high percentage of treated patients, and may also stimulate other lineages (2-9). In rodents,
|
|
- Pierce Roberts
- 5 years ago
- Views:
Transcription
1 Supplemental Results Lithium increases hematopoietic stem/progenitor cells Lithium increases circulating CD34 + stem cells (1) in humans, increases neutrophil count in a high percentage of treated patients, and may also stimulate other lineages (2-9). In rodents, lithium increases peripheral blood counts and enhances stem and progenitor cell numbers in ex vivo and in vivo assays. These studies led to the hypothesis that the effects of lithium are mediated at the level of the HSC and/or HPC (6, 1, 11). As sophisticated immunophenotypic markers to detect diverse hematopoietic cell types have become available since those early studies were performed, we have re-examined the effect of lithium on hematopoiesis in C7/B6 mice using FCM. Mice received dietary LiCl (or NaCl as control) at a dose that achieves a serum lithium concentration of 1. meq/l (12), similar to therapeutic concentrations in bipolar disorder patients (there was no change in the overall well being of the animals after two-three weeks on lithium). After 2 weeks, bone marrow was isolated and cells were analyzed by FCM. Lithium caused a significant increase in the number of LSK cells compared with NaCl treated animals (Supplemental Figure 1A), consistent with an increase in HSCs and HPCs, and a doubling of the overall marrow cellularity (Supplemental Figure 1B). To confirm this, we also examined expression of the SLAM family receptors CD1, CD48, and CD244 (13) and observed an approximately 2.3-fold increase in the number of CD1 + CD48 - CD244 - cells, an immunophenotypic population highly enriched for HSCs (data not shown). Histological analysis of bone marrow morphology showed no significant differences in maturity or cellular morphology in lithium-treated versus control marrows, as reported previously (not shown). Consistent with published observations in humans and rodents, the percentage of neutrophils in peripheral blood also increased 3-4% in lithium-treated mice (data not shown). Inclusion of CD34 and 1
2 Flk2 in FCM analysis shows that lithium primarily increases the CD34 + Flk2 - population, consistent with an increase in ST-HSCs (Supplemental Figure 1A). GSK-3 as the target of lithium in HSC/HPCs Inhibition of GSK-3 provides a compelling explanation for many of the known effects of lithium (14), but lithium also inhibits inositol monophosphatase and structurally related phosphomonoesterases, some of which are highly sensitive to lithium (1). To test further whether inhibition of GSK-3 explains the hematopoietic effects of lithium, we used alternative, selective GSK-3 inhibitors that are unlikely to have off-target effects that overlap with lithium (16-18). The selective GSK-3 inhibitor, 6-bromo-indirubin 3 -oxime (6BIO) has an IC for GSK-3 in the nanomolar range (17). 6BIO caused a pronounced increase in the number of LSK cells after a 2-week treatment (Supplemental Figure 1C). 6BIO also increased marrow cellularity, similar to lithium. These observations are consistent with Trowbridge et al, who observed an approximately % increase in LSK cells in mice treated with the GSK-3 inhibitor CHIR-911 (19). Goessling et al also reported that 6BIO increases HSCs in mice as measured by long-term competitive repopulation assay (2), consistent with our observation of increased LSK cells after 6BIO treatment. Taken together, these pharmacological data support the hypothesis that lithium increases HSCs through inhibition of GSK-3. To test whether progenitor cells are increased by lithium treatment, we performed colony formation assays. Previous work in the 198's with lithium-treated rodents demonstrated an increase in colony forming units (CFU) in ex vivo assays and by CFU-S formation in short-term transplants (6, 21). To confirm these studies, bone marrow cells were isolated from lithiumtreated mice and cultured in methylcellulose with hematopoietic cytokines. Marrow from lithiumtreated animals showed a two-fold increase in total colony initiating cells compared to control, similar to earlier reports (data not shown) and consistent with more recent observations with 2
