Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.
|
|
|
- Rebecca Dixon
- 5 years ago
- Views:
Transcription
1 GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014
2 Turnkey Variant Analysis Project Provides a collection of analysis tools and computational frameworks for streamlined discovery and interpretation of genetic variants VarScan Pindel BreakDancer Genome Variant Investigation Portal Multi-tool Variant discovery Cloud computing Scalability Extensibility Poster #1678M (Monday) local Cloud (AWS) tvap.genome.wustl.edu
3 Genome Variant Investigation Portal Web server and interface for germline and somatic variant-discovery tools VarScan Pindel BreakDancer Heuristic/statistical calling of single nucleotide variants (SNVs) Indel detection for paired reads based on local realignment Structural variant (SV) detection for paired reads GenomeSTRiP (Harvard U.) Structural variant detection and genotyping Concurrent pipelines (SNV, indel, SV) with parallelization Launchable on local machines or on the cloud through Amazon Web Services (AWS) Download results from AWS via web browser
4 Biological Discoveries (selected) Comprehensive molecular portraits of human breast tumours Identified four main types by combining data from five platforms Nature 490, (2012) Clonal evolution in relapsed acute myeloid leukaemia Cancer consists of multiple variants; founding clone may give rise to relapse clone; subclones may survive therapy and mutate further Nature 481, (2012) Genomic Landscape of Non-Small Cell Lung Cancer in Smokers and Never-Smokers Of patients with lung cancer, smokers found to have10x more mutations than non-smokers Cell 150, (2012) Discovery & genotyping for structural variants in populations ~14,000 deletion polymorphisms with allelic states (1000G pilot) Nature Genetics 43, (2011)
5 Application to APOL1: Demo Representative samples from PUR population from 1000 Genomes Analyze within the range chr22 : Mbp for known variants: Sample Region Variant Isoforms HG :36,661,906 A / G G1 (non-silent) HG :36,662,041 AATAATT / A G2 (Δ6) HG :36,133,448 Δ 767bp
6 Login Select AWS Click Next
7 Sample & Reference Selection Specify path & retrieve Select samples Entering path: Copy the given URI. Click Retrieve. Click on all the PUR low_coverage items to transfer them to the Selected bams textbox. Select reference hs37d5.chr22.fa. Select reference (hs37d5.chr22.fa) Click Next.
8 SNV Detection: VarScan SNV All 22: CheckVarScan Select Germline Select SNVs only Select All (pooled) samples Select User-defined region and enter 22: Keep p-value: 0.99 Set Output vcf: True Click Next.
9 Indel Detection: Pindel Select All Check Run Pindel Select All (pooled) samples Select User-defined region and enter 22: Click Next. 22:
10 SV Detection: BreakDancer 22: Check BreakDancer In Step 1, select All (pooled) samples In Step 3, select Intra (ITX) only, user-defined region and enter 22: Click Next.
