Plasma cells and interleukin-4 in chronic bronchitis and COPD. Jie Zhu, Yu Sheng Qiu, Monica Valobra, Shengyang Qiu, Swati Majumdar, Dean

Size: px
Start display at page:

Download "Plasma cells and interleukin-4 in chronic bronchitis and COPD. Jie Zhu, Yu Sheng Qiu, Monica Valobra, Shengyang Qiu, Swati Majumdar, Dean"

Transcription

1 Plasma cells and interleukin-4 in chronic bronchitis and COPD Jie Zhu, Yu Sheng Qiu, Monica Valobra, Shengyang Qiu, Swati Majumdar, Dean Matin, Virginia De Rose and Peter K. Jeffery Online Data Supplement 43

2 On Line Repository for Methods Subjects: Each patient had <10% reversibility or < 200 ml increase of FEV1 in response to inhaled β 2 -agonist. Atopic patients or patients with a history of wheezing, asthma, allergic rhinitis or any allergic disease were excluded from the study. None had received antibiotics or inhaled or oral corticosteroids within the preceding month. Tissue processing The tissues were obtained in collaboration with the departments of Respiratory Diseases at University of Turin (Italy) and Ghent University Hospital (Belgium). Only grossly normal lobar and segmental bronchi (i.e. airways with mucus-secreting glands and supportive cartilage plates). The airways selected were well away from circumscribed tumor and not blocked by tumor. The tissues were freshly fixed in 10% buffered formaldehyde, processed to paraffin wax, sectioned 5µm thick and stained with haematoxylin-eosin (H.E) in order to visualize morphology first before conducting counts of the inflammatory cells. Histochemistry staining for plasma cells Modified Unna-Pappenheim methyl green-pyronin stain was used. The procedures described in Carleton s Histological Technique were closely followed (E1). Briefly, the sections were deparaffinized, rehydrated to distilled water and were stained in methyl green pyronin solution. The slides were rinsed in differentiating solution and then quick-rinse in CNP30. The sections were mounted with DPX. Using the technique, the cytoplasm of plasma cells was stained pinkish red. Immunohistochemistry 44

3 The alkaline phosphatase anti-alkaline phosphatase (APAAP) was used to label CD45+ inflammatory cells, mast cells and IL-4 protein using anti-human CD45, leucocyte commom antigen mab (DAKO M0701), anti-human tryptase mab (DAKO M7052) and anti-human IL-4 monoclonal antibody (Chemicon International, Inc, Temecula, CA MAB1029), respectively, as previously described (E2). The sections were counterstained with Harris s haematoxylin mounted in Aqua per mounting medium. The avidin-biotinylated peroxidase complex (ABC) technique was used to identify plasma cells, CD4+, and CD8+ lymphocytes as previously described but with minor modification (E3). Briefly, following protein K (for plasma cells) and microwave (for CD8 cells) antigen retrieval, the sections were incubated with 0.3% hydrogen peroxide (H 2 O 2 ) in distilled water and then immunostained for 60 minutes with appropriately diluted (1 in 50 in PBS) mouse anti-human monoclonal antibodies (mab) to CD4 antigen (Novocastra NCL-CD4-1F6), CD8 antigen (DAKO Cambridge, UK M7103), CD20 antigen (Novocastra NCL-CD20-L26) and plasma cell specific antigens (Novocastra Newcastle, UK NCL-PC). Sections were washed and incubated for a further 30 minutes with biotinylated rabbit anti-mouse immunoglobulins (DAKO Cambridge, E0464) diluted 1 in 300. Sections were then washed and incubated for 50 minutes with avidin complexed with biotinylated peroxidase (DAKO K0355). After a further wash, bound peroxidase was detected as a dark brown product following 10 minutes incubation with 0.03% H 2 O 2 and 0.5 mg/ml diaminobenzidine (DAB). The sections were counterstained with Harris s haematoxylin to provide morphological detail, then mounted in DPX. 45

4 We used an irrelevant antibody, mouse IgG1, Kappa (MOPC21 Sigma, Dorset, UK M7894), as a replacement for the primary mab as the negative control procedure for both APAAP and ABC methods. Preparation of crna probes Digoxigenin (Dig)-labelled antisense and sense complementary ribonucleic acid (crna) probes were generated from complementary deoxyribonucleic acid (cdna) according to a published method, which has been described previously (E2, E3). The sizes (base pairs), vectors and sources of the cdna probes were as follows: IL-4 (318bp; PGEM-1), IL-5 (412bp; PGEM-IV; both from Glaxo Wellcome Biomedical Research, Geneva, Switzerland) and TNF-α (500bp; PGEM-3Z; R & D Systems Europe Ltd, Oxon UK). Immunohistochemistry/non-isotopic in situ hybridization double-staining: The EnVision TM +horseradish peroxidase (HRP) kit (Dako K4006) was first applied for the labelling of plasma cells, mast cells and CD4+ cells following the kits suppler's instruction. HRP was detected using diaminobenzidine (DAB). Positive was shown a golden brown pigment. Non-isotopic in situ hybridization was then carried out as the protocol described previously (E3) to detect cytoplasmic mrna for IL-4, IL-5 and TNF-α. Detection was carried out by addition of 5-bromo-4- chloro-3-indolyl phosphate/nitroblue tetrazolium (NBT/BCIP) substrate (Roche Diagnostics Limited, Sussex, UK). The positive signals were showed as dark blue. The slides were counterstained with nuclear fast red, then mounted in Aqua perm mounting medium. 46

