Plasma cells and interleukin-4 in chronic bronchitis and COPD. Jie Zhu, Yu Sheng Qiu, Monica Valobra, Shengyang Qiu, Swati Majumdar, Dean
|
|
- Arleen Waters
- 5 years ago
- Views:
Transcription
1 Plasma cells and interleukin-4 in chronic bronchitis and COPD Jie Zhu, Yu Sheng Qiu, Monica Valobra, Shengyang Qiu, Swati Majumdar, Dean Matin, Virginia De Rose and Peter K. Jeffery Online Data Supplement 43
2 On Line Repository for Methods Subjects: Each patient had <10% reversibility or < 200 ml increase of FEV1 in response to inhaled β 2 -agonist. Atopic patients or patients with a history of wheezing, asthma, allergic rhinitis or any allergic disease were excluded from the study. None had received antibiotics or inhaled or oral corticosteroids within the preceding month. Tissue processing The tissues were obtained in collaboration with the departments of Respiratory Diseases at University of Turin (Italy) and Ghent University Hospital (Belgium). Only grossly normal lobar and segmental bronchi (i.e. airways with mucus-secreting glands and supportive cartilage plates). The airways selected were well away from circumscribed tumor and not blocked by tumor. The tissues were freshly fixed in 10% buffered formaldehyde, processed to paraffin wax, sectioned 5µm thick and stained with haematoxylin-eosin (H.E) in order to visualize morphology first before conducting counts of the inflammatory cells. Histochemistry staining for plasma cells Modified Unna-Pappenheim methyl green-pyronin stain was used. The procedures described in Carleton s Histological Technique were closely followed (E1). Briefly, the sections were deparaffinized, rehydrated to distilled water and were stained in methyl green pyronin solution. The slides were rinsed in differentiating solution and then quick-rinse in CNP30. The sections were mounted with DPX. Using the technique, the cytoplasm of plasma cells was stained pinkish red. Immunohistochemistry 44
3 The alkaline phosphatase anti-alkaline phosphatase (APAAP) was used to label CD45+ inflammatory cells, mast cells and IL-4 protein using anti-human CD45, leucocyte commom antigen mab (DAKO M0701), anti-human tryptase mab (DAKO M7052) and anti-human IL-4 monoclonal antibody (Chemicon International, Inc, Temecula, CA MAB1029), respectively, as previously described (E2). The sections were counterstained with Harris s haematoxylin mounted in Aqua per mounting medium. The avidin-biotinylated peroxidase complex (ABC) technique was used to identify plasma cells, CD4+, and CD8+ lymphocytes as previously described but with minor modification (E3). Briefly, following protein K (for plasma cells) and microwave (for CD8 cells) antigen retrieval, the sections were incubated with 0.3% hydrogen peroxide (H 2 O 2 ) in distilled water and then immunostained for 60 minutes with appropriately diluted (1 in 50 in PBS) mouse anti-human monoclonal antibodies (mab) to CD4 antigen (Novocastra NCL-CD4-1F6), CD8 antigen (DAKO Cambridge, UK M7103), CD20 antigen (Novocastra NCL-CD20-L26) and plasma cell specific antigens (Novocastra Newcastle, UK NCL-PC). Sections were washed and incubated for a further 30 minutes with biotinylated rabbit anti-mouse immunoglobulins (DAKO Cambridge, E0464) diluted 1 in 300. Sections were then washed and incubated for 50 minutes with avidin complexed with biotinylated peroxidase (DAKO K0355). After a further wash, bound peroxidase was detected as a dark brown product following 10 minutes incubation with 0.03% H 2 O 2 and 0.5 mg/ml diaminobenzidine (DAB). The sections were counterstained with Harris s haematoxylin to provide morphological detail, then mounted in DPX. 45
4 We used an irrelevant antibody, mouse IgG1, Kappa (MOPC21 Sigma, Dorset, UK M7894), as a replacement for the primary mab as the negative control procedure for both APAAP and ABC methods. Preparation of crna probes Digoxigenin (Dig)-labelled antisense and sense complementary ribonucleic acid (crna) probes were generated from complementary deoxyribonucleic acid (cdna) according to a published method, which has been described previously (E2, E3). The sizes (base pairs), vectors and sources of the cdna probes were as follows: IL-4 (318bp; PGEM-1), IL-5 (412bp; PGEM-IV; both from Glaxo Wellcome Biomedical Research, Geneva, Switzerland) and TNF-α (500bp; PGEM-3Z; R & D Systems Europe Ltd, Oxon UK). Immunohistochemistry/non-isotopic in situ hybridization double-staining: The EnVision TM +horseradish peroxidase (HRP) kit (Dako K4006) was first applied for the labelling of plasma cells, mast cells and CD4+ cells following the kits suppler's instruction. HRP was detected using diaminobenzidine (DAB). Positive was shown a golden brown pigment. Non-isotopic in situ hybridization was then carried out as the protocol described previously (E3) to detect cytoplasmic mrna for IL-4, IL-5 and TNF-α. Detection was carried out by addition of 5-bromo-4- chloro-3-indolyl phosphate/nitroblue tetrazolium (NBT/BCIP) substrate (Roche Diagnostics Limited, Sussex, UK). The positive signals were showed as dark blue. The slides were counterstained with nuclear fast red, then mounted in Aqua perm mounting medium. 46