11 SV Detection & Genotyping: GenomeSTRiP 1. Check Run GenomeSTRiP 2. Verify reference is hs37d5.chr22.fa 3. Select mask Hs37d5 human_g1k_v37.mask.36.fasta.chr22 4. GC normalization: True, with cn2_mask_g1k_v37.fasta 5. Chromosome: User-defined with 22: Variant size: 100bp 100 kbp. 100bp- 100kbp
12 Amazon AWS Submission Select machine type Jobs have been tested to finish within a few minutes Where to send results Validate & submit
13 Results DEL_1 T <DEL> SVLEN=-762;SVTYPE=DEL AATAATT A. PASS END= ;HOMLEN=4;HOMSEQ=ATAA;SVLEN=-6;SVTYPE=DEL; A G. PASS ADP=7;WT=1;HET=0;HOM=0;NC= AATAATT A. PASS ADP=4;WT=0;HET=1;HOM=0;NC=2;
14 Jay Mashl genome.wustl.edu) Kai Ye genome.wustl.edu) Li Ding genome.wustl.edu)...and with thanks to the Ding Lab members Poster #1678 / M (this afternoon) National Human Genome Research Institute
15 Alternate slides
16 Amazon AWS S3 Data Retrieval Links to actual files to be generated, along with merged VCF Click links to download Participants will identify variants in the output (Left) Prepared results available, in case of technology problems
DNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
Analysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
PSSV User Manual (V2.1)
PSSV User Manual (V2.1) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant
Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer
Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:
Data mining with Ensembl Biomart. Stéphanie Le Gras
Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:
PSSV User Manual (V1.0)
PSSV User Manual (V1.0) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
Molecular Characterization of Tumors Using Next-Generation Sequencing
Molecular Characterization of Tumors Using Next-Generation Sequencing Using BaseSpace to visualize molecular changes in cancer. Tumor-Normal Sequencing Data in BaseSpace To enable researchers new to next-generation
Calling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017
1 Calling DNA variants SNVs, CNVs, and SVs Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 Calling DNA variants SNVs, CNVs, SVs 2 1. What is a variant? 2. Paired End read
Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing
Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical
Supplementary Figure 1. Estimation of tumour content
Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent
Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN
SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN Structural variation (SV) Variants larger than 50bps Affect
Identification of Genetic Determinants of Metastasis and Clonal Relationships Between Primary and Metastatic Tumors
Washington University in St. Louis Washington University Open Scholarship All Theses and Dissertations (ETDs) Spring 5-1-2013 Identification of Genetic Determinants of Metastasis and Clonal Relationships
AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
Core Technology Development Team Meeting
Core Technology Development Team Meeting To hear the meeting, you must call in Toll-free phone number: 1-866-740-1260 Access Code: 2201876 For international call in numbers, please visit: https://www.readytalk.com/account-administration/international-numbers
Golden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
Integrated Analysis of Copy Number and Gene Expression
Integrated Analysis of Copy Number and Gene Expression Nexus Copy Number provides user-friendly interface and functionalities to integrate copy number analysis with gene expression results for the purpose
Genetics Mutations 2 Teacher s Guide
Genetics Mutations 2 Teacher s Guide 1.0 Summary Mutations II is an extension activity, which reviews and enhances the previous Core activities. We recommend that it follow Mutations and X-Linkage. This
Nature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
COMPUTATIONAL OPTIMISATION OF TARGETED DNA SEQUENCING FOR CANCER DETECTION
COMPUTATIONAL OPTIMISATION OF TARGETED DNA SEQUENCING FOR CANCER DETECTION Pierre Martinez, Nicholas McGranahan, Nicolai Juul Birkbak, Marco Gerlinger, Charles Swanton* SUPPLEMENTARY INFORMATION SUPPLEMENTARY
Structural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
ISOWN: accurate somatic mutation identification in the absence of normal tissue controls
Kalatskaya et al. Genome Medicine (2017) 9:59 DOI 10.1186/s13073-017-0446-9 SOFTWARE ISOWN: accurate somatic mutation identification in the absence of normal tissue controls Irina Kalatskaya 1*, Quang
AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients
AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:
User Instruction Guide
User Instruction Guide Table of Contents Logging In and Logging Out of MMSx 1 Creating a TPN (Terminal Profile Number) 2 Single Merchant 2 From Navigation Bar 2 From Home Page Link 4 Multiple Merchants
Clonal Evolution of saml. Johnnie J. Orozco Hematology Fellows Conference May 11, 2012
Clonal Evolution of saml Johnnie J. Orozco Hematology Fellows Conference May 11, 2012 CML: *bcr-abl and imatinib Melanoma: *braf and vemurafenib CRC: *k-ras and cetuximab Esophageal/Gastric: *Her-2/neu
Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
PERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST
INCLUDED IN THIS REPORT: REVIEW OF YOUR GENETIC INFORMATION RELEVANT TO ENDOMETRIOSIS PERSONAL EDUCATIONAL INFORMATION RELEVANT TO YOUR GENES INFORMATION FOR OBTAINING YOUR ENTIRE X-SCREEN DATA FILE PERSONALIZED
Original Article International Cancer Genome Consortium Data Portal a one-stop shop for cancer genomics data
Original Article International Cancer Genome Consortium Data Portal a one-stop shop for cancer genomics data Junjun Zhang 1, Joachim Baran 1, A. Cros 1, Jonathan M. Guberman 1, Syed Haider 2, Jack Hsu
Performance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
GENETIC TESTING FOR PREDICTING RISK OF NONFAMILIAL BREAST CANCER
Non-Discrimination Statement and Multi-Language Interpreter Services information are located at the end of this document. Coverage for services, procedures, medical devices and drugs are dependent upon
Research Strategy: 1. Background and Significance
Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity
Ginkgo Interactive analysis and quality assessment of single-cell CNV data
Ginkgo Interactive analysis and quality assessment of single-cell CNV data @RobAboukhalil Robert Aboukhalil, Tyler Garvin, Jude Kendall, Timour Baslan, Gurinder S. Atwal, Jim Hicks, Michael Wigler, Michael
The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients
The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
CNV PCA Search Tutorial
CNV PCA Search Tutorial Release 8.1 Golden Helix, Inc. March 18, 2014 Contents 1. Data Preparation 2 A. Join Log Ratio Data with Phenotype Information.............................. 2 B. Activate only
MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
Genomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC.
Supplementary Figure 1 Rates of different mutation types in CRC. (a) Stratification by mutation type indicates that C>T mutations occur at a significantly greater rate than other types. (b) As for the
OncoPhase: Quantification of somatic mutation cellular prevalence using phase information
OncoPhase: Quantification of somatic mutation cellular prevalence using phase information Donatien Chedom-Fotso 1, 2, 3, Ahmed Ashour Ahmed 1, 2, and Christopher Yau 3, 4 1 Ovarian Cancer Cell Laboratory,
underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
Supplementary Figures Figure S1. Patient cohorts and study design. To define and interrogate the genetic alterations underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
Lionbridge Connector for Hybris. User Guide
Lionbridge Connector for Hybris User Guide Version 2.1.0 November 24, 2017 Copyright Copyright 2017 Lionbridge Technologies, Inc. All rights reserved. Published in the USA. March, 2016. Lionbridge and
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
Myeloma Genetics what do we know and where are we going?
in partnership with Myeloma Genetics what do we know and where are we going? Dr Brian Walker Thames Valley Cancer Network 14 th September 2015 Making the discoveries that defeat cancer Myeloma Genome:
Reporting TP53 gene analysis results in CLL
Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review
Global variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole
Tumor mutational burden and its transition towards the clinic
Tumor mutational burden and its transition towards the clinic G C C A T C A C Wolfram Jochum Institute of Pathology Kantonsspital St.Gallen CH-9007 St.Gallen wolfram.jochum@kssg.ch 30th European Congress
Introduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Systematic investigation of cancer-associated somatic point mutations in SNP databases HyunChul Jung 1,2, Thomas Bleazard 3, Jongkeun Lee 1 and Dongwan Hong 1 1. Cancer Genomics
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
No mutations were identified.
Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123
Below, we included the point-to-point response to the comments of both reviewers.