5 Immunofluorescence double staining The sections were deparaffinized, rehydrated. Following protein K (for plasma cells) and microwave (for CD20 and CD68 cells) antigen retrieval, and washed in PBS then incubated with 10% normal rabbit serum for plasma cells in PBS for 10 min. In the first sequence the sections incubated with first primary mab to plasma cell specific antigens, CD20 (Novocastra) and CD68 (Dako M0876) antigens for 1 hour and then incubated tetramethylrhodamine isothiocyanate isomer R (TRITC) conjugated rabbit anti-mouse IgG (Dako R0270) for plasma cells mab and fluorescein isothiocyanate isomer (FITC) conjugated rabbit anti-mouse F(ab ) 2 (Dako F0313) for anti-cd20 or -CD68 mabs for 1 hour, respectively. After the first indirect labelling, free binding sites of the first primary mab were saturated by incubation for 30 min with unconjugated rabbit anti-mouse immunoglobulin (Dako Z0259) to block false binding of the secondary antibody to the first primary mab in the next sequence. The sections were then incubated with 15% normal mouse serum for 20 min to saturate any open antigen-binding site on the conjugated secondary antibody, so that binding of the second primary mab in the next sequence were prevented. The secondary indirect staining were performed using anti-il-4 mab (Genzyme Cambridge UK ) and anti-plasma cell specific antigen mab for 1.5 hour and then FITC or TRITC conjugated rabbit anti-mouse F(ab ) 2 or IgG for 1 hour. Single staining was carried out as a control procedure, using an irrelevant antibody, mouse IgG1, Kappa (MOPC21 Sigma, Dorset, UK M7894) instead of first or second primary layer followed by both secondary antibodies. Replacing both first and secondary primary antibodies with the irrelevant antibody and continuation with both secondary antibodies was 47

6 performed as a negative control. Immune-complexed sections were counterstained with DAPI and mounted with aqueous mounting media. Images were acquired using a Leica TCS-SP confocal microscope with lasers giving excitation wavelengths of nm, 488 nm, 568 nm (Leica Microsystems UK Ltd, Milton Keynes, UK). Quantification, variability, data presentation and statistics: Areas of epithelium, interstitial areas in the subepithelium (a zone between the external edge of the reticular basement membrane and inner aspect of bronchial muscle), areas of submucosal mucus-secreting gland (a line was drawn around areas of gland including inter-acinar interstitium, secretory acini and ducts), and remainder of the airway wall (excluding cartilage) of each entire section were assessed using Apple Macintosh computer Image 1.5 software (Apple Mac, Cupertino,CA, USA). Plasma cells, tryptase, CD4 and CD45 immuno-positive cells and double IHC/ISH stained cells were counted using a Leitz Dialux 20 light microscope (Leitz Wetzlar, West Germany) at 200 magnification using an eyepiece graticule divided into 100 squares in order to ensure no overlap of fields of view. A similar eyepiece graticule was used at 400 magnification to point count and assess the percentage of epithelium containing AB-PAS positive mucosubstances (E4). The points overlying Alcian blue-pas positive cytoplasm areas of surface, submucosal gland acinar and glandular duct epithelial cells were counted as positive, points overlying the unstained areas counted as negative. Points overlying nuclei of the epithelial cells were excluded. The entire cross section of lobar or segmental bronchial ring was assessed for each subject. There were no significant differences in the bronchial diameter (calculated from measures of luminal 48

7 perimeter) between the three smoker groups (mean±sem: AS = 4.24±0.58, CB = 3.98±0.48, CB+AO = 4.25±0.49). Slides were coded to avoid observer bias. To test the consistency of quantification and the inherent variation of repeated counts, one section was selected and counted five times over the period of the entire study. The sections, which had been hybridized with the sense (negative) probe, were examined first in order to detect and be aware of only background signal. The coefficient of variation (CV = SD/mean 100) was used to express the error of repeat counts in a single section of a patient with CB. The errors for repeat counts for the numbers of plasma cells in the subepithelium and submucosal glands by one observer (JZ) were 4.6% and 5.3% respectively. The errors for repeat point counts for the percentage of positive surface and glandular epithelium for Alcian blue-pas staining were 6.2% and 6.9%, respectively. The data for single staining of plasma cells, mast cells, CD4+ and CD45+ cells, are expressed as number of positive cells per mm 2 of: (i) epithelium (ii) subepithelial zone, (iii) gland or (iv) bronchial smooth muscle and (v) remainder of airway wall. The counts of IL-4 and IL-5 mrna+ cells are expressed as number of positive cells per mm 2 tissue for three zones of the airway wall: (i) the subepithelium (ii) that area of the section containing mucus-secreting gland acini or ducts and (iii) the remainder of airway wall. Data for double staining for plasma or mast or CD4+ cells /IL-4 mrna, plasma or mast or CD4+ cells /IL-5 mrna and mast cells/tnf-α mrna are expressed as percentage of double stained cells of the total number of positive cells stained for plasma, mast and CD4+ cells, respectively, or each of cytokines in the 49

8 subepithelial zone and interstitium between mucus-secreting gland acini or surrounding gland ducts. 50

