance testing by standard-sequencing Blood plasma RNA extraction RNA Reverse Transcription/
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationVirusDetect pipeline - virus detection with small RNA sequencing
VirusDetect pipeline - virus detection with small RNA sequencing CSC webinar 16.1.2018 Eija Korpelainen, Kimmo Mattila, Maria Lehtivaara Big thanks to Jan Kreuze and Jari Valkonen! Outline Small interfering
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationBelow, we included the point-to-point response to the comments of both reviewers.
To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively
More informationNEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca
NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA
More informationNew technologies reaching the clinic
New technologies reaching the clinic Martin Däumer May 31, 2018 Deep-sequencing Standard Sanger-sequencing...PQIYMDDHTRE... Ultra-deep-sequencing...PQIYMDDHTRE......PQIYMDDHTRE......PQIYVDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE...
More information7.014 Problem Set 7 Solutions
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 7.014 Problem Set 7 Solutions Question 1 Part A Antigen binding site Antigen binding site Variable region Light chain Light chain Variable
More informationUnderstanding HIV. Transmitted/Founder Viruses. Brandon Keele SAIC-Frederick National Cancer Institute
Understanding HIV Transmission Utilizing Transmitted/Founder Viruses Brandon Keele SAIC-Frederick National Cancer Institute AIDS Vaccine 2011 15 September 2011 Overview Several years ago, the CHAVI sought
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationInfluenza hemagglutinin protein stability correlates with fitness and seasonal evolutionary dynamics
Influenza hemagglutinin protein stability correlates with fitness and seasonal evolutionary dynamics Eili Y. Klein, Ph.D. Assistant Professor, Department of Emergency Medicine & Fellow, Center for Disease
More informationSupplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR
Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationA new wild-type in the era of transmitted drug resistance
A new wild-type in the era of transmitted drug resistance EHR 2018 Rome KU Leuven 1 A new wild-type in the era of transmitted drug resistance? KU Leuven 2 Measurably evolving viruses Evolutionary rate
More informationObstacles and challenges in the analysis of microrna sequencing data
Obstacles and challenges in the analysis of microrna sequencing data (mirna-seq) David Humphreys Genomics core Dr Victor Chang AC 1936-1991, Pioneering Cardiothoracic Surgeon and Humanitarian The ABCs
More informationMapping evolutionary pathways of HIV-1 drug resistance using conditional selection pressure. Christopher Lee, UCLA
Mapping evolutionary pathways of HIV-1 drug resistance using conditional selection pressure Christopher Lee, UCLA HIV-1 Protease and RT: anti-retroviral drug targets protease RT Protease: responsible for
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationData Mining in Bioinformatics Day 9: String & Text Mining in Bioinformatics
Data Mining in Bioinformatics Day 9: String & Text Mining in Bioinformatics Karsten Borgwardt March 1 to March 12, 2010 Machine Learning & Computational Biology Research Group MPIs Tübingen Karsten Borgwardt:
More informationUnderstanding DNA Copy Number Data
Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php
More informationThe BLAST search on NCBI ( and GISAID
Supplemental materials and methods The BLAST search on NCBI (http:// www.ncbi.nlm.nih.gov) and GISAID (http://www.platform.gisaid.org) showed that hemagglutinin (HA) gene of North American H5N1, H5N2 and
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationMapping the Antigenic and Genetic Evolution of Influenza Virus
Mapping the Antigenic and Genetic Evolution of Influenza Virus Derek J. Smith, Alan S. Lapedes, Jan C. de Jong, Theo M. Bestebroer, Guus F. Rimmelzwaan, Albert D. M. E. Osterhaus, Ron A. M. Fouchier Science
More informationModeling the Antigenic Evolution of Influenza Viruses from Sequences
Modeling the Antigenic Evolution of Influenza Viruses from Sequences Taijiao Jiang Center of Systems Medicine, Chinese Academy of Medical Sciences Suzhou Institute of Systems Medicine October 8-10, 2015.