5 Immunofluorescence double staining The sections were deparaffinized, rehydrated. Following protein K (for plasma cells) and microwave (for CD20 and CD68 cells) antigen retrieval, and washed in PBS then incubated with 10% normal rabbit serum for plasma cells in PBS for 10 min. In the first sequence the sections incubated with first primary mab to plasma cell specific antigens, CD20 (Novocastra) and CD68 (Dako M0876) antigens for 1 hour and then incubated tetramethylrhodamine isothiocyanate isomer R (TRITC) conjugated rabbit anti-mouse IgG (Dako R0270) for plasma cells mab and fluorescein isothiocyanate isomer (FITC) conjugated rabbit anti-mouse F(ab ) 2 (Dako F0313) for anti-cd20 or -CD68 mabs for 1 hour, respectively. After the first indirect labelling, free binding sites of the first primary mab were saturated by incubation for 30 min with unconjugated rabbit anti-mouse immunoglobulin (Dako Z0259) to block false binding of the secondary antibody to the first primary mab in the next sequence. The sections were then incubated with 15% normal mouse serum for 20 min to saturate any open antigen-binding site on the conjugated secondary antibody, so that binding of the second primary mab in the next sequence were prevented. The secondary indirect staining were performed using anti-il-4 mab (Genzyme Cambridge UK ) and anti-plasma cell specific antigen mab for 1.5 hour and then FITC or TRITC conjugated rabbit anti-mouse F(ab ) 2 or IgG for 1 hour. Single staining was carried out as a control procedure, using an irrelevant antibody, mouse IgG1, Kappa (MOPC21 Sigma, Dorset, UK M7894) instead of first or second primary layer followed by both secondary antibodies. Replacing both first and secondary primary antibodies with the irrelevant antibody and continuation with both secondary antibodies was 47
6 performed as a negative control. Immune-complexed sections were counterstained with DAPI and mounted with aqueous mounting media. Images were acquired using a Leica TCS-SP confocal microscope with lasers giving excitation wavelengths of nm, 488 nm, 568 nm (Leica Microsystems UK Ltd, Milton Keynes, UK). Quantification, variability, data presentation and statistics: Areas of epithelium, interstitial areas in the subepithelium (a zone between the external edge of the reticular basement membrane and inner aspect of bronchial muscle), areas of submucosal mucus-secreting gland (a line was drawn around areas of gland including inter-acinar interstitium, secretory acini and ducts), and remainder of the airway wall (excluding cartilage) of each entire section were assessed using Apple Macintosh computer Image 1.5 software (Apple Mac, Cupertino,CA, USA). Plasma cells, tryptase, CD4 and CD45 immuno-positive cells and double IHC/ISH stained cells were counted using a Leitz Dialux 20 light microscope (Leitz Wetzlar, West Germany) at 200 magnification using an eyepiece graticule divided into 100 squares in order to ensure no overlap of fields of view. A similar eyepiece graticule was used at 400 magnification to point count and assess the percentage of epithelium containing AB-PAS positive mucosubstances (E4). The points overlying Alcian blue-pas positive cytoplasm areas of surface, submucosal gland acinar and glandular duct epithelial cells were counted as positive, points overlying the unstained areas counted as negative. Points overlying nuclei of the epithelial cells were excluded. The entire cross section of lobar or segmental bronchial ring was assessed for each subject. There were no significant differences in the bronchial diameter (calculated from measures of luminal 48