3 small molecule GSK-3 inhibitors, which increase CFUs ex vivo and CFU-S approximately 1. to 2-fold (19, 2). To test in a side-by-side comparison whether structurally diverse GSK-3 inhibitors expand HPCs similar to lithium, c-kit + cells were purified from control mice and treated for three days with GSK-3 inhibitors including lithium, 6BIO (17, 2), AR-A14418 (22), and the organometallic GSK-3 inhibitor DW21 (18). (The number of cells after three days was similar in each group (Supplemental Figure 1E). Treated cells were washed and an equal number from each sample was then added to methylcellulose with hematopoietic cytokines and cultured for 1-14 days. Each of the GSK-3 inhibitors induced a marked increase in hematopoietic colony number (Supplemental Figure 1D), strongly supporting the hypothesis that lithium expands the HPC population by inhibiting GSK-3 within hematopoietic cells. Supplemental References 1. Ballin, A., Lehman, D., Sirota, P., Litvinjuk, U., and Meytes, D Increased number of peripheral blood CD34+ cells in lithium-treated patients. Br J Haematol 1: Shopsin, B., Friedmann, R., and Gershon, S Lithium and leukocytosis. Clin Pharmacol Ther 12: Boggs, D.R., Joyce, R.A The Hematopoietic Effects of Lithium. Seminars in Hematology 2: Barr, R.D., and Galbraith, P.R Lithium and hematopoiesis. Canadian Medical Association Journal 128: Tisman, G., Herbert, V., and Rosenblatt, S Evidence that lithium induces human granulocyte proliferation: elevated serum vitamin B 12 binding capacity in vivo and granulocyte colony proliferation in vitro. British Journal of Haematology 24: Joyce, R.A Sequential effects of lithium on haematopoiesis. British Journal of Haematology 6: Bille, P.E., Jensen, M.K., Kaalund Jensen, J.P., and Poulsen, J.C Studies on the haematologic and cytogenetic effect of lithium. Acta Medica Scandinavica 198: Ricci, P., Bandini, G., Franchi, P., Motta, M.R., Visani, G., and Calamandrei, G Haematological effects of lithium carbonate: a study in 6 psychiatric patients. Haematologica 66: Focosi, D., Azzara, A., Kast, R.E., Carulli, G., and Petrini, M. 29. Lithium and hematology: established and proposed uses. Journal of Leukocyte Biology 8:
4 1. Gallicchio, V.S., Messino, M.J., Hulette, B.C., and Hughes, N.K Lithium and hematopoiesis: effective experimental use of lithium as an agent to improve bone marrow transplantation. Journal of Medicine 23: Gallicchio, V.S., and Chen, M.G Modulation of murine pluripotential stem cell proliferation in vivo by lithium carbonate. Blood 6: O'Brien, W.T., Harper, A.D., Jove, F., Woodgett, J.R., Maretto, S., Piccolo, S., and Klein, P.S. 24. Glycogen synthase kinase-3beta haploinsufficiency mimics the behavioral and molecular effects of lithium. Journal of Neuroscience 24: Kiel, M.J., Yilmaz, O.H., Iwashita, T., Terhorst, C., and Morrison, S.J. 2. SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells.[see comment]. Cell 121: Klein, P.S., and Melton, D.A A molecular mechanism for the effect of lithium on development. Proc. Nat'l. Acad. Sci. U.S.A. 93: Gurvich, N., and Klein, P.S. 22. Lithium and valproic acid: parallels and contrasts in diverse signaling contexts. Pharmacol Ther 96: Bain, J., McLaughlan, H., Elliott, M., and Cohen, P. 23. The specificities of protein kinase inhibitors - an update. Biochem J 371 (Pt. 1): Meijer, L., Skaltsounis, A.L., Magiatis, P., Polychronopoulos, P., Knockaert, M., Leost, M., Ryan, X.P., Vonica, C.A., Brivanlou, A., Dajani, R., et al. 23. GSK-3-selective inhibitors derived from Tyrian purple indirubins. Chem Biol 1: Williams, D.S., Atilla, G.E., Bregman, H., Arzoumanian, A., Klein, P.S., and Meggers, E. 2. Switching on a signaling pathway with an organoruthenium complex. Angew Chem Int Ed Engl. 44: Trowbridge, J.J., Xenocostas, A., Moon, R.T., and Bhatia, M. 26. Glycogen synthase kinase-3 is an in vivo regulator of hematopoietic stem cell repopulation. Nat Med 12: Goessling, W., North, T.E., Loewer, S., Lord, A.M., Lee, S., Stoick-Cooper, C.L., Weidinger, G., Puder, M., Daley, G.Q., Moon, R.T., et al. 29. Genetic interaction of PGE2 and Wnt signaling regulates developmental specification of stem cells and regeneration. Cell 136: Levitt, L.J., and Quesenberry, P.J The effect of lithium on murine hematopoiesis in a liquid culture system. New England Journal of Medicine 32: Bhat, R., Xue, Y., Berg, S., Hellberg, S., Ormo, M., Nilsson, Y., Radesater, A.C., Jerning, E., Markgren, P.O., Borgegard, T., et al. 23. Structural insights and biological effects of glycogen synthase kinase 3-specific inhibitor AR-A Journal of Biological Chemistry 278:
5 Supplemental Figure Legends Supplemental figure 1. Lithium and other GSK-3 inhibitors expand HSC/HPCs: (A) Absolute number of Lineage-Sca-1 + ckit + (LSK) fraction, which is enriched for HSCs, and immunophenotypic LT-HSC (LSK; CD34 - Flk2 - ) and ST-HSC (LSK CD34 + Flk-2 - ) fractions in bone marrow harvested from mice treated with control or lithium diet for 2 weeks. (B) Cellularity of bone marrow, thymus and spleen in control and lithium treated mice, shown as the number of nucleated cells/mouse recovered from both femurs and tibias, thymus, and spleen. (C) Percentage (left) and absolute number (right) of HSC/HPCs (as LSK) in mice treated with 6BIO vs control for two weeks. (D) Colony formation assay: Purified total c-kit + cells were treated with lithium, 6BIO, AR-A14418, or Ru (1-OH) (also known as DW12) for 3 days and plated in methylcellulose with hematopoietic cytokines for 12 days. Colonies of >3 viable cells were counted and the mean colony number/, plated cells for each of three separate experiments is shown. (E) The total numbers of c-kit + cells in each drug treatment after 3 days primary culture were shown. Supplemental figure 2. Annexin V staining and cellularity of bone marrow harvested from transplant recipients: (A) Flow cytometric detection of Annexin V using bone marrow cells harvested from 1º recipients after 4 month bone marrow transplantation from both control and. Annexin V was measured in the GFP + LSK gated population. (B) Total number of bone marrow cells and number of GFP + cells recovered in bone marrow from 1º recipients after 4 month transplant. (C) Total number and number of GFP + cells recovered in bone marrow from 2º recipients after 4 months. (D) Total number and number of GFP + cells recovered in bone marrow from 3º recipients after 4 months.
6 Supplemental Figure 3. Increased colony formation induced by requires ß- catenin: Colony formation assay was performed (as in figure 1) using sorted GFP + cells harvested from 1º recipients (A) or 2º recipients (B) of wild-type (left) and ß-catenin KO (right) marrow transduced with control (open boxes) or (filled boxes) lentivirus. Data represent mean number of colonies per well for five mice per construct repeated in three separate experiments. Supplemental Figure 4. Effect of ß-catenin conditional knockout on colony formation in Gsk3-depleted bone marrow: Colony formation assay was performed (as in figure 1) using sorted GFP + cells from each group in 1º (A) and 2º (B) recipients. Data represent mean number of colonies per well for five mice per construct repeated in three separate experiments. 6
7 A. 12 B. 1 Lithium No. of cells(x14) LSK LSK CD34-Flk2- LSK CD34+Flk2- No. of total cells(x17) BM Thymus Spleen Lithium C. Percentage of LSK in BM(%) control 6BIO No. of BM LSK cells(x14) control 6BIO D. 1 colonies/, cells untreated DMSO Li+ 6BIO AR DW21 E. No. of total cells(x1) untreated DMSO Li+ 6BIO AR DW21 Supplemental figure 1. Lithium and other GSK3 inhibitors expand HSC/HPCs: (A) Absolute number of Lineage- Sca-1+cKit+ (LSK) fraction, which is enriched for HSCs, and immunophenotypic LT-HSC (LSK; CD34-Flk2-) and ST-HSC (LSK CD34+Flk-2-) fractions in bone marrow harvested from mice treated with control or lithium diet for 2 weeks. (B) Cellularity of bone marrow, thymus and spleen in control and lithium treated mice, shown as the number of nucleated cells/mouse recovered from both femurs and tibias, thymus, and spleen. (C) Percentage (left) and absolute number (right) of HSC/HPCs (as LSK) in mice treated with 6BIO vs control for two weeks. (D) Colony formation assay: Purified total c-kit+ cells were treated with lithium, 6BIO, AR-A14418, or Ru(1-OH) (also known as DW12) for 3 days and plated in methylcellulose with hematopoietic cytokines for 12 days. Colonies of >3 viable cells were counted and the mean colony number/, plated cells for each of three separate experiments is shown. (E) The total numbers of c-kit+ cells in each drug treatment after 3 days primary culture were shown. Supplemental Figure 1.
8 A. GFP+LSK gated cells relative cell number IgG Annexin V B º recipients No. of BM cells(x16) Total cells GFP+ cells C. No. of BM cells(x16) º recipients Total cells GFP+ cells D. No. of BM cells(x16) º recipients Total cells GFP+ cells Supplemental figure 2. Annexin-V staining and cellularity of bone marrow harvested from transplant recipients: (A) Flow cytometric detection of Annexin V using bone marrow cells harvested from 1º recipients after 4 month bone marrow transplantation from both control and. Annexin V was measured in the GFP+LSK gated population. (B) Total number of bone marrow cells and number of GFP+ cells recovered in bone marrow from 1º recipients after 4 month transplant. (C) Total number and number of GFP+ cells recovered in bone marrow from 2º recipients after 4 months. (D) Total number and number of GFP+ cells recovered in bone marrow from 3º recipients after 4 months. Supplemental figure 2.