To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively
DPV. Ramona Ranz, Andreas Hungele, Prof. Reinhard Holl
DPV Ramona Ranz, Andreas Hungele, Prof. Reinhard Holl Contents Possible use of DPV Languages Patient data Search for patients Patient s info Save data Mandatory fields Diabetes subtypes ICD 10 Fuzzy date
Cancer Validation in the 100,000 genomes project. Dr Shirley Henderson ACGS spring meeting 06/07/16
Cancer Validation in the 100,000 genomes project Dr Shirley Henderson ACGS spring meeting 06/07/16 Cancer is a lesion of the Genome Diagnosis Cancer Molecular Lesions Prognosis Disease Monitoring Why is
ACE ImmunoID. ACE ImmunoID. Precision immunogenomics. Precision Genomics for Immuno-Oncology
ACE ImmunoID ACE ImmunoID Precision immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. A universal biomarker platform for immuno-oncology Patient response to cancer immunotherapies
Session 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20
NGS ONCOPANELS: FDA S PERSPECTIVE
NGS ONCOPANELS: FDA S PERSPECTIVE CBA Workshop: Biomarker and Application in Drug Development August 11, 2018 Rockville, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration
Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
Analyzing Genomic Data with PyEnsembl and Varcode. Alex Rubinsteyn SciPy - July 9th, 2015
Analyzing Genomic Data with PyEnsembl and Varcode Alex Rubinsteyn SciPy - July 9th, 2015 HammerLab @ Mount Sinai http://www.hammerlab.org/research/ Not biologists! Most lab members have a background in
TCGA. The Cancer Genome Atlas
TCGA The Cancer Genome Atlas TCGA: History and Goal History: Started in 2005 by the National Cancer Institute (NCI) and the National Human Genome Research Institute (NHGRI) with $110 Million to catalogue
Computational Systems Biology: Biology X
Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#4:(October-0-4-2010) Cancer and Signals 1 2 1 2 Evidence in Favor Somatic mutations, Aneuploidy, Copy-number changes and LOH
Nature Medicine: doi: /nm.4439
Figure S1. Overview of the variant calling and verification process. This figure expands on Fig. 1c with details of verified variants identification in 547 additional validation samples. Somatic variants
Clinical Utility of Actionable Genome Information in Precision Oncology Clinic
Indian Ocean Rim 2017 Laboratory Haematology Congress 2017. 6.18-19, Singapore Clinical Utility of Actionable Genome Information in Precision Oncology Clinic Reimbursement program for NGS panel tests in
NGS Types of gene dossier applications UKGTN can evaluate
NGS Types of gene dossier applications UKGTN can evaluate Jo Whittaker on behalf of the Genetic Test Evaluation Working Group & UKGTN Project team NGS used in a number of ways Replacement technology for
Use Case 9: Coordinated Changes of Epigenomic Marks Across Tissue Types. Epigenome Informatics Workshop Bioinformatics Research Laboratory
Use Case 9: Coordinated Changes of Epigenomic Marks Across Tissue Types Epigenome Informatics Workshop Bioinformatics Research Laboratory 1 Introduction Active or inactive states of transcription factor
BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
Genomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy
Genomic complexity and arrays in CLL Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Clinical relevance of genomic complexity (GC) in CLL GC has been identified as a critical negative
Session 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 28
FONS Nové sekvenační technologie vklinickédiagnostice?
FONS 2010 Nové sekvenační technologie vklinickédiagnostice? Sekvenování amplikonů Sequence capture Celogenomové sekvenování FONS 2010 Sekvenování amplikonů Amplicon sequencing - amplicon sequencing enables
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/7/283/283ra54/dc1 Supplementary Materials for Clonal status of actionable driver events and the timing of mutational processes in cancer evolution
38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16
38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 PGAR: ASD Candidate Gene Prioritization System Using Expression Patterns Steven Cogill and Liangjiang Wang Department of Genetics and
Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit
APPLICATION NOTE Ion PGM System Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit Key findings The Ion PGM System, in concert with the Ion ReproSeq PGS View Kit and Ion Reporter
Identification of genomic alterations in cervical cancer biopsies by exome sequencing
Chapter- 4 Identification of genomic alterations in cervical cancer biopsies by exome sequencing 105 4.1 INTRODUCTION Athough HPV has been identified as the prime etiological factor for cervical cancer,
LESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2
For a complete list of defined terms, see the Glossary. Transformation the process by which a cell acquires characteristics of a tumor cell. LESSON 3.2 WORKBOOK How do normal cells become cancer cells?
