Mariusz Z. Ratajczak M.D., Ph.D., d.hc. Stem Cell Institute at the James Graham Brown Cancer Center, University of Louisville.
|
|
|
- Joshua Walton
- 5 years ago
- Views:
Transcription
1 Umbilical cord blood-derived CD45 - /SSEA-4 + /OCT-4 + /CD133 + /CXCR4 + /Lin - very small embryonic/epiblast like stem cells (VSELs) Potential Clinical Applications Mariusz Z. Ratajczak M.D., Ph.D., d.hc. Stem Cell Institute at the James Graham Brown Cancer Center, University of Louisville.
2 Circulating pluripotent stem cells CXCR4 SDF-1 gradient SDF-1 gradient SDF-1 gradient SDF-1 gradient SDF-1 gradient
3 Sorting strategy to purify Sca-1 + lin - CD45 - cells Size standard - mix of beads particles with different diameter (1-15µm) Murine BM nucleated cells - with the extended lymphgate to include very small events (2-10µm) 15μm 10μm 6μm 4μm 2μm SSC 2-10µm SSC 1μm FSC FSC Zuba-Surma et al. J Cell Mol Med 2008:12;
4 Non-hematopoietic BM stem cells are Sca-1 + lin - CD45 - SSC Lineage PE 50.5% 0.16% FSC Sca-1 PE-Cy % 0.15% Counts Sca-1 + lin - CD45 - Zuba-Surma et al. Cytometry 2008, 73, CD45 APC-Cy7 Sca-1 + lin - CD45 +
5 Very Small Embryonic Like (VSEL) Stem Cell Hematopoietic Stem Cell (HSC) Sca-1 + lin - CD45 - SSEA-1 Sca-1 + lin - CD45 + Oct4 7-AAD Nanog M1 Kucia et al. Leukemia 2006,20: FL2-A VSEL are diploid VSEL exclude 7-ADD
6 Oct-4 promotor in VSEL is hypomethylated Oct4 Proximal Enhancer Promoter VSEL HSC MSC ESC Shin et al. Leukemia 2009, 23,
7 Oct4 promoter in VSEL shows open chromatin structure (ChIP assay) VSEL HSC MNC ESC THP VSEL HSC BMMNC EB (1d) ESC-D3 VSEL HSC BMMNC EB (1d) ESC-D3 Fold of enrichment Fold of enrichment IgG H3Ac IgG H3Ac IgG H3Ac IgG H3Ac IgG H3Ac D.W. B UB Oct4-S2 Oct4-S1 B UB B UB ** H3Ac H3K9me2 ** ** 25 0 ** ** ** ** βactin Shin et al. Leukemia 2009, 23,
8 VSEL HSC MNC ESC-D3 Heat-Map Analysis for ΔCt Value from realtime PCR (Heatmap builder) Pluripotency Epiblast Germ-line Specification Germ-line Development DNA methylation C/T antigen Imprinted genes Cell Cycle
9 Epiblast/Germ line as origin and scaffold of stem cell system Nervous System extra-embryonic ectoderm Quiescence 1. Ectopic niche PGC precursors Muscles 2. Inhibitory factors 3. Erasure of the somatic imprint Fetal Liver Bone Marrow VSEL status Embryo EPIBLAST (primitive ectoderm) Myocardium Activation 1. Inflammation, tissue injury 2. Epigenetic changes 3. Reestablishment