9 A. No. of colonies/3, cells WT β catenin KO B. No. of colonies/3, cells WT β catenin KO Supplemental Figure 3. Increased colony formation induced by requires ß-catenin: Colony formation assay was performed (as in figure 1) using sorted GFP+ cells harvested from 1º recipients (A) or 2º recipients (B) of wild-type (left) and ß-catenin KO (right) marrow transduced with control (open boxes) or (filled boxes) lentivirus. Data represent mean number of colonies per well for five mice per construct repeated in three separate experiments. Supplemental figure 3.
10 A. No. of colonies/3, cells WT β catenin KO B. No. of colonies/3, cells WT β catenin KO Supplemental Figure 4. Effect of ß-catenin conditional knockout on colony formation in Gsk3-depleted bone marrow: Colony formation assay was performed (as in figure 1) using sorted GFP+ cells from each group in 1º (A) and 2º (B) recipients. Data represent mean number of colonies per well for five mice per construct repeated in three separate experiments. Supplemental figure 4.
BCR-ABL - LSK BCR-ABL + LKS - (%)
Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
More informationThe Role of Rac Signaling in The Perivascular Niche
The Role of Rac Signaling in The Perivascular Niche Felicia Ciuculescu Diaspora and Higher Education and Research Perspectives in Personalized Medicine- from Concept to Clinical Application Center for
More informationSupplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently
Immunity, Volume 47 Supplemental Information Granulocyte-Monocyte Progenitors and Monocyte-endritic ell Progenitors Independently Produce Functionally istinct Monocytes lberto Yáñez, Simon G. oetzee, ndre
More informationHematopoiesis. - Process of generation of mature blood cells. - Daily turnover of blood cells (70 kg human)
Hematopoiesis - Process of generation of mature blood cells - Daily turnover of blood cells (70 kg human) 1,000,000,000,000 total cells 200,000,000,000 red blood cells 70,000,000,000 neutrophils Hematopoiesis
More informationStem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research.
Stem cells: units of development and regeneration Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research Concepts 1. Embryonic vs. adult stem cells 2. Hematopoietic stem
More informationNormal & Leukaemic haematopoiesis. Dr. Liu Te Chih Dept of Haematology / Oncology National University Health Services Singapore
Normal & Leukaemic haematopoiesis 2010 Dr. Liu Te Chih Dept of Haematology / Oncology National University Health Services Singapore Use of Immunophenotyping today Lineage assignment Differentiation of
More informationNature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
More informationMolecular Characterization of Leukemia Stem Cell Development. Scott A. Armstrong MD, Ph.D.
Molecular Characterization of Leukemia Stem Cell Development Scott A. Armstrong MD, Ph.D. Normal and Leukemic Hierarchies NORMAL HSC (SRC) Myeloid progenitor LTC-IC CFU AML LSC (SL-IC) Leukemic LTC-IC
More informationX P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
More informationMeeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A
Meeting Report Affiliation Department of Transfusion Medicine and Cell Therapy Name Hisayuki Yao Name of the meeting Period and venue Type of your presentation Title of your presentation The 54 th Annual
More informationCD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow
White Paper September 2016 CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow Lily C. Trajman, PhD Introduction: Hematopoietic Stem Cells (HSCs)
More informationSUPPLEMENTARY INFORMATION
a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages
More informationSupplementary Figure 1. Successful excision of genes from WBM lysates and
Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was
More informationTITLE: Properties of Leukemia Stem Cells in a Novel Model of CML Progression to Lymphoid Blast Crisis
AD Award Number: W81XWH-05-1-0608 TITLE: Properties of Leukemia Stem Cells in a Novel Model of CML Progression to Lymphoid Blast Crisis PRINCIPAL INVESTIGATOR: Craig T. Jordan, Ph.D. CONTRACTING ORGANIZATION:
More informationChronic variable stress activates hematopoietic stem cells
SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur
More informationEffective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
More informationSupplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
More informationHaematopoietic stem cells
Haematopoietic stem cells Neil P. Rodrigues, DPhil NIH Centre for Biomedical Research Excellence in Stem Cell Biology Boston University School of Medicine neil.rodrigues@imm.ox.ac.uk Haematopoiesis: An
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
More informationHighly Efficient CRISPR/Cas9 Gene Editing and Long-Term Engraftment of Human Hematopoietic Stem and Progenitor Cells
Highly Efficient CRISPR/Cas9 Gene Editing and Long-Term Engraftment of Human Hematopoietic Stem and Progenitor Cells J. M. Heath, A. Chalishazar, C.S. Lee, W. Selleck, C. Cotta-Ramusino, D. Bumcrot, J.L.
