中国科技论文在线. * CFTR cl - [5]

Transcription

1 CFTR 1 * * xiaoqun1988@xysm.net CFTR PCR western blot CFTR CFTR cl - CFTR Real-time PCR 4h CFTR mrna CFTR Western blot 4h CFTR CFTR cl - 5 µm forskolin CFTR cl - forskolin 4h BECs CFTR cl - cl - CFTR cl - glibenclamide CFTR cl - DIDS cl - CFTR cl - CFTR CF (Cystic fibrosis transmembrane conductance regulator, CFTR)Cl- Cl - [1-2] Cystic fibrosis, CFCFTR Cl - [3-4] CFTR [5] CFTR 1 No:

2 CFTR 10 Wistar n540cm30cm 25cm 1.5ppm 3 1 (bronchial epithelial cells, BECs ) Gruenent DMEM/F12 10% 100Uml50ml % 4% 30min BECs 80%6h 1ml 4% 30min4PBS 3min0.5% Triton X-100 PBS 1ml 10min2% BSA PBS 1ml 60min 2% BSA PBS Ìl 372h 4PBS 5min Ìl2hPBS 5min 400PBS PCR TrizolBECsRNAAMV 2

3 TaqmanReal time PCRTaqman5 ä FAM3 ätamragapdh CFTR forward 5 - TTAAAGCTGTCAAGCCGTGTTC-3 CFTR reverse 5 -GCCAATGCAAGTCCTTCATCA -3 CFTR probe FAM+ TGGACAACTTGTTAGTCTCCTTTCC +TAMRA GAPDH forward GAPDH reverse CCACTCCTCCACCTTTGAC ACCCTGTTGCTGTAGCCA GAPDH probe FAM-TTGCCCTCAACGACCACTTTGTC-TAMRA 2 Ìl 50 ÌlPCR509410S 5330S7240SRNA CFTRmRNAGAPDH mrnamrna RNARNA Western blot RIPA BSA 30 Ìg SDS - PAGE (4%6%)PVDF 4 CFTR ( ) 4 HRP ( 14000) 2 h ECL X (mmol/l)145 mm NaCl4 mm CsCl1 mm CaCl 2 5 mm glucose10 mm TESPH mOsm(mmol/L)113 mm L-aspartic acid113 mm CsOH 27 mm CsCl1 mm NaCl1 mm MgCl 2 1 mm EGTA10 mm TES PH mOsm5µmol/L forskolin CFTR cl - -40mV-100mV 100mV200mS20mV2S -40mV I-V S SPSS 3

4 t P CFTR CFTR1ACFTR 1C1B A B C control negative control ozone 20 Ìm Figure 1: Immunofluorescence of CFTR in respiratory epithelium from rat trachea mucosa. Normal (A), negative control (B) and ozone stress rat (C). Bars, 20 µm. BECs CFTR Real-time PCR BECs 30min CFTR mrna (CFTR/GAPDH: control group was 1.35 ± 0.3, ozone group was 0.46 ± 0.07, P < 0.01, n=4) (2)western blot BECs CFTR CFTR Hoechest CFTR (3)Western blot 4 CFTR (CFTR/actin protein density: control group was 0.81 ± 0.02, ozone group was 0.33 ± 0.02, P < 0.01, n=5) (4) 4

5 CFTR/GAPDH control ozone RT-PCRCFTR mrna Figure 2: Real time RT-PCR analysis of mrna expression of CFTR in HBEC control ozone 10 Ìm Figure 3: Immunofluorescence of CFTR in HBEC. Bars, 10 µm control ozone CFTR actin 5

6 relative intensity 2 CFTR control ozone 4 western blot CFTR Figure 4: Expression CFTR protein in HBEC CFTR CFTR cl - 5 µm forskolincftr cl - forskolin BECs CFTR cl - (5A, B)cl - CFTR cl - glibenclamide CFTR cl - DIDS cl - CFTR cl - (5 A, C) A basal forskolin forskolin+ozone forskolin+glibenclamide forskolin+didsäúèýîþ Ä 6