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
Hands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
Functional analysis of DNA variants
Functional analysis of DNA variants GS011143, Introduction to Bioinformatics The University of Texas GSBS program, Fall 2012 Ken Chen, Ph.D. Department of Bioinformatics and Computational Biology UT MD
SubcloneSeeker: a computational framework for reconstructing tumor clone structure for cancer variant interpretation and prioritization
Qiao et al. Genome Biology 2014, 15:443 METHOD Open Access SubcloneSeeker: a computational framework for reconstructing tumor clone structure for cancer variant interpretation and prioritization Yi Qiao
Detection of copy number variations in PCR-enriched targeted sequencing data
Detection of copy number variations in PCR-enriched targeted sequencing data German Demidov Parseq Lab, Saint-Petersburg University of Russian Academy of Sciences, current: Center for Genomic Regulation
Using Network Flow to Bridge the Gap between Genotype and Phenotype. Teresa Przytycka NIH / NLM / NCBI
Using Network Flow to Bridge the Gap between Genotype and Phenotype Teresa Przytycka NIH / NLM / NCBI Journal Wisla (1902) Picture from a local fare in Lublin, Poland Genotypes Phenotypes Journal Wisla
Run Time Tester Requirements Document
Run Time Tester Requirements Document P. Sherwood 7 March 2004 Version: 0.4 Status: Draft After review 2 March 2004 Contents 1 Introduction 2 1.1 Scope of the Requirements Document.....................
DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester
DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING John Archer Faculty of Life Sciences University of Manchester HIV Dynamics and Evolution, 2008, Santa Fe, New Mexico. Overview
Clay Tablet Connector for hybris. User Guide. Version 1.5.0
Clay Tablet Connector for hybris User Guide Version 1.5.0 August 4, 2016 Copyright Copyright 2005-2016 Clay Tablet Technologies Inc. All rights reserved. All rights reserved. This document and its content
MutationTaster & RegulationSpotter
Practical MutationTaster & RegulationSpotter Daniela Hombach & Jana Marie Schwarz Exzellenzcluster NeuroCure Charité Universitätsmedizin Berlin AG Translational Genomics 08.11.2017 Rare diseases 7000 8000rare
COSMIC - Catalogue of Somatic Mutations in Cancer
COSMIC - Catalogue of Somatic Mutations in Cancer http://cancer.sanger.ac.uk/cosmic https://academic.oup.com/nar/articl e-lookup/doi/10.1093/nar/gkw1121 Data In Large-scale systematic screens Detailed
VMMC Installation Guide (Windows NT) Version 2.0
VMMC Installation Guide (Windows NT) Version 2.0 The Shrimp Project Department of Computer Science Princeton University February 1999 About this Document Welcome to VMMC! This document describes how to
Proteome Discoverer Version 1.3
Xcalibur Proteome Discoverer Version 1.3 Installation Guide XCALI-97359 Revision A May 2011 2011 Thermo Fisher Scientific Inc. All rights reserved. Xcalibur is a registered trademark of Thermo Fisher Scientific
Investigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
Supplementary Figure 1
Supplementary Figure 1 An example of the gene-term-disease network automatically generated by Phenolyzer web server for 'autism'. The largest word represents the user s input term, Autism. The pink round
SUPPLEMENTARY INFORMATION
doi:10.1038/nature13908 Supplementary Tables Supplementary Table 1: Families in this study (.xlsx) All families included in the study are listed. For each family, we show: the genders of the probands and
ARTICLE RESEARCH. Macmillan Publishers Limited. All rights reserved
Extended Data Figure 6 Annotation of drivers based on clinical characteristics and co-occurrence patterns. a, Putative drivers affecting greater than 10 patients were assessed for enrichment in IGHV mutated
MRC-Holland MLPA. Description version 06; 23 December 2016
SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated
Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
Finding subtle mutations with the Shannon human mrna splicing pipeline
Finding subtle mutations with the Shannon human mrna splicing pipeline Presentation at the CLC bio Medical Genomics Workshop American Society of Human Genetics Annual Meeting November 9, 2012 Peter K Rogan
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
New observations on maternal age effect on germline de novo mutations
Received 6 May 215 Accepted 18 Dec 215 Published 19 Jan 216 DOI: 1.138/ncomms1486 OPEN New observations on maternal age effect on germline de novo mutations Wendy S.W. Wong 1, Benjamin D. Solomon 1,2,3,