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationRCPA Research Award Final Progress Review
RCPA Research Award 2010-2011 Final Progress Review Name: Dr Craig Wallington-Beddoe Degree/Institution/Year: PhD, The University of Sydney, Year 2 Research Project Title: New Therapeutic Strategies for
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationGetting to the root of Cancer
Cancer Stem Cells: Getting to the root of Cancer Dominique Bonnet, Ph.D Senior Group Leader, Haematopoietic Stem Cell Laboratory Cancer Research UK, London Research Institute Venice, Sept 2009 Overview
More informationSupplemental Information. Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection. Cell Host & Microbe, Volume 15
Cell Host & Microbe, Volume 15 Supplemental Information Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection Arya Khosravi, Alberto Yáñez, Jeremy G. Price, Andrew Chow, Miriam Merad, Helen
More informationDone By : WESSEN ADNAN BUTHAINAH AL-MASAEED
Done By : WESSEN ADNAN BUTHAINAH AL-MASAEED Acute Myeloid Leukemia Firstly we ll start with this introduction then enter the title of the lecture, so be ready and let s begin by the name of Allah : We
More informationactivation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-13-1-0057 TITLE: Role of TIRAP in Myelodysplastic Syndromes PRINCIPAL INVESTIGATOR: Linda Ya-ting Chang CONTRACTING ORGANIZATION: British Columbia Cancer Agency Branch Vancouver,
More informationNature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.
Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described
More informationSUPPLEMENTARY INFORMATION doi: /nature12026
doi:1.138/nature1226 a 4 35 3 MCSF level (pg/ml) 25 2 15 1 5 1h3 3h 5h 7h 15h 24h b MPP (CD135 KSL) HSC (CD34 CD15 KSLF) c % 4 ** LPS 3 GFP pos cells 2 PU.1 GFP LPS 1 FSCA Ctl NI 24h LPS Sup.Fig.1 Effect
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationCHAPTER 3 LABORATORY PROCEDURES
CHAPTER 3 LABORATORY PROCEDURES CHAPTER 3 LABORATORY PROCEDURES 3.1 HLA TYPING Molecular HLA typing will be performed for all donor cord blood units and patients in the three reference laboratories identified
More informationCD27 signaling on chronic myelogenous leukemia stem cells activates Wnt target genes and promotes disease progression
Research article CD27 signaling on chronic myelogenous leukemia stem cells activates Wnt target genes and promotes disease progression Christian Schürch, 1 Carsten Riether, 1 Matthias S. Matter, 2 Alexandar
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Pleiotrophin Regulates the Expansion and Regeneration of Hematopoietic Stem Cells Heather A Himburg 1, Garrett G Muramoto 1 *, Pamela Daher 1*, Sarah K Meadows 1, J. Lauren Russell
More informationHematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne
Hematopoiesis BHS Liège 27/1/2012 Dr Sonet Anne UCL Mont-Godinne Hematopoiesis: definition = all the phenomenons to produce blood cells Leukocytes = White Blood Cells Polynuclear = Granulocytes Platelet
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationDr Prashant Tembhare
Dr Prashant Tembhare docprt@gmail.com FCM very powerful technology in Identification and characterization of neoplastic plasma cells as it allows - simultaneous assessment of multiple antigens large numbers
More informationAutomated and Standardized Counting of Mouse Bone Marrow CFU Assays
Automated and Standardized Counting of Mouse Bone Marrow CFU Assays 2 Automated and Standardized Colony Counting Table of Contents 4 Colony-Forming Unit (CFU) Assays for Mouse Bone Marrow 5 Automated Assay
More informationDifferentiation Ability of Peripheral Blood Cells from Patients with Acute Leukemia or Blast Crisis in Chronic Myelocytic Leukemia"
Differentiation Ability of Peripheral Blood Cells from Patients with Acute Leukemia or Blast Crisis in Chronic Myelocytic Leukemia" Hoelzer, D.,l, Harriss, E. B.l, Kurrle, E.l, Schmücker, H.l, Hellriegel,
More informationNatural Killer Cells: Development, Diversity, and Applications to Human Disease Dr. Michael A. Caligiuri
Natural Killer Cells: Development, Diversity, November 26, 2008 The Ohio State University Comprehensive Cancer Center The James Cancer Hospital and Solove Research Institute Columbus, Ohio, USA 1 Human
More informationSupplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ
Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,
More informationNK cell flow cytometric assay In vivo DC viability and migration assay
NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
More informationThe nucleotide sugar UDP-glucose mobilizes long-term repopulating primitive hematopoietic cells
Research article The nucleotide sugar UDP-glucose mobilizes long-term repopulating primitive hematopoietic cells Sungho Kook, 1 Joonseok Cho, 1 Sean Bong Lee, 2 and Byeong-Chel Lee 1 1 University of Pittsburgh
More informationVUmc Basispresentatie
Clinical diagnostic cytometry Gerrit J Schuurhuis Dept of Hematology VU University Medical Center Amsterdam, Netherlands Use of immunophenotyping at diagnosis to trace residual disease after therapy 1.
More informationBCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid
Supplementary Results BCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid leukemia Oliver Hantschel*, Wolfgang Warsch*, Eva Eckelhart*, Ines Kaupe, Florian Grebien, Kay-Uwe Wagner, Giulio
More informationBlocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
More informationDosimetry comparison of orthovoltage x-ray and 137 Cs irradiation of the murine bone marrow compartment Matthew Belley
Dosimetry comparison of orthovoltage x-ray and 137 Cs irradiation of the murine bone marrow compartment Matthew Belley NCHPS Fall Meeting October 9, 2015 Duke Medical Physics Disclaimer Financial support
More informationSupplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
More informationSelective Enhancement of Donor Hematopoietic Cell Engraftment by the CXCR4 Antagonist AMD3100 in a Mouse Transplantation Model
Selective Enhancement of Donor Hematopoietic Cell Engraftment by the CXCR4 Antagonist AMD3100 in a Mouse Transplantation Model Yubin Kang 1, Benny J. Chen 2, Divino DeOliveira 2, Jeffrey Mito 2, Nelson
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the author to give readers additional information about his work. Supplement to: Olnes MJ, Scheinberg P, Calvo KR, et al. Eltrombopag and improved
More informationSDF-1/CXCR4 Axis on Endothelial Progenitor Cells Regulates Bone Fracture Healing
SDF-1/CXCR4 Axis on Endothelial Progenitor Cells Regulates Bone Fracture Healing Yohei Kawakami, M.D., Ph.D. 1,2, Masaaki Ii 3, Tomoyuki Matsumoto, M.D., Ph.D. 1, Astuhiko Kawamoto, M.D., Ph.D. 2, Yutaka
More informationHematopoiesis. Hematopoiesis. Hematopoiesis
Chapter. Cells and Organs of the Immune System Hematopoiesis Hematopoiesis- formation and development of WBC and RBC bone marrow. Hematopoietic stem cell- give rise to any blood cells (constant number,
More informationBone Marrow Stroma in Myelodysplastic Syndromes
Bone Marrow Stroma in Myelodysplastic Syndromes Universidad de Salamanca Prof Mª M Consuelo del Cañizo Hematology Dept. University Hospital, Salamanca SPAIN Bone marrow stroma in MDS Introduction Mesenchymal
More informationTITLE: Effects of Hematopoietic Stem Cell Age on CML Disease Progression
AD Award Number: W81XWH-04-1-0795 TITLE: Effects of Hematopoietic Stem Cell Age on CML Disease Progression PRINCIPAL INVESTIGATOR: Kenneth Dorshkind, Ph.D. CONTRACTING ORGANIZATION: University of California,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationGenetic and Pharmacologic Inhibition of b-catenin Targets Imatinib-Resistant Leukemia Stem Cells in CML
Article Genetic and Pharmacologic Inhibition of b-catenin Targets Imatinib-Resistant Leukemia Stem Cells in CML Florian H. Heidel, 1,2,3 Lars Bullinger, 1,2,4 Zhaohui Feng, 1,2 Zhu Wang, 1,2 Tobias A.