7 B basal forskolin forskolin+ozone I(PA/PF) C forskolin forskolin+glibencla mide forskolin+dids I(PA/PF) 5 CFTR cl - Figure 5: CFTR current in HBEC were recorded were whole-cell patch clamp. A: Typical whole-cell currents recorded from HBEC in basal condition, in presence of 5 µm forskolin, forskolin+ozone, forskolin+glibenclamide or forskolin+dids. Step protocol consisted of 400ms voltage steps from -100 to +100 mv from a holding potential of -40 mv. B: current-voltage (I-V) curves (means ± SE) for CFTR current before, after application of forskolin and after forskolin+ozone treatment (n = 7, respectively). C: current-voltage (I-V) curves (means ± SE) for CFTR current after application of forskolin and after forskolin+glibenclamide or forskolin+dids treatment (n = 7, respectively). CF CFTR [6] CFTR Cl - CFTR camp Cl - Cl - Na + ATP CFTR CFTR airway surface liquid, ASL CFTR 7

8 CF AHR CFTR BECs Cl - CFTR [7-8] CFTR mrna CFTR mrna TNF- Á Ã- CFTR mrna CFTR mrna [9-10] mrna CFTR CFTR mrna CFTR CFTR CFTR Cl - CFTR CFTR CF CF CFTR [1] Mall M, Bleich M, Schurlein M, et al. Cholinergic ion secretion in human colon requires coactivation by camp[j]. Am J Physiol Gastrointestinal Liver Physiology, 38, G1274-G [2] Ballard S, Trout L, Bebok Z, et al. CFTR involvement in chloride, bicarbonate, and liquid secretion by airway submucosal glands[j]. Am J Physiol Lung Cell Mol Physiol, 277, L694-L [3] Dahl M, Tybjaerg-Hansen A, Lange P, et al. F508 heterozygosity in cystic fibrosis and susceptibility to asthma[j]. Lancet, 351, [4] Tzetis M, Efthymiadou A, Strofalis S, et al. CFTR gene mutations including three novel nucleotide substitutions and haplotype background in patients with asthma, disseminated brochiectasis and chronic obstructive pulmonary disease[j]. Hum Genet, 108, [5] Taouil K, Hinnrasky J, Hologne C, et al. Stimulation of beta 2-Adrenergic Receptor Increases Cystic Fibrosis Transmembrane Conductance Regulator Expression in Human Airway Epithelial Cells through a camp/protein Kinase A-independent Pathway[J]. J Biol Chem, 278, [6] Widdicombe J. Regulation of the depth and composition of airway surface liquid[j]. J Anat, 201, [7] Cowley E & Linsdell P. Oxidant stress stimulates anion secretion from the human airway epithelial cell line Calu-3: implications for cystic fibrosis lung disease[j]. J Physiol, 543, [8] Jung J, Lee JY, Oh SO, et al. Effect of t-butylhydroperoxide on chloride secretion in rat tracheal epithelia[j]. Pharmacol Toxicol, 82, [9] Besancon F, Przewlocki G, Baro I, Hongre AS, Escande D, Edelman A. Interferon- Ã 8

9 downregulates CFTR gene expression in epithelial cells[j]. Am J Physiol Cell Physiol, 267, C1398-C [10] Nakamura H, Yoshimura K, Bajocchi G, et al. Tumor necrosis factor modulation of expression of the cystic fibrosis transmembrane conductance regulator gene[j]. FEBS Lett, 314, Ozone Stress Down-regulates the Gating Function of Cystic Fibrosis Transmembrane Conductance Regulator in Human Bronchial Epithelial Cells QU Fei, QIN Xiaoqun *, XIANG Yang, TAN Yurong, LIU Huijun Department of Physiology, Central South University Xiangya Medical School, Changsha, Abstract To investigate abnormalities of cystic fibrosis transmembrane conductance regulator (CFTR) expression in chronic inflammatory airway diseases, the present study was designed to observe the expression of CFTR, CFTR chloride current in in vitro and in vivo bronchial epithelium by using real-time PCR, immunofluorescence, western blot and whole cell patch-clamp. The results demonstrated that CFTR staining was decreased in rat airway epithelium under ozone stress. Ozone stress also down-regulated CFTR protein and mrna expression and CFTR chloride current in cultured human bronchial epithelial cells (HBEC). These negative effects on CFTR function could potentially contribute to CF-like symptoms in a variety of inflammatory airway diseases. Our results provide support for studies investigating CFTR function in inflammatory lung diseases other than cystic fibrosis. Key words: cystic fibrosis transmembrane conductance regulator; human bronchial epithelial cells; ozone stress; airway hyperresponsiveness 9