7 perimeter) between the three smoker groups (mean±sem: AS = 4.24±0.58, CB = 3.98±0.48, CB+AO = 4.25±0.49). Slides were coded to avoid observer bias. To test the consistency of quantification and the inherent variation of repeated counts, one section was selected and counted five times over the period of the entire study. The sections, which had been hybridized with the sense (negative) probe, were examined first in order to detect and be aware of only background signal. The coefficient of variation (CV = SD/mean 100) was used to express the error of repeat counts in a single section of a patient with CB. The errors for repeat counts for the numbers of plasma cells in the subepithelium and submucosal glands by one observer (JZ) were 4.6% and 5.3% respectively. The errors for repeat point counts for the percentage of positive surface and glandular epithelium for Alcian blue-pas staining were 6.2% and 6.9%, respectively. The data for single staining of plasma cells, mast cells, CD4+ and CD45+ cells, are expressed as number of positive cells per mm 2 of: (i) epithelium (ii) subepithelial zone, (iii) gland or (iv) bronchial smooth muscle and (v) remainder of airway wall. The counts of IL-4 and IL-5 mrna+ cells are expressed as number of positive cells per mm 2 tissue for three zones of the airway wall: (i) the subepithelium (ii) that area of the section containing mucus-secreting gland acini or ducts and (iii) the remainder of airway wall. Data for double staining for plasma or mast or CD4+ cells /IL-4 mrna, plasma or mast or CD4+ cells /IL-5 mrna and mast cells/tnf-α mrna are expressed as percentage of double stained cells of the total number of positive cells stained for plasma, mast and CD4+ cells, respectively, or each of cytokines in the 49
8 subepithelial zone and interstitium between mucus-secreting gland acini or surrounding gland ducts. 50
9 Reference List E1. Drury RAB and Wallington EA. Chapter 7, General staining procedures, p Carleton's Histological Techniques. Oxford New York Toronto: Oxford University Press; 1980, p E2. Zhu J, Kilty I, Granger H, Gamble E, Qiu YS, Hattotuwa K, Elston W, Liu WL, Oliva A, Pauwels RA, Kips JC, De Rose V, Barnes N, Yeadon M, Jenkinson S, Jeffery PK. Gene expression and immuno-localization of 15-lipooxygenase isozymes in the airway mucosa of smokers with chronic bronchitis. Am J Resp Cell Mol Biol. 2002; 27: E3. Zhu J, Majumdar S, Qiu YS, Ansari T, Oliva A, Kips JC, Pauwels RA, De Rose V, and Jeffery PK: IL-4 and IL-5 gene expression and inflammation in the mucus-secreting glands and subepithelial tissue of smokers with chronic bronchitis: lack of relationship with CD8+ cells. Am J Resp Crit Care Med. 2001; 164: E4. Aherne WA, Dunnill MS. Point counting and morphometry, In: Aherne WA, Dunnill MS, editors. Morphometery. London: Arnold E;1982. p
10 E Figure legends Figures E1A-F Double immunofluorescence staining to identify co-localization of CD20+ B-lymphocytes or CD68+ monocytes/macrophages and IL-4 protein in the submucosal compartment of bronchi from a patient with CB: immunopositive A) CD 20+ and D) CD68+ cells are illustrated with green FITC fluorescence alone. B,E) IL-4 protein positivity stained by anti-human IL-4 antibody is shown by Texas red fluorescence alone. Cells showing co-expression of either C) CD20+ cells or F) CD68+ cells with IL-4 protein are fluorescing yellow (I,e, a mixture of the two colors). Nuclei are counter stained blue with DAPI (internal scale bars = 20 µm). Figure E2. Double immunofluorescence stain confirming that mouse anti-human monoclonal antibodies to plasma cell specific antigens do not cross react with CD20+ B-lymphocytes in the submucosal compartment of bronchi from a patient with CB: plasma cells are illustrated with Texas red (arrows) and CD20+ B-lymphocytes shown by green FITC fluorescence (arrow heads). No yellow fluorescent double-labelled cells can be seen. Nuclei are counter stained blue with DAPI (internal scale bar = 10 µm). Figure E3A & B. Alcian blue-periodic Acid Schiff staining with diastase digestion to indentify acidic and neutral mucopolysaccharides stained blue or purple red, respectively in A) surface and B) glandular epithelium of bronchi from a patient with CB (internal scale bar = 20 µm). 52
11 Table E1 Characteristics of subjects with chronic bronchitis and chronic obstructive pulmonary disease Subjects No. Sex (M/F) Age (Yr) Smoking (Pack/yr) FVC ( %) FEV1 (%) FEV1/FVC (%) AS 1 M M M M M M M M M M M Mean SEM CB 12 M M M M M M M M M M M 80 Ex-smoker Mean SEM CB+COPD 23 M M M M M M M M M M Mean SEM * 3.5 Definition of abbreviations: AS = asymptomatic smokers; CB = chronic bronchitis; COPD = chronic obstructive pulmonary disease; SEM = standard error of mean. *P < compared to AS and CB groups, respectively, (unpaired Student s t test). 60.5*
12 Table E2 Median (range) of inflammatory cells in epithelium, subepithelium, glands and muscles: a comparison within or between tissue compartments Cell AS CB CB + AO type Ep S-Ep Gland Muscle Ep S-Ep Gland Muscle Ep S-Ep Gland Muscle Plasma cells 0 (0-0) 38 (4-107) 41 (10-136) 0 (0-0) 0 (0-0) 110 (44-235) 213 (76-313) 0 (0-0) 0 (0-0) 55 (20-177) 118 (18-224) 0 (0-0) Mast cells CD4+ cells 21 (0-39) 9 (0-47) 65 (39-247) 77* (12-118) 35 (15-97) 38* (23-91) 47 װ (29-86) 6 (0-51) 19 (0-124) 12 (0-58) 204 (61-348) 63* (29-137) 34 (21-64) 46* (17-95) 50 װ (30-140) 8 (0-24) 26 (0-95) 9 (0-76) 115 (43-259) 87* (35-191) 34 (19-78) 62* (20-88) 33 װ (0-57) 10 (2-21) CD8+ cells 123 (30-312) 75 (16-187) 41 (5-113) 2 (0-15) 130 (49-391) 99 (33-253) 36 (12-70) 3 (0-19) 109 (8-352) 109 (10-280) 31 (4-99) Abbreviations: Ep = epithelium; S-Ep = sub-epithelium. *P < 0.01 vs epithelial and muscle areas of AS, CB and CB+AO, respectively; P < vs mast cells, CD4+ cells and plasma cells in epithelial area of AS, CB and CB+AO, respectively; P< 0.01 vs plasma cells, CD4+ and CD8+ cells in subepithelial area of CB; P < 0.05 or 0.01 vs mast cells, CD4+ and CD8+ cells in gland area of CB and CB+AO, respectively. װ P< 0.01 vs plasma cells, CD4+ and CD8+ cells in muscle area in each of three groups. 5(0-27) 54
13 Table E3 Fold increases in the numbers of inflammatory cells in different compartments of the large airways of CB: a comparison with AS subjects and those with CB+AO Cell type Comparison with AS Comparison with CB+COPD Ep Sub- Ep Gland Ep Sub-Ep Gland CD45+ cells Plasma cells Mast cells CD4+ cells CD8+ cells Abbreviations: Ep = Epithelium, AS = Asymptomatic smoker, CB = Chronic bronchitis, AO= airflow obstruction 55
14 Figures E1A-F 56
15 Figure E2 57
16 Figure E3A&B 58
Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
More informationPepsin Solution ready-to-use
SIE HABEN DIE VISION, WIR HABEN DIE SUBSTANZ. Pepsin Solution Single component Pepsin Solution: only one component refrigerator stable Pepsin is a commonly used digestive enzyme for immunohistochemical
More informationCells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2],
Supplementary information Methods Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2], and A/Hong Kong/213/03 [H5N1]) were grown in Madin-Darby canine kidney (MDCK) cells
More informationSUPPLEMENTARY MATERIAL. Sample preparation for light microscopy
SUPPLEMENTARY MATERIAL Sample preparation for light microscopy To characterize the granulocytes and melanomacrophage centers, cross sections were prepared for light microscopy, as described in Material
More informationJIE ZHU, SWATI MAJUMDAR, YUSHENG QIU, TAREQ ANSARI, ALESSANDRO OLIVA, JOHAN C. KIPS, ROMAIN A. PAUWELS, VIRGINIA DE ROSE, and PETER K.
Interleukin-4 and Interleukin-5 Gene Expression and Inflammation in the Mucus-secreting Glands and Subepithelial Tissue of Smokers with Chronic Bronchitis Lack of Relationship with CD8 Cells JIE ZHU, SWATI
More informationHRP cytochemistry. Division of Radiooncology, Deutsches Krebsforschungszentrum, Heidelberg, Germany
HRP cytochemistry WOLF D. KUHLMANN, M.D. Division of Radiooncology, Deutsches Krebsforschungszentrum, 69120 Heidelberg, Germany A range of substrates is available for the cytochemical staining of peroxidase
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationGrass pollen immunotherapy induces Foxp3 expressing CD4 + CD25 + cells. in the nasal mucosa. Suzana Radulovic MD, Mikila R Jacobson PhD,
Radulovic 1 1 2 3 Grass pollen immunotherapy induces Foxp3 expressing CD4 + CD25 + cells in the nasal mucosa 4 5 6 7 Suzana Radulovic MD, Mikila R Jacobson PhD, Stephen R Durham MD, Kayhan T Nouri-Aria
More informationof chronic obstructive pulmonary disease
Eur Respir J 006; 7: 9 99 DOI: 0.8/09096.06.0007705 CopyrightßERS Journals Ltd 006 Variability of bronchial inflammation in chronic obstructive pulmonary disease: implications for study design E. Gamble*,"",
More informationFixation... Questions 1 Answers 16. Processing... Questions 25 Answers 36. Safety... Questions 67 Answers 73
Table of Contents Fixation... Questions 1 Answers 16 Processing... Questions 25 Answers 36 Instrumentation... Questions 43 Answers 58 Safety... Questions 67 Answers 73 Laboratory Mathematics & Solution
More informationCysteinyl Leukotriene 1 Receptor Expression Associated With Bronchial Inflammation in Severe Exacerbations of COPD
CHEST Cysteinyl Leukotriene Receptor Expression Associated With Bronchial Inflammation in Severe Exacerbations of COPD Jie Zhu, MD, PhD ; Venkata Bandi, MD, FCCP ; Shengyang Qiu, MD ; David J. Figueroa,
More informationLIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:!
LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:! Spinal cord and peripheral nerves! Eyes, Inner ear, nasal
More informationDownregulation of angiotensin type 1 receptor and nuclear factor-κb. by sirtuin 1 contributes to renoprotection in unilateral ureteral
Supplementary Information Downregulation of angiotensin type 1 receptor and nuclear factor-κb by sirtuin 1 contributes to renoprotection in unilateral ureteral obstruction Shao-Yu Yang 1,2, Shuei-Liong
More informationCOPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic
COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate
More informationSupplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
More informationSupplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny
More informationEpithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive
Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,
More informationSystems Pharmacology Respiratory Pharmacology. Lecture series : General outline
Systems Pharmacology 3320 2017 Respiratory Pharmacology Associate Professor Peter Henry (Rm 1.34) Peter.Henry@uwa.edu.au Division of Pharmacology, School of Biomedical Sciences Lecture series : General
More informationcolorimetric sandwich ELISA kit datasheet
colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL5 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity
More information3 CHAPTER 3: RESULTS
3 CHAPTER 3: RESULTS 3.1 Histopathology 3.1.1 Normal Squamous Epithelium The squamous epithelium that covers the ectocervix of the uterus is composed of different layers starting at the basement membrane
More informationCD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer
CD14 + S1A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer Po-Hao, Feng M.D., Kang-Yun, Lee, M.D. Ph.D., Ya-Ling Chang, Yao-Fei Chan, Lu- Wei, Kuo,Ting-Yu
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: van Seters M, van Beurden M, ten Kate FJW, et al. Treatment
More informationVariation in the measurements of basement membrane thickness and inflammatory cell number in bronchial biopsies
Eur Respir J 1998; 12: 811 815 DOI: 10.1183/09031936.98.12040811 Printed in UK - all rights reserved Copyright ERS Journals Ltd 1998 European Respiratory Journal ISSN 0903-1936 Variation in the measurements
More informationIKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung
IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung Se-Ran Yang, Samantha Valvo, Hongwei Yao, Aruna Kode, Saravanan Rajendrasozhan, Indika Edirisinghe, Samuel
More informationHistopathology: pulmonary pathology
Histopathology: pulmonary pathology These presentations are to help you identify basic histopathological features. They do not contain the additional factual information that you need to learn about these
More informationInt J Clin Exp Pathol 2017;10(3): /ISSN: /IJCEP
Int J Clin Exp Pathol 2017;10(3):3671-3676 www.ijcep.com /ISSN:1936-2625/IJCEP0046381 Original Article Comparison of immunofluorescence and immunohistochemical staining with anti-insulin antibodies on
More informationImpact of Asthma in the U.S. per Year. Asthma Epidemiology and Pathophysiology. Risk Factors for Asthma. Childhood Asthma Costs of Asthma
American Association for Respiratory Care Asthma Educator Certification Prep Course Asthma Epidemiology and Pathophysiology Robert C. Cohn, MD, FAARC MetroHealth Medical Center Cleveland, OH Impact of
More informationAtlas of Stains. Special Stains on Artisan Link Pro
Atlas of Stains Special Stains on Artisan Link Pro Intended use Routinely processed samples (paraffin-embedded) may be used. The preferred fixative is neutral buffered formalin. The clinical interpretation
More informationHER2 FISH pharmdx TM Interpretation Guide - Breast Cancer
P A T H O L O G Y HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer For In Vitro Diagnostic Use FDA approved as an aid in the assessment of patients for whom Herceptin TM (trastuzumab) treatment
More informationSupplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent
Supplementary Information Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent Authors: Susanne Kossatz a, Christian Brand a, Stanley Gutiontov b, Jonathan T.C. Liu c, Nancy
More informationEstrogen receptor (ER)
Assessment Run B7 204 Estrogen receptor (ER) Material The slide to be stained for ER comprised: No. Tissue ER-positivity* ER-intensity*. Uterine cervix 80-90% Moderate to strong 2. Breast carcinoma 0%
More informationChemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic
Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Reticulum Stress Lokesh Makhija, BE, Veda Krishnan, MSc, Rakhshinda Rehman, MTech, Samarpana Chakraborty, MSc, Shuvadeep Maity,
More informationSpecial Staining (I)
Special Staining (I) Carbohydrates 1- PERIODIC ACID SCHIFF'S (PAS ) Purpose: Glycogen is present in liver, kidney, skeletal and cardiac muscle. The PAS stain is used to demonstrate neutral polysaccharides
More informationHow does COPD really work?
How does COPD really work? by Alex Goodell View online Where does COPD fit in the mix of respiratory diseases? I ve made a map of the major pathologies outlined in Robbins and First Aid (obviously these
More informationRESPIRATORY BLOCK. Bronchial Asthma. Dr. Maha Arafah Department of Pathology KSU
RESPIRATORY BLOCK Bronchial Asthma Dr. Maha Arafah Department of Pathology KSU marafah@ksu.edu.sa Jan 2018 Objectives Define asthma (BA) Know the two types of asthma 1. Extrinsic or atopic allergic 2.
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationCell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-
Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationSupplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
More informationKEYWORDS: Chronic obstructive pulmonary disease, inflammation, smoking, smoking cessation
Eur Respir J 2007; 30: 467 471 DOI: 10.1183/09031936.00013006 CopyrightßERS Journals Ltd 2007 Airway mucosal inflammation in COPD is similar in smokers and ex-smokers: a pooled analysis E. Gamble*,#, D.C.
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationT obacco smoking is one of the major causes of chronic
303 CHRONIC OBSTRUCTIVE PULMONARY DISEASE Inflammatory features of nasal mucosa in smokers with and without COPD I Vachier, A M Vignola, G Chiappara, A Bruno, H Meziane, P Godard, J Bousquet, P Chanez...
More informationSupplemental Data. Wnt/β-Catenin Signaling in Mesenchymal Progenitors. Controls Osteoblast and Chondrocyte
Supplemental Data Wnt/β-Catenin Signaling in Mesenchymal Progenitors Controls Osteoblast and Chondrocyte Differentiation during Vertebrate Skeletogenesis Timothy F. Day, Xizhi Guo, Lisa Garrett-Beal, and
More informationIncreased number and altered phenotype of lymphatic vessels in peripheral lung compartments of patients with COPD
Increased number and altered phenotype of lymphatic vessels in peripheral lung compartments of patients with COPD Mori et al. Mori et al. Respiratory Research 2013, 14:65 Mori et al. Respiratory Research
More informationEvaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
More informationHuman Saliva as a Convenient Source of Ribonuclease. By S. BRADBURY
Human Saliva as a Convenient Source of Ribonuclease 323 By S. BRADBURY (From the Cytological Laboratory, Department of Zoology, University Museum, Oxford) SUMMARY Saliva, heated to 80 C for 10 minutes
More informationSupplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
More informationIT S ABOUT TIME. IQFISH pharmdx Interpretation Guide THREEHOURSTHIRTYMINUTES. HER2 IQFISH pharmdxtm. TOP2A IQFISH pharmdxtm
I N T E R P R E TAT I O N IQFISH pharmdx Interpretation Guide TM HER2 IQFISH pharmdxtm TOP2A IQFISH pharmdxtm Breast carcinoma (FFPE) stained with HER2 IQFISH pharmdx Breast carcinoma (FFPE) stained with
More informationNeutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury
Neutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury Bastian OW, Koenderman L, Alblas J, Leenen LPH, Blokhuis TJ. Neutrophils contribute to
More informationSuperior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)
Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor
More informationDr Rodney Itaki Lecturer Division of Pathology Anatomical Pathology Discipline
Pathology of Asthma Dr Rodney Itaki Lecturer Division of Pathology Anatomical Pathology Discipline Bronchial Asthma Definition: chronic, relapsing inflammatory lung disorder characterised by reversible
More informationMucin Histochemistry Study of the Prostate in Normal and Malignant Lesions
ISSN 2231-4261 ORIGINAL ARTICLE Mucin Histochemistry Study of the Prostate in Normal and Malignant Lesions 1* 1 1 1 Manoj P.Ambali, Megha A. Doshi, Pratibha P. Patil, Shweta H. Chavan 1 Department of Anatomy,
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationFluorescence Microscopy
Fluorescence Microscopy Imaging Organelles Mitochondria Lysosomes Nuclei Endoplasmic Reticulum Plasma Membrane F-Actin AAT Bioquest Introduction: Organelle-Selective Stains Organelles are tiny, specialized
More informationDako IT S ABOUT TIME. Interpretation Guide. Agilent Pathology Solutions. ALK, ROS1 and RET IQFISH probes (Dako Omnis) MET IQFISH probe (Dako Omnis)
INTERPRETATION Dako Agilent Pathology Solutions IQFISH Interpretation Guide ALK, ROS1 and RET IQFISH probes (Dako Omnis) MET IQFISH probe (Dako Omnis) IT S ABOUT TIME For In Vitro Diagnostic Use ALK, ROS1,
More information2010 Health Press Ltd.
Fast Facts Fast Facts: Asthma Third edition Stephen T Holgate MD DSc FRCP FMedSci MRC Clinical Professor of Immunopharmacology School of Medicine Southampton General Hospital Southampton, UK Jo Douglass
More informationSHORT COMMUNICATION. Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points
VIROLOGY 214, 259 263 (1995) SHORT COMMUNICATION Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points DARRON R. BROWN,*,,1 JANINE T. BRYAN,
More informationCOPD and Asthma: Similarities and differences Prof. Peter Barnes
and Asthma: Similarities and Differences and Asthma: 1 Imperial College Peter Barnes FRS, FMedSci, National Heart & Lung Institute Imperial College, London, UK p.j.barnes@imperial.ac.uk Royal Brompton
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More informationEstrogen receptor (ER)
Material The slide to be stained for ER comprised: Assessment Run B26 2018 Estrogen receptor (ER) No. Tissue ER-positivity* ER-intensity* 1. Uterine cervix 80-90% Moderate to strong 2. Tonsil 1-5% Weak
More informationGSI Canine IL-5 ELISA Kit-2 Plates DataSheet
Interleukin5 (IL5) is a secreted glycoprotein that belongs to the α-helical group of cytokines (1, 2, 3). Unlike other family members, it is present as a covalently linked antiparallel dimer (4, 5). IL-5
More informationExplain the laboratory diagnosis of Rabies?
Explain the laboratory diagnosis of Rabies? The standard test for rabies testing is dfa. This test has been thoroughly evaluated for more than 40 years, and is recognized as the most rapid and reliable
More informationProduct Introduction
Product Introduction Product Codes: HCL026, HCL027 and HCL028 Contents Introduction to HER2 2 HER2 immunohistochemistry 3 Cell lines as controls 5 HER2 Analyte Control DR IHC 7 HER2 Analyte Control DR
More informationLocalization and Upregulation of Cysteinyl Leukotriene-1 Receptor in Asthmatic Bronchial Mucosa
Localization and Upregulation of Cysteinyl Leukotriene-1 Receptor in Asthmatic Bronchial Mucosa Jie Zhu, Yu-Sheng Qiu, David J. Figueroa, Venkata Bandi, Helen Galczenski, Kaoru Hamada, Kalpalatha K. Guntupalli,
More informationRelationship of Small Airway Chymase-Positive Mast Cells and Lung Function in Severe. Asthma
Relationship of Small Airway Chymase-Positive Mast Cells and Lung Function in Severe Asthma Silvana Balzar, M.D., Hong Wei Chu, M.D., Matthew Strand, Ph.D, Sally Wenzel, M.D. Online Data Supplement METHODS
More informationCOPYRIGHTED MATERIAL. Definition and Pathology CHAPTER 1. John Rees
CHAPTER 1 Definition and Pathology John Rees Sherman Education Centre, Guy s Hospital, London, UK OVERVIEW Asthma is an overall descriptive term but there are a number of more or less distinct phenotypes
More informationMaterials and Methods
280 Fujisawa et al. 5. In order to ascertain the biological signifi cance of CD56 epithelial cells found in the duct system, we made an immunohistochemical study of fetal and normal adult pancreatic tissues
More informationThyroid Stimulating Hormone (S-TSH) Thyroid Stimulating
ab108659 Thyroid Stimulating Hormone (S-TSH) Human ELISA Kit Instructions for Use For the quantitative measurement of Human Thyroid Stimulating Hormone (S-TSH) concentrations in serum. This product is
More informationSupplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and
Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and Primary Children s Hospital, Salt Lake City, UT, both
More informationCHAPTER 4 IMMUNOLOGICAL TECHNIQUES
CHAPTER 4 IMMUNOLOGICAL TECHNIQUES Nitroblue Tetrazolium Chloride (NBT) Reduction test NBT reduction test was evaluated by employing the method described by Hudson and Hay,1989 based upon principle that
More informationAPPENDIX 1 ETHICAL CLEARANCE
APPENDIX 1 ETHICAL CLEARANCE 75 APPENDIX 2 76 PROCEDURE FOR PREPARING OF LIVER HISTOLOGY SLIDES Overview: Histology involves the use of a set of techniques to examine the morphology, architecture and composition
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationHER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer
P A T H O L O G Y HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer FROM CERTAINTY COMES TRUST For in vitro diagnostic use HER2 CISH pharmdx Kit HER2 CISH pharmdx Kit is intended for dual-color
More informationComparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3-
Supplemental Data Comparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3- GFP tumors in mice either injected with control or clodronate-containing liposomes and stained for macrophages using
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSingle and Multiplex Immunohistochemistry
Single and Multiplex Immunohistochemistry Steve Westra, BS Reagent Product Specialist Leica Biosystems IHC Theory Polyclonal vs Monoclonal Polyclonal reagents Detect a multitude of epitopes Batch to batch
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationSecondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan
Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationEvaluation of the diagnostic value of immunocytochemistry and in situ hybridization in the pediatric leprosy
Indian J Lepr 203, 85 : 93- Hind Kusht Nivaran Sangh, New Delhi http://www.ijl.org.in Original Article Evaluation of the diagnostic value of immunocytochemistry and in situ hybridization in the pediatric
More informationInterpretation guide. Abnormal cytology can t hide anymore
Interpretation guide Abnormal cytology can t hide anymore Unique dual-biomarker technology makes you certain about the presence of transforming HPV infection. The science that creates certainty. Table
More informationAlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director
AlphaScreen : A Straightforward and Powerful Alternative to ELISA Martina Bielefeld-Sévigny Ph.D., R&D Director Overview AlphaScreen - an alternative to ELISA Why an alternative to ELISA? Assay principle
More informationSupplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
More informationIHC Polymer. BioGenex Website. Presented for: Presented by: Date: BioGenex Tech Support 2016
IHC Polymer Presented for: Presented by: Date: BioGenex Website BioGenex Tech Support 2016 Immunohistochemistry (IHC) Quick Guide# Super SensitiveTM Polymer-HRP kits. Baking An-gen Retrieval DeWax Overnight,
More informationSupplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
More informationStudy of Melanin Bleaching After Immunohistochemistry of Melanin-containing Tissues. Hongwu Shen, MD and Wenqiao Wu, MD
TECHNICAL ARTICLE Study of Melanin Bleaching After Immunohistochemistry of Melanin-containing Tissues Hongwu Shen, MD and Wenqiao Wu, MD Abstract: Melanin may interfere with immunohistochemical staining.
More informationALAEZI CM 1 *, ADISA JO 2, OKOROCHI EC 3 and OKECHI OO 4
Global Journal of Scientific Researches Available online at gjsr.blue-ap.org 2014 GJSR Journal. Vol. 2(2), pp. 51-55, 28 February, 2014 E-ISSN: 2311-732X METHYL GREEN PYRONIN: A PROGRESSIVE NUCLEAR STAIN
More informationRobert Kruklitis, MD, PhD Chief, Pulmonary Medicine Lehigh Valley Health Network
Robert Kruklitis, MD, PhD Chief, Pulmonary Medicine Lehigh Valley Health Network Robert.kruklitis@lvh.com Correlation of a Asthma pathophyisology with basic science Asthma (Physiology) Bronchodilators
More informationEstrogen receptor (ER)
Material The slide to be stained for ER comprised: Assessment B25 208 Estrogen receptor (ER) No. Tissue ER-positivity* ER-intensity*. Uterine cervix 80-90% Moderate to strong 2. Tonsil < 2-5% Weak to strong
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationSialic acid and receptor expression on the respiratory tract in normal subjects and H5N1 and non-avian influenza patients
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Key Messages JM Nicholls 黎國思 JSM Peiris 裴偉士 Y Guan 管軼 1. Influenza virus binds to cell receptors via sialic acid (SA) linked glycoproteins. An accurate
More informationBronchial gland histochemistry in lungs removed for cancer
Thorax, 1980, 35, 546-551 Bronchial gland histochemistry in lungs removed for cancer W DE POITIERS, P W LORD, B BILES, AND W F WHIMSTER From the Department of Morbid Anatomy, King's College Hospital, and
More information*Corresponding author:
LIPID DROPLETS HYPERTROPHY: A CRUCIAL DETERMINING FACTOR IN INSULIN REGULATION BY ADIPOCYTES 1 Bahram Sanjabi #, 2,3 Monireh Dashty #, 4 Behiye. Özcan, 5 Vishtaseb Akbarkhanzadeh, 3 Mehran Rahimi, 7,8
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationMast cells in COPD airways: relationship to bronchodilator responsiveness and angiogenesis
Eur Respir J 212; 39: 1361 1367 DOI: 1.1183/931936.84411 CopyrightßERS 212 Mast cells in COPD airways: relationship to bronchodilator responsiveness and angiogenesis Amir Soltani, Yean Pin Ewe,+, Zhen
More informationBiodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery
Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing
More informationInterpretation Manual - Gastric or Gastroesophageal Junction Adenocarcinoma. PD-L1 IHC 22C3 pharmdx is FDA-approved for in vitro diagnostic use
Interpretation Manual - Gastric or Gastroesophageal Junction Adenocarcinoma PD-L1 IHC 22C3 pharmdx is FDA-approved for in vitro diagnostic use For countries outside of the United States, see the local
More informationThe Respiratory System. Dr. Ali Ebneshahidi
The Respiratory System Dr. Ali Ebneshahidi Functions of The Respiratory System To allow gases from the environment to enter the bronchial tree through inspiration by expanding the thoracic volume. To allow
More informationInternational Conference on Biomedical and Biological Engineering (BBE 2016)
International Conference on Biomedical and Biological Engineering (BBE 2016) Injury Mechanism of Sub-Micron Calcium Oxalate Monohydrate and Dihydrate Crystals on Renal Epithelial Cells Poonam BHADJA, Kai
More informationCitation Acta Medica Nagasakiensia. 1992, 37
NAOSITE: Nagasaki University's Ac Title Author(s) Immunohistochemical Study on Blood Antigens in Primary Breast Carcinom Tomita, Masao; Nakagoe, Toru; Kawah Tagawa, Yutaka Citation Acta Medica Nagasakiensia.
More information