More informationSuppression of Cytochrome P450 Reductase Enhances Long-Term Hematopoietic Stem Cell Repopulation Efficiency in Mice
Suppression of Cytochrome P450 Reductase Enhances Long-Term Hematopoietic Stem Cell Repopulation Efficiency in Mice Yan Zhang 1,2., Fang Dong 1,2., Na Zhang 1,2, Hui Cheng 1,2, Yakun Pang 1,2, Xiaomin
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
More informationSupplemental Materials
Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo
More informationTISSUE-SPECIFIC STEM CELLS
TISSUE-SPECIFIC STEM CELLS Inhibition of Aldehyde Dehydrogenase Expands Hematopoietic Stem Cells with Radioprotective Capacity GARRETT G. MURAMOTO, a J. LAUREN RUSSELL, a RACHID SAFI, b ALICE B. SALTER,
More informationUniversity of Miami Miller School of Medicine, Miami, FL 33136, USA, 3 State Key Laboratory
Supplementary File ASXL1 plays an important role in erythropoiesis Hui Shi 1,2,3, Shohei Yamamoto 1,2,4, Mengyao Sheng 3, Jie Bai 3, Peng Zhang 1,2, Runze Chen 1,2, Shi Chen 1,2, Lihong Shi 3, Omar Abdel-Wahab
More informationStem cells are undifferentiated cells which are maintained within a specific niche. A stem cell
Abstract Stem cells are undifferentiated cells which are maintained within a specific niche. A stem cell niche is a microenvironment of cells that maintain stem cell functionality, and one example is the
More informationFebruary 14, 2003 Report on preclinical studies in gc-ko mice Fabio Candotti
February 14, 2003 Report on preclinical studies in gc-ko mice Fabio Candotti Five published reports (see details below) have described the development of peripheral blood lymphocytes as well as cellular
More informationDISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS
DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS James Clinton, Ph.D. Scientist, ATCC February 19, 2015 About ATCC Founded in 1925, ATCC is a non-profit
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
More informationEML Erythroid and Neutrophil Differentiation Protocols Cristina Pina 1*, Cristina Fugazza 2 and Tariq Enver 3
EML Erythroid and Neutrophil Differentiation Protocols Cristina Pina 1*, Cristina Fugazza 2 and Tariq Enver 3 1 Department of Haematology, University of Cambridge, Cambridge, UK; 2 Dipartimento de Biotecnologie
More informationImpaired DNA replication within progenitor cell pools promotes leukemogenesis
Impaired DNA replication within progenitor cell pools promotes leukemogenesis Ganna Bilousova, University of Colorado Andriy Marusyk, University of Colorado Christopher Porter, Emory University Robert
More informationASH 2011 aktualijos: MSC TPŠL gydyme. Mindaugas Stoškus VULSK HOTC MRMS
ASH 2011 aktualijos: MSC TPŠL gydyme Mindaugas Stoškus VULSK HOTC MRMS #3042. Yukiyasu Ozawa et al. Mesenchymal Stem Cells As a Treatment for Steroid-Resistant Acute Graft Versus Host Disease (agvhd);
More informationHematopoiesis i starts from. HPC differentiates t to sequentially more mature. HPC circulate in very low
Upstate Cord Blood Bank Hematopoietic Progenitor Cells Hematopoiesis i starts from self renewing HPC HPC differentiates t to sequentially more mature blood cells HPC circulate in very low numbers in adults
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationSUPPLEMENT Supplementary Figure 1: (A) (B)
SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with
More informationCLINICAL USE OF CELLULAR SUBPOPULATION ANALYSIS IN BM
CLINICAL USE OF CELLULAR SUBPOPULATION ANALYSIS IN BM CANCER RESEARCH CENTRE, UNIVERSITY AND UNIVERSITY HOSPITAL OF SALAMANCA (SPAIN)( Sao Paulo, 18th of April, 2009 IDENTIFICATION OF HPC (I) 1.- In vivo
More informationScientific report: Delineating cellular stages and regulation of human NK cell development to improve NK cell-based therapy for cancer (Dnr )
Scientific report: Delineating cellular stages and regulation of human NK cell development to improve NK cell-based therapy for cancer (Dnr 130259) The main goal of this project focuses on establishing
More informationFLOW CYTOMETRIC ANALYSIS OF NORMAL BONE MARROW
XI International Conference Hematopoiesis Immunology Budapest, June 6-7, 2014 FLO CYTOMETRIC ANALYSIS OF NORMAL BONE MARRO Bruno Brando and Arianna Gatti Hematology Laboratory and Transfusion Center Legnano
More informationResident cardiac stem cells: how to find and use them
Resident cardiac stem cells: how to find and use them G. Hasenfuß Cardiology and Pneumology Heart Research Center Göttingen Georg-August-University Göttingen Definition: Stem cell Selfrenewal Stem cell
More informationModeling Developmental Hematopoiesis Using Pluripotent Stem Cells
Modeling Developmental Hematopoiesis Using Pluripotent Stem Cells Christopher Sturgeon February 14, 2017 Pluripotent Stem Cells self-renewal hpsc Mesoderm blood cardiovascular muscle Endoderm lung liver
More informationEffective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features
Effective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features Loretta Gammaitoni, Lidia Giraudo, Valeria Leuci, et al. Clin Cancer Res
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationFeasibility of hyperthermia as a purging modality in autologous bone marrow transplantation Wierenga, Pieter Klaas
University of Groningen Feasibility of hyperthermia as a purging modality in autologous bone marrow transplantation Wierenga, Pieter Klaas IMPORTANT NOTE: You are advised to consult the publisher's version
More informationUMBILICAL CORD BLOOD STEM CELLS EXPANDED IN THE PRESENCE OF NICOTINAMIDE (NICORD) PROVIDE LONG TERM MULITI-LINEAGE ENGRAFTMENT
UMBILICAL CORD BLOOD STEM CELLS EXPANDED IN THE PRESENCE OF NICOTINAMIDE (NICORD) PROVIDE LONG TERM MULITI-LINEAGE ENGRAFTMENT Mitchell E. Horwitz, MD Duke University Medical Center Duke Cancer Institute
More informationOne Day BMT Course by Thai Society of Hematology. Management of Graft Failure and Relapsed Diseases
One Day BMT Course by Thai Society of Hematology Management of Graft Failure and Relapsed Diseases Piya Rujkijyanont, MD Division of Hematology-Oncology Department of Pediatrics Phramongkutklao Hospital
More informationSupplementary Information
Supplementary Information Targeted Disruption of the EZH2/EED Complex Inhibits EZH2- dependent Cancer Woojin Kim 1,2,3, Gregory H. Bird 2,3,4, Tobias Neff 5, Guoji Guo 1,2,3, Marc A. Kerenyi 1,2,3, Loren
More informationHSCT MANAGEMENT WHITE PAPER. Managing stem cell apheresis effectively
HAEMATOLOGY JANUARY 2017 WHITE PAPER HSCT MANAGEMENT Managing stem cell apheresis effectively Haematopoietic stem cell transplantation Haematopoietic stem cell transplantation (HSCT) is a treatment that
More informationIn vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay
In vitro bactericidal assay Mouse bone marrow was isolated from the femur and the tibia. Cells were suspended in phosphate buffered saline containing.5% BSA and 2 mm EDTA and filtered through a cell strainer.
More informationSupplemental Experimental Procedures
Cell Stem Cell, Volume 2 Supplemental Data A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis Andrew S. Brack, Irina M. Conboy, Michael J. Conboy,
More informationGeneration of ST2-GFP reporter mice and characterization of ILC1 cells following infection
Supplementary Figure 1 Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection with influenza virus. (a) ST2-GFP reporter mice were generated as described in Methods.
More informationCase Presentation No. 075
Case Presentation No. 075 Session 4. Myelodysplastic Syndrome Cristina Montalvo, MD Baylor College of Medicine Houston, Texas 2007 Workshop of Society for Hematopathology and European Association for Haematopathology
More informationSupplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance
Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather
More informationThe Immune System. A macrophage. ! Functions of the Immune System. ! Types of Immune Responses. ! Organization of the Immune System
The Immune System! Functions of the Immune System! Types of Immune Responses! Organization of the Immune System! Innate Defense Mechanisms! Acquired Defense Mechanisms! Applied Immunology A macrophage
More informationTITLE: Assessing the Mechanisms of MDS and its Transformation to Leukemia in a Novel Humanized Mouse. REPORT DATE: September 2014
AWARD NUMBER: W81XWH-13-1-0245 TITLE: Assessing the Mechanisms of MDS and its Transformation to Leukemia in a Novel Humanized Mouse PRINCIPAL INVESTIGATOR: Stephanie Halene CONTRACTING ORGANIZATION: Yale
More informationTargeting methyltransferase PRMT5 eliminates leukemia stem cells in chronic myelogenous leukemia
Targeting methyltransferase PRMT5 eliminates leukemia stem cells in chronic myelogenous leukemia Yanli Jin,, Ruibao Ren, Jingxuan Pan J Clin Invest. 2016;126(10):3961-3980. https://doi.org/10.1172/jci85239.
More informationMariusz Z. Ratajczak M.D., Ph.D., d.hc. Stem Cell Institute at the James Graham Brown Cancer Center, University of Louisville.
Umbilical cord blood-derived CD45 - /SSEA-4 + /OCT-4 + /CD133 + /CXCR4 + /Lin - very small embryonic/epiblast like stem cells (VSELs) Potential Clinical Applications Mariusz Z. Ratajczak M.D., Ph.D., d.hc.
More informationDevelopment Supplementary information. Supplementary Figures * * +/+ +/- -/- +/+ +/- -/-
Development 144: doi:1.1242/dev.1473: Supplementary information Supplementary Figures A (f) FRT LoxP 2 3 4 B All Males Females I Ovary 1 (+) 77 bps (f) 78 bps (-) >13 bps (-) 2 4 (-) 424 bps M +/f +/-
More informationSupplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.
Relative Serpin expression 25 2 15 1 5 Serpina3f 1 2 3 4 5 6 8 6 4 2 Serpina3g 1 2 3 4 5 6 C57BL/6 DBA/2 Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Splenocytes
More informationAccelerate Your Research with Conversant Bio
Accelerate Your Research with Conversant Bio 400+ Participating MDs 50+ Partner sites for tissue procurement Continuous expansion of sourcing capabilities Closely monitored chain of custody Full regulatory
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More information