9 Reference List E1. Drury RAB and Wallington EA. Chapter 7, General staining procedures, p Carleton's Histological Techniques. Oxford New York Toronto: Oxford University Press; 1980, p E2. Zhu J, Kilty I, Granger H, Gamble E, Qiu YS, Hattotuwa K, Elston W, Liu WL, Oliva A, Pauwels RA, Kips JC, De Rose V, Barnes N, Yeadon M, Jenkinson S, Jeffery PK. Gene expression and immuno-localization of 15-lipooxygenase isozymes in the airway mucosa of smokers with chronic bronchitis. Am J Resp Cell Mol Biol. 2002; 27: E3. Zhu J, Majumdar S, Qiu YS, Ansari T, Oliva A, Kips JC, Pauwels RA, De Rose V, and Jeffery PK: IL-4 and IL-5 gene expression and inflammation in the mucus-secreting glands and subepithelial tissue of smokers with chronic bronchitis: lack of relationship with CD8+ cells. Am J Resp Crit Care Med. 2001; 164: E4. Aherne WA, Dunnill MS. Point counting and morphometry, In: Aherne WA, Dunnill MS, editors. Morphometery. London: Arnold E;1982. p

10 E Figure legends Figures E1A-F Double immunofluorescence staining to identify co-localization of CD20+ B-lymphocytes or CD68+ monocytes/macrophages and IL-4 protein in the submucosal compartment of bronchi from a patient with CB: immunopositive A) CD 20+ and D) CD68+ cells are illustrated with green FITC fluorescence alone. B,E) IL-4 protein positivity stained by anti-human IL-4 antibody is shown by Texas red fluorescence alone. Cells showing co-expression of either C) CD20+ cells or F) CD68+ cells with IL-4 protein are fluorescing yellow (I,e, a mixture of the two colors). Nuclei are counter stained blue with DAPI (internal scale bars = 20 µm). Figure E2. Double immunofluorescence stain confirming that mouse anti-human monoclonal antibodies to plasma cell specific antigens do not cross react with CD20+ B-lymphocytes in the submucosal compartment of bronchi from a patient with CB: plasma cells are illustrated with Texas red (arrows) and CD20+ B-lymphocytes shown by green FITC fluorescence (arrow heads). No yellow fluorescent double-labelled cells can be seen. Nuclei are counter stained blue with DAPI (internal scale bar = 10 µm). Figure E3A & B. Alcian blue-periodic Acid Schiff staining with diastase digestion to indentify acidic and neutral mucopolysaccharides stained blue or purple red, respectively in A) surface and B) glandular epithelium of bronchi from a patient with CB (internal scale bar = 20 µm). 52

11 Table E1 Characteristics of subjects with chronic bronchitis and chronic obstructive pulmonary disease Subjects No. Sex (M/F) Age (Yr) Smoking (Pack/yr) FVC ( %) FEV1 (%) FEV1/FVC (%) AS 1 M M M M M M M M M M M Mean SEM CB 12 M M M M M M M M M M M 80 Ex-smoker Mean SEM CB+COPD 23 M M M M M M M M M M Mean SEM * 3.5 Definition of abbreviations: AS = asymptomatic smokers; CB = chronic bronchitis; COPD = chronic obstructive pulmonary disease; SEM = standard error of mean. *P < compared to AS and CB groups, respectively, (unpaired Student s t test). 60.5*

12 Table E2 Median (range) of inflammatory cells in epithelium, subepithelium, glands and muscles: a comparison within or between tissue compartments Cell AS CB CB + AO type Ep S-Ep Gland Muscle Ep S-Ep Gland Muscle Ep S-Ep Gland Muscle Plasma cells 0 (0-0) 38 (4-107) 41 (10-136) 0 (0-0) 0 (0-0) 110 (44-235) 213 (76-313) 0 (0-0) 0 (0-0) 55 (20-177) 118 (18-224) 0 (0-0) Mast cells CD4+ cells 21 (0-39) 9 (0-47) 65 (39-247) 77* (12-118) 35 (15-97) 38* (23-91) 47 װ (29-86) 6 (0-51) 19 (0-124) 12 (0-58) 204 (61-348) 63* (29-137) 34 (21-64) 46* (17-95) 50 װ (30-140) 8 (0-24) 26 (0-95) 9 (0-76) 115 (43-259) 87* (35-191) 34 (19-78) 62* (20-88) 33 װ (0-57) 10 (2-21) CD8+ cells 123 (30-312) 75 (16-187) 41 (5-113) 2 (0-15) 130 (49-391) 99 (33-253) 36 (12-70) 3 (0-19) 109 (8-352) 109 (10-280) 31 (4-99) Abbreviations: Ep = epithelium; S-Ep = sub-epithelium. *P < 0.01 vs epithelial and muscle areas of AS, CB and CB+AO, respectively; P < vs mast cells, CD4+ cells and plasma cells in epithelial area of AS, CB and CB+AO, respectively; P< 0.01 vs plasma cells, CD4+ and CD8+ cells in subepithelial area of CB; P < 0.05 or 0.01 vs mast cells, CD4+ and CD8+ cells in gland area of CB and CB+AO, respectively. װ P< 0.01 vs plasma cells, CD4+ and CD8+ cells in muscle area in each of three groups. 5(0-27) 54

13 Table E3 Fold increases in the numbers of inflammatory cells in different compartments of the large airways of CB: a comparison with AS subjects and those with CB+AO Cell type Comparison with AS Comparison with CB+COPD Ep Sub- Ep Gland Ep Sub-Ep Gland CD45+ cells Plasma cells Mast cells CD4+ cells CD8+ cells Abbreviations: Ep = Epithelium, AS = Asymptomatic smoker, CB = Chronic bronchitis, AO= airflow obstruction 55

14 Figures E1A-F 56

15 Figure E2 57

16 Figure E3A&B 58

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.

More information

Pepsin Solution ready-to-use

Pepsin Solution ready-to-use SIE HABEN DIE VISION, WIR HABEN DIE SUBSTANZ. Pepsin Solution Single component Pepsin Solution: only one component refrigerator stable Pepsin is a commonly used digestive enzyme for immunohistochemical

More information

Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2],

Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2], Supplementary information Methods Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2], and A/Hong Kong/213/03 [H5N1]) were grown in Madin-Darby canine kidney (MDCK) cells

More information

SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy

SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy SUPPLEMENTARY MATERIAL Sample preparation for light microscopy To characterize the granulocytes and melanomacrophage centers, cross sections were prepared for light microscopy, as described in Material

More information

JIE ZHU, SWATI MAJUMDAR, YUSHENG QIU, TAREQ ANSARI, ALESSANDRO OLIVA, JOHAN C. KIPS, ROMAIN A. PAUWELS, VIRGINIA DE ROSE, and PETER K.

JIE ZHU, SWATI MAJUMDAR, YUSHENG QIU, TAREQ ANSARI, ALESSANDRO OLIVA, JOHAN C. KIPS, ROMAIN A. PAUWELS, VIRGINIA DE ROSE, and PETER K. Interleukin-4 and Interleukin-5 Gene Expression and Inflammation in the Mucus-secreting Glands and Subepithelial Tissue of Smokers with Chronic Bronchitis Lack of Relationship with CD8 Cells JIE ZHU, SWATI

More information

HRP cytochemistry. Division of Radiooncology, Deutsches Krebsforschungszentrum, Heidelberg, Germany

HRP cytochemistry. Division of Radiooncology, Deutsches Krebsforschungszentrum, Heidelberg, Germany HRP cytochemistry WOLF D. KUHLMANN, M.D. Division of Radiooncology, Deutsches Krebsforschungszentrum, 69120 Heidelberg, Germany A range of substrates is available for the cytochemical staining of peroxidase

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Grass pollen immunotherapy induces Foxp3 expressing CD4 + CD25 + cells. in the nasal mucosa. Suzana Radulovic MD, Mikila R Jacobson PhD,

Grass pollen immunotherapy induces Foxp3 expressing CD4 + CD25 + cells. in the nasal mucosa. Suzana Radulovic MD, Mikila R Jacobson PhD, Radulovic 1 1 2 3 Grass pollen immunotherapy induces Foxp3 expressing CD4 + CD25 + cells in the nasal mucosa 4 5 6 7 Suzana Radulovic MD, Mikila R Jacobson PhD, Stephen R Durham MD, Kayhan T Nouri-Aria

More information

of chronic obstructive pulmonary disease

of chronic obstructive pulmonary disease Eur Respir J 006; 7: 9 99 DOI: 0.8/09096.06.0007705 CopyrightßERS Journals Ltd 006 Variability of bronchial inflammation in chronic obstructive pulmonary disease: implications for study design E. Gamble*,"",

More information

Fixation... Questions 1 Answers 16. Processing... Questions 25 Answers 36. Safety... Questions 67 Answers 73

Fixation... Questions 1 Answers 16. Processing... Questions 25 Answers 36. Safety... Questions 67 Answers 73 Table of Contents Fixation... Questions 1 Answers 16 Processing... Questions 25 Answers 36 Instrumentation... Questions 43 Answers 58 Safety... Questions 67 Answers 73 Laboratory Mathematics & Solution

More information

Cysteinyl Leukotriene 1 Receptor Expression Associated With Bronchial Inflammation in Severe Exacerbations of COPD

Cysteinyl Leukotriene 1 Receptor Expression Associated With Bronchial Inflammation in Severe Exacerbations of COPD CHEST Cysteinyl Leukotriene Receptor Expression Associated With Bronchial Inflammation in Severe Exacerbations of COPD Jie Zhu, MD, PhD ; Venkata Bandi, MD, FCCP ; Shengyang Qiu, MD ; David J. Figueroa,

More information

LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:!

LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:! LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:! Spinal cord and peripheral nerves! Eyes, Inner ear, nasal

More information

Downregulation of angiotensin type 1 receptor and nuclear factor-κb. by sirtuin 1 contributes to renoprotection in unilateral ureteral

Downregulation of angiotensin type 1 receptor and nuclear factor-κb. by sirtuin 1 contributes to renoprotection in unilateral ureteral Supplementary Information Downregulation of angiotensin type 1 receptor and nuclear factor-κb by sirtuin 1 contributes to renoprotection in unilateral ureteral obstruction Shao-Yu Yang 1,2, Shuei-Liong

More information

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate

More information

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,

More information

Systems Pharmacology Respiratory Pharmacology. Lecture series : General outline

Systems Pharmacology Respiratory Pharmacology. Lecture series : General outline Systems Pharmacology 3320 2017 Respiratory Pharmacology Associate Professor Peter Henry (Rm 1.34) Peter.Henry@uwa.edu.au Division of Pharmacology, School of Biomedical Sciences Lecture series : General

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL5 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity

More information

3 CHAPTER 3: RESULTS

3 CHAPTER 3: RESULTS 3 CHAPTER 3: RESULTS 3.1 Histopathology 3.1.1 Normal Squamous Epithelium The squamous epithelium that covers the ectocervix of the uterus is composed of different layers starting at the basement membrane

More information

CD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer

CD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer CD14 + S1A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer Po-Hao, Feng M.D., Kang-Yun, Lee, M.D. Ph.D., Ya-Ling Chang, Yao-Fei Chan, Lu- Wei, Kuo,Ting-Yu

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: van Seters M, van Beurden M, ten Kate FJW, et al. Treatment

More information

Variation in the measurements of basement membrane thickness and inflammatory cell number in bronchial biopsies

Variation in the measurements of basement membrane thickness and inflammatory cell number in bronchial biopsies Eur Respir J 1998; 12: 811 815 DOI: 10.1183/09031936.98.12040811 Printed in UK - all rights reserved Copyright ERS Journals Ltd 1998 European Respiratory Journal ISSN 0903-1936 Variation in the measurements

More information

IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung

IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung Se-Ran Yang, Samantha Valvo, Hongwei Yao, Aruna Kode, Saravanan Rajendrasozhan, Indika Edirisinghe, Samuel

More information

Histopathology: pulmonary pathology

Histopathology: pulmonary pathology Histopathology: pulmonary pathology These presentations are to help you identify basic histopathological features. They do not contain the additional factual information that you need to learn about these

More information

Int J Clin Exp Pathol 2017;10(3): /ISSN: /IJCEP

Int J Clin Exp Pathol 2017;10(3): /ISSN: /IJCEP Int J Clin Exp Pathol 2017;10(3):3671-3676 www.ijcep.com /ISSN:1936-2625/IJCEP0046381 Original Article Comparison of immunofluorescence and immunohistochemical staining with anti-insulin antibodies on

More information

Impact of Asthma in the U.S. per Year. Asthma Epidemiology and Pathophysiology. Risk Factors for Asthma. Childhood Asthma Costs of Asthma

Impact of Asthma in the U.S. per Year. Asthma Epidemiology and Pathophysiology. Risk Factors for Asthma. Childhood Asthma Costs of Asthma American Association for Respiratory Care Asthma Educator Certification Prep Course Asthma Epidemiology and Pathophysiology Robert C. Cohn, MD, FAARC MetroHealth Medical Center Cleveland, OH Impact of

More information

Atlas of Stains. Special Stains on Artisan Link Pro

Atlas of Stains. Special Stains on Artisan Link Pro Atlas of Stains Special Stains on Artisan Link Pro Intended use Routinely processed samples (paraffin-embedded) may be used. The preferred fixative is neutral buffered formalin. The clinical interpretation

More information

HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer

HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer P A T H O L O G Y HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer For In Vitro Diagnostic Use FDA approved as an aid in the assessment of patients for whom Herceptin TM (trastuzumab) treatment

More information

Supplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent

Supplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent Supplementary Information Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent Authors: Susanne Kossatz a, Christian Brand a, Stanley Gutiontov b, Jonathan T.C. Liu c, Nancy

More information

Estrogen receptor (ER)

Estrogen receptor (ER) Assessment Run B7 204 Estrogen receptor (ER) Material The slide to be stained for ER comprised: No. Tissue ER-positivity* ER-intensity*. Uterine cervix 80-90% Moderate to strong 2. Breast carcinoma 0%

More information

Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic

Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Reticulum Stress Lokesh Makhija, BE, Veda Krishnan, MSc, Rakhshinda Rehman, MTech, Samarpana Chakraborty, MSc, Shuvadeep Maity,

More information

Special Staining (I)

Special Staining (I) Special Staining (I) Carbohydrates 1- PERIODIC ACID SCHIFF'S (PAS ) Purpose: Glycogen is present in liver, kidney, skeletal and cardiac muscle. The PAS stain is used to demonstrate neutral polysaccharides

More information

How does COPD really work?

How does COPD really work? How does COPD really work? by Alex Goodell View online Where does COPD fit in the mix of respiratory diseases? I ve made a map of the major pathologies outlined in Robbins and First Aid (obviously these

More information

RESPIRATORY BLOCK. Bronchial Asthma. Dr. Maha Arafah Department of Pathology KSU

RESPIRATORY BLOCK. Bronchial Asthma. Dr. Maha Arafah Department of Pathology KSU RESPIRATORY BLOCK Bronchial Asthma Dr. Maha Arafah Department of Pathology KSU marafah@ksu.edu.sa Jan 2018 Objectives Define asthma (BA) Know the two types of asthma 1. Extrinsic or atopic allergic 2.

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary

More information

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC

More information

KEYWORDS: Chronic obstructive pulmonary disease, inflammation, smoking, smoking cessation

KEYWORDS: Chronic obstructive pulmonary disease, inflammation, smoking, smoking cessation Eur Respir J 2007; 30: 467 471 DOI: 10.1183/09031936.00013006 CopyrightßERS Journals Ltd 2007 Airway mucosal inflammation in COPD is similar in smokers and ex-smokers: a pooled analysis E. Gamble*,#, D.C.

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

T obacco smoking is one of the major causes of chronic

T obacco smoking is one of the major causes of chronic 303 CHRONIC OBSTRUCTIVE PULMONARY DISEASE Inflammatory features of nasal mucosa in smokers with and without COPD I Vachier, A M Vignola, G Chiappara, A Bruno, H Meziane, P Godard, J Bousquet, P Chanez...

More information

Supplemental Data. Wnt/β-Catenin Signaling in Mesenchymal Progenitors. Controls Osteoblast and Chondrocyte

Supplemental Data. Wnt/β-Catenin Signaling in Mesenchymal Progenitors. Controls Osteoblast and Chondrocyte Supplemental Data Wnt/β-Catenin Signaling in Mesenchymal Progenitors Controls Osteoblast and Chondrocyte Differentiation during Vertebrate Skeletogenesis Timothy F. Day, Xizhi Guo, Lisa Garrett-Beal, and

More information

Increased number and altered phenotype of lymphatic vessels in peripheral lung compartments of patients with COPD

Increased number and altered phenotype of lymphatic vessels in peripheral lung compartments of patients with COPD Increased number and altered phenotype of lymphatic vessels in peripheral lung compartments of patients with COPD Mori et al. Mori et al. Respiratory Research 2013, 14:65 Mori et al. Respiratory Research

More information

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180

More information

Human Saliva as a Convenient Source of Ribonuclease. By S. BRADBURY

Human Saliva as a Convenient Source of Ribonuclease. By S. BRADBURY Human Saliva as a Convenient Source of Ribonuclease 323 By S. BRADBURY (From the Cytological Laboratory, Department of Zoology, University Museum, Oxford) SUMMARY Saliva, heated to 80 C for 10 minutes

More information

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right

More information

IT S ABOUT TIME. IQFISH pharmdx Interpretation Guide THREEHOURSTHIRTYMINUTES. HER2 IQFISH pharmdxtm. TOP2A IQFISH pharmdxtm

IT S ABOUT TIME. IQFISH pharmdx Interpretation Guide THREEHOURSTHIRTYMINUTES. HER2 IQFISH pharmdxtm. TOP2A IQFISH pharmdxtm I N T E R P R E TAT I O N IQFISH pharmdx Interpretation Guide TM HER2 IQFISH pharmdxtm TOP2A IQFISH pharmdxtm Breast carcinoma (FFPE) stained with HER2 IQFISH pharmdx Breast carcinoma (FFPE) stained with

More information

Neutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury

Neutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury Neutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury Bastian OW, Koenderman L, Alblas J, Leenen LPH, Blokhuis TJ. Neutrophils contribute to

More information

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.) Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor

More information

Dr Rodney Itaki Lecturer Division of Pathology Anatomical Pathology Discipline

Dr Rodney Itaki Lecturer Division of Pathology Anatomical Pathology Discipline Pathology of Asthma Dr Rodney Itaki Lecturer Division of Pathology Anatomical Pathology Discipline Bronchial Asthma Definition: chronic, relapsing inflammatory lung disorder characterised by reversible

More information

Mucin Histochemistry Study of the Prostate in Normal and Malignant Lesions

Mucin Histochemistry Study of the Prostate in Normal and Malignant Lesions ISSN 2231-4261 ORIGINAL ARTICLE Mucin Histochemistry Study of the Prostate in Normal and Malignant Lesions 1* 1 1 1 Manoj P.Ambali, Megha A. Doshi, Pratibha P. Patil, Shweta H. Chavan 1 Department of Anatomy,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

Fluorescence Microscopy

Fluorescence Microscopy Fluorescence Microscopy Imaging Organelles Mitochondria Lysosomes Nuclei Endoplasmic Reticulum Plasma Membrane F-Actin AAT Bioquest Introduction: Organelle-Selective Stains Organelles are tiny, specialized

More information

Dako IT S ABOUT TIME. Interpretation Guide. Agilent Pathology Solutions. ALK, ROS1 and RET IQFISH probes (Dako Omnis) MET IQFISH probe (Dako Omnis)

Dako IT S ABOUT TIME. Interpretation Guide. Agilent Pathology Solutions. ALK, ROS1 and RET IQFISH probes (Dako Omnis) MET IQFISH probe (Dako Omnis) INTERPRETATION Dako Agilent Pathology Solutions IQFISH Interpretation Guide ALK, ROS1 and RET IQFISH probes (Dako Omnis) MET IQFISH probe (Dako Omnis) IT S ABOUT TIME For In Vitro Diagnostic Use ALK, ROS1,

More information

2010 Health Press Ltd.

2010 Health Press Ltd. Fast Facts Fast Facts: Asthma Third edition Stephen T Holgate MD DSc FRCP FMedSci MRC Clinical Professor of Immunopharmacology School of Medicine Southampton General Hospital Southampton, UK Jo Douglass

More information

SHORT COMMUNICATION. Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points

SHORT COMMUNICATION. Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points VIROLOGY 214, 259 263 (1995) SHORT COMMUNICATION Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points DARRON R. BROWN,*,,1 JANINE T. BRYAN,

More information

COPD and Asthma: Similarities and differences Prof. Peter Barnes

COPD and Asthma: Similarities and differences Prof. Peter Barnes and Asthma: Similarities and Differences and Asthma: 1 Imperial College Peter Barnes FRS, FMedSci, National Heart & Lung Institute Imperial College, London, UK p.j.barnes@imperial.ac.uk Royal Brompton

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson

More information

Estrogen receptor (ER)

Estrogen receptor (ER) Material The slide to be stained for ER comprised: Assessment Run B26 2018 Estrogen receptor (ER) No. Tissue ER-positivity* ER-intensity* 1. Uterine cervix 80-90% Moderate to strong 2. Tonsil 1-5% Weak

More information

GSI Canine IL-5 ELISA Kit-2 Plates DataSheet

GSI Canine IL-5 ELISA Kit-2 Plates DataSheet Interleukin5 (IL5) is a secreted glycoprotein that belongs to the α-helical group of cytokines (1, 2, 3). Unlike other family members, it is present as a covalently linked antiparallel dimer (4, 5). IL-5

More information

Explain the laboratory diagnosis of Rabies?

Explain the laboratory diagnosis of Rabies? Explain the laboratory diagnosis of Rabies? The standard test for rabies testing is dfa. This test has been thoroughly evaluated for more than 40 years, and is recognized as the most rapid and reliable

More information

Product Introduction

Product Introduction Product Introduction Product Codes: HCL026, HCL027 and HCL028 Contents Introduction to HER2 2 HER2 immunohistochemistry 3 Cell lines as controls 5 HER2 Analyte Control DR IHC 7 HER2 Analyte Control DR

More information

Localization and Upregulation of Cysteinyl Leukotriene-1 Receptor in Asthmatic Bronchial Mucosa

Localization and Upregulation of Cysteinyl Leukotriene-1 Receptor in Asthmatic Bronchial Mucosa Localization and Upregulation of Cysteinyl Leukotriene-1 Receptor in Asthmatic Bronchial Mucosa Jie Zhu, Yu-Sheng Qiu, David J. Figueroa, Venkata Bandi, Helen Galczenski, Kaoru Hamada, Kalpalatha K. Guntupalli,

More information

Relationship of Small Airway Chymase-Positive Mast Cells and Lung Function in Severe. Asthma

Relationship of Small Airway Chymase-Positive Mast Cells and Lung Function in Severe. Asthma Relationship of Small Airway Chymase-Positive Mast Cells and Lung Function in Severe Asthma Silvana Balzar, M.D., Hong Wei Chu, M.D., Matthew Strand, Ph.D, Sally Wenzel, M.D. Online Data Supplement METHODS

More information

COPYRIGHTED MATERIAL. Definition and Pathology CHAPTER 1. John Rees

COPYRIGHTED MATERIAL. Definition and Pathology CHAPTER 1. John Rees CHAPTER 1 Definition and Pathology John Rees Sherman Education Centre, Guy s Hospital, London, UK OVERVIEW Asthma is an overall descriptive term but there are a number of more or less distinct phenotypes

More information

Materials and Methods

Materials and Methods 280 Fujisawa et al. 5. In order to ascertain the biological signifi cance of CD56 epithelial cells found in the duct system, we made an immunohistochemical study of fetal and normal adult pancreatic tissues

More information

Thyroid Stimulating Hormone (S-TSH) Thyroid Stimulating

Thyroid Stimulating Hormone (S-TSH) Thyroid Stimulating ab108659 Thyroid Stimulating Hormone (S-TSH) Human ELISA Kit Instructions for Use For the quantitative measurement of Human Thyroid Stimulating Hormone (S-TSH) concentrations in serum. This product is

More information

Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and

Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and Primary Children s Hospital, Salt Lake City, UT, both

More information

CHAPTER 4 IMMUNOLOGICAL TECHNIQUES

CHAPTER 4 IMMUNOLOGICAL TECHNIQUES CHAPTER 4 IMMUNOLOGICAL TECHNIQUES Nitroblue Tetrazolium Chloride (NBT) Reduction test NBT reduction test was evaluated by employing the method described by Hudson and Hay,1989 based upon principle that

More information

APPENDIX 1 ETHICAL CLEARANCE

APPENDIX 1 ETHICAL CLEARANCE APPENDIX 1 ETHICAL CLEARANCE 75 APPENDIX 2 76 PROCEDURE FOR PREPARING OF LIVER HISTOLOGY SLIDES Overview: Histology involves the use of a set of techniques to examine the morphology, architecture and composition

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer

HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer P A T H O L O G Y HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer FROM CERTAINTY COMES TRUST For in vitro diagnostic use HER2 CISH pharmdx Kit HER2 CISH pharmdx Kit is intended for dual-color

More information

Comparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3-

Comparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3- Supplemental Data Comparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3- GFP tumors in mice either injected with control or clodronate-containing liposomes and stained for macrophages using

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Single and Multiplex Immunohistochemistry

Single and Multiplex Immunohistochemistry Single and Multiplex Immunohistochemistry Steve Westra, BS Reagent Product Specialist Leica Biosystems IHC Theory Polyclonal vs Monoclonal Polyclonal reagents Detect a multitude of epitopes Batch to batch

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal

More information

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,

More information

Evaluation of the diagnostic value of immunocytochemistry and in situ hybridization in the pediatric leprosy

Evaluation of the diagnostic value of immunocytochemistry and in situ hybridization in the pediatric leprosy Indian J Lepr 203, 85 : 93- Hind Kusht Nivaran Sangh, New Delhi http://www.ijl.org.in Original Article Evaluation of the diagnostic value of immunocytochemistry and in situ hybridization in the pediatric

More information

Interpretation guide. Abnormal cytology can t hide anymore

Interpretation guide. Abnormal cytology can t hide anymore Interpretation guide Abnormal cytology can t hide anymore Unique dual-biomarker technology makes you certain about the presence of transforming HPV infection. The science that creates certainty. Table

More information

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director AlphaScreen : A Straightforward and Powerful Alternative to ELISA Martina Bielefeld-Sévigny Ph.D., R&D Director Overview AlphaScreen - an alternative to ELISA Why an alternative to ELISA? Assay principle

More information

Supplementary Information

Supplementary Information Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1

More information

IHC Polymer. BioGenex Website. Presented for: Presented by: Date: BioGenex Tech Support 2016

IHC Polymer. BioGenex Website. Presented for: Presented by: Date: BioGenex Tech Support 2016 IHC Polymer Presented for: Presented by: Date: BioGenex Website BioGenex Tech Support 2016 Immunohistochemistry (IHC) Quick Guide# Super SensitiveTM Polymer-HRP kits. Baking An-gen Retrieval DeWax Overnight,

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Study of Melanin Bleaching After Immunohistochemistry of Melanin-containing Tissues. Hongwu Shen, MD and Wenqiao Wu, MD

Study of Melanin Bleaching After Immunohistochemistry of Melanin-containing Tissues. Hongwu Shen, MD and Wenqiao Wu, MD TECHNICAL ARTICLE Study of Melanin Bleaching After Immunohistochemistry of Melanin-containing Tissues Hongwu Shen, MD and Wenqiao Wu, MD Abstract: Melanin may interfere with immunohistochemical staining.

More information

ALAEZI CM 1 *, ADISA JO 2, OKOROCHI EC 3 and OKECHI OO 4

ALAEZI CM 1 *, ADISA JO 2, OKOROCHI EC 3 and OKECHI OO 4 Global Journal of Scientific Researches Available online at gjsr.blue-ap.org 2014 GJSR Journal. Vol. 2(2), pp. 51-55, 28 February, 2014 E-ISSN: 2311-732X METHYL GREEN PYRONIN: A PROGRESSIVE NUCLEAR STAIN

More information

Robert Kruklitis, MD, PhD Chief, Pulmonary Medicine Lehigh Valley Health Network

Robert Kruklitis, MD, PhD Chief, Pulmonary Medicine Lehigh Valley Health Network Robert Kruklitis, MD, PhD Chief, Pulmonary Medicine Lehigh Valley Health Network Robert.kruklitis@lvh.com Correlation of a Asthma pathophyisology with basic science Asthma (Physiology) Bronchodilators

More information

Estrogen receptor (ER)

Estrogen receptor (ER) Material The slide to be stained for ER comprised: Assessment B25 208 Estrogen receptor (ER) No. Tissue ER-positivity* ER-intensity*. Uterine cervix 80-90% Moderate to strong 2. Tonsil < 2-5% Weak to strong

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

Sialic acid and receptor expression on the respiratory tract in normal subjects and H5N1 and non-avian influenza patients

Sialic acid and receptor expression on the respiratory tract in normal subjects and H5N1 and non-avian influenza patients RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Key Messages JM Nicholls 黎國思 JSM Peiris 裴偉士 Y Guan 管軼 1. Influenza virus binds to cell receptors via sialic acid (SA) linked glycoproteins. An accurate

More information

Bronchial gland histochemistry in lungs removed for cancer

Bronchial gland histochemistry in lungs removed for cancer Thorax, 1980, 35, 546-551 Bronchial gland histochemistry in lungs removed for cancer W DE POITIERS, P W LORD, B BILES, AND W F WHIMSTER From the Department of Morbid Anatomy, King's College Hospital, and

More information

*Corresponding author:

*Corresponding author: LIPID DROPLETS HYPERTROPHY: A CRUCIAL DETERMINING FACTOR IN INSULIN REGULATION BY ADIPOCYTES 1 Bahram Sanjabi #, 2,3 Monireh Dashty #, 4 Behiye. Özcan, 5 Vishtaseb Akbarkhanzadeh, 3 Mehran Rahimi, 7,8

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Mast cells in COPD airways: relationship to bronchodilator responsiveness and angiogenesis

Mast cells in COPD airways: relationship to bronchodilator responsiveness and angiogenesis Eur Respir J 212; 39: 1361 1367 DOI: 1.1183/931936.84411 CopyrightßERS 212 Mast cells in COPD airways: relationship to bronchodilator responsiveness and angiogenesis Amir Soltani, Yean Pin Ewe,+, Zhen

More information

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing

More information

Interpretation Manual - Gastric or Gastroesophageal Junction Adenocarcinoma. PD-L1 IHC 22C3 pharmdx is FDA-approved for in vitro diagnostic use

Interpretation Manual - Gastric or Gastroesophageal Junction Adenocarcinoma. PD-L1 IHC 22C3 pharmdx is FDA-approved for in vitro diagnostic use Interpretation Manual - Gastric or Gastroesophageal Junction Adenocarcinoma PD-L1 IHC 22C3 pharmdx is FDA-approved for in vitro diagnostic use For countries outside of the United States, see the local

More information

The Respiratory System. Dr. Ali Ebneshahidi

The Respiratory System. Dr. Ali Ebneshahidi The Respiratory System Dr. Ali Ebneshahidi Functions of The Respiratory System To allow gases from the environment to enter the bronchial tree through inspiration by expanding the thoracic volume. To allow

More information

International Conference on Biomedical and Biological Engineering (BBE 2016)

International Conference on Biomedical and Biological Engineering (BBE 2016) International Conference on Biomedical and Biological Engineering (BBE 2016) Injury Mechanism of Sub-Micron Calcium Oxalate Monohydrate and Dihydrate Crystals on Renal Epithelial Cells Poonam BHADJA, Kai

More information

Citation Acta Medica Nagasakiensia. 1992, 37

Citation Acta Medica Nagasakiensia. 1992, 37 NAOSITE: Nagasaki University's Ac Title Author(s) Immunohistochemical Study on Blood Antigens in Primary Breast Carcinom Tomita, Masao; Nakagoe, Toru; Kawah Tagawa, Yutaka Citation Acta Medica Nagasakiensia.

More information