More informationBioinformatics. Sequence Analysis: Part III. Pattern Searching and Gene Finding. Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute
Bioinformatics Sequence Analysis: Part III. Pattern Searching and Gene Finding Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Course Syllabus Jan 7 Jan 14 Jan 21 Jan 28 Feb 4 Feb 11 Feb 18
More informationTransmission Bottleneck Size Estimation from Pathogen Deep- Sequencing Data, with an Application to Human Influenza A Virus
JVI Accepted Manuscript Posted Online 3 May 2017 J. Virol. doi:10.1128/jvi.00171-17 Copyright 2017 Sobel Leonard et al. This is an open-access article distributed under the terms of the Creative Commons
More informationModels of HIV during antiretroviral treatment
Models of HIV during antiretroviral treatment Christina M.R. Kitchen 1, Satish Pillai 2, Daniel Kuritzkes 3, Jin Ling 3, Rebecca Hoh 2, Marc Suchard 1, Steven Deeks 2 1 UCLA, 2 UCSF, 3 Brigham & Womes
More informationEmergence of Hemagglutinin Mutations during the Course of Influenza Infection
University of Pennsylvania ScholarlyCommons Statistics Papers Wharton Faculty Research 11-5-2015 Emergence of Hemagglutinin Mutations during the Course of Influenza Infection Anna Cushing Amanda Kamali
More informationSCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab
SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline
More informationLarge-scale identity-by-descent mapping discovers rare haplotypes of large effect. Suyash Shringarpure 23andMe, Inc. ASHG 2017
Large-scale identity-by-descent mapping discovers rare haplotypes of large effect Suyash Shringarpure 23andMe, Inc. ASHG 2017 1 Why care about rare variants of large effect? Months from randomization 2
More informationThe Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0
The Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0 Introduction Loss of erozygosity (LOH) represents the loss of allelic differences. The SNP markers on the SNP Array 6.0 can be used
More informationSingle-Cell Sequencing in Cancer. Peter A. Sims, Columbia University G4500: Cellular & Molecular Biology of Cancer October 22, 2018
Single-Cell Sequencing in Cancer Peter A. Sims, Columbia University G4500: Cellular & Molecular Biology of Cancer October 22, 2018 Lecture will focus on technology for and applications of single-cell RNA-seq
More informationAIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria
AIDS - Knowledge and Dogma Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/17 2010, Vienna, Austria Reliability of PCR to detect genetic sequences from HIV Juan Manuel
More informationPerformance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
More informationRNA Secondary Structures: A Case Study on Viruses Bioinformatics Senior Project John Acampado Under the guidance of Dr. Jason Wang
RNA Secondary Structures: A Case Study on Viruses Bioinformatics Senior Project John Acampado Under the guidance of Dr. Jason Wang Table of Contents Overview RSpredict JAVA RSpredict WebServer RNAstructure
More informationMapping evolutionary pathways of HIV-1 drug resistance using conditional selection pressure. Christopher Lee, UCLA
Mapping evolutionary pathways of HIV-1 drug resistance using conditional selection pressure Christopher Lee, UCLA Stalemate: We React to them, They React to Us E.g. a virus attacks us, so we develop a
More informationThe Evolutionary Analysis of Emerging Low Frequency HIV-1 CXCR4 Using Variants through Time An Ultra- Deep Approach
The Evolutionary Analysis of Emerging Low Frequency HIV-1 CXCR4 Using Variants through Time An Ultra- Deep Approach John Archer 1, Andrew Rambaut 2, Bruce E. Taillon 3, P. Richard Harrigan 4,5, Marilyn
More informationCONSTRUCTION OF PHYLOGENETIC TREE USING NEIGHBOR JOINING ALGORITHMS TO IDENTIFY THE HOST AND THE SPREADING OF SARS EPIDEMIC
CONSTRUCTION OF PHYLOGENETIC TREE USING NEIGHBOR JOINING ALGORITHMS TO IDENTIFY THE HOST AND THE SPREADING OF SARS EPIDEMIC 1 MOHAMMAD ISA IRAWAN, 2 SITI AMIROCH 1 Institut Teknologi Sepuluh Nopember (ITS)
More informationIdentification of Mutation(s) in. Associated with Neutralization Resistance. Miah Blomquist
Identification of Mutation(s) in the HIV 1 gp41 Subunit Associated with Neutralization Resistance Miah Blomquist What is HIV 1? HIV-1 is an epidemic that affects over 34 million people worldwide. HIV-1
More informationCRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
More informationThe Open Bioinformatics Journal, 2014, 8, 1-5 1
Send Orders for Reprints to reprints@benthamscience.net The Open Bioinformatics Journal, 214, 8, 1-5 1 Open Access Performances of Bioinformatics Pipelines for the Identification of Pathogens in Clinical
More informationDevelopment of Real Time RT-PCR Assays for Neuraminidase Subtyping of Avian Influenza Virus
Development of Real Time RT-PCR Assays for Neuraminidase Subtyping of Avian Influenza Virus Yanyan Huang 1, Mazhar Khan 1, and Ion Măndoiu 1 Department of Pathobiology & Veterinary Science, University
More informationFor all of the following, you will have to use this website to determine the answers:
For all of the following, you will have to use this website to determine the answers: http://blast.ncbi.nlm.nih.gov/blast.cgi We are going to be using the programs under this heading: Answer the following
More informationPrinciples of phylogenetic analysis
Principles of phylogenetic analysis Arne Holst-Jensen, NVI, Norway. Fusarium course, Ås, Norway, June 22 nd 2008 Distance based methods Compare C OTUs and characters X A + D = Pairwise: A and B; X characters
More informationCS 4365: Artificial Intelligence Recap. Vibhav Gogate
CS 4365: Artificial Intelligence Recap Vibhav Gogate Exam Topics Search BFS, DFS, UCS, A* (tree and graph) Completeness and Optimality Heuristics: admissibility and consistency CSPs Constraint graphs,
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationHigh Failure Rate of the ViroSeq HIV-1 Genotyping System for Drug Resistance Testing in Cameroon, a Country with Broad HIV-1 Genetic Diversity
JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2011, p. 1635 1641 Vol. 49, No. 4 0095-1137/11/$12.00 doi:10.1128/jcm.01478-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. High Failure
More informationVirus Genetic Diversity
Virus Genetic Diversity Jin-Ching Lee, Ph.D. 李 jclee@kmu.edu.tw http://jclee.dlearn.kmu.edu.t jclee.dlearn.kmu.edu.tw TEL: 2369 Office: N1024 Faculty of Biotechnology Kaohsiung Medical University Outline
More informationGenome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.
GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant
More informationStudent Handout Bioinformatics
Student Handout Bioinformatics Introduction HIV-1 mutates very rapidly. Because of its high mutation rate, the virus will continue to change (evolve) after a person is infected. Thus, within an infected
More informationarxiv: v1 [cs.ce] 30 Dec 2014
Fast and Scalable Inference of Multi-Sample Cancer Lineages Victoria Popic 1, Raheleh Salari 1, Iman Hajirasouliha 1, Dorna Kashef-Haghighi 1, Robert B West and Serafim Batzoglou 1* arxiv:141.874v1 [cs.ce]
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationGoing Nowhere Fast: Lentivirus genetic sequence evolution does not correlate with phenotypic evolution.
Going Nowhere Fast: Lentivirus genetic sequence evolution does not correlate with phenotypic evolution. Brian T. Foley, PhD btf@lanl.gov HIV Genetic Sequences, Immunology, Drug Resistance and Vaccine Trials
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationSMPD 287 Spring 2015 Bioinformatics in Medical Product Development. Final Examination
Final Examination You have a choice between A, B, or C. Please email your solutions, as a pdf attachment, by May 13, 2015. In the subject of the email, please use the following format: firstname_lastname_x
More informationInter-country mixing in HIV transmission clusters: A pan-european phylodynamic study
Inter-country mixing in HIV transmission clusters: A pan-european phylodynamic study Prabhav Kalaghatgi Max Planck Institute for Informatics March 20th 2013 HIV epidemic (2009) Prabhav Kalaghatgi 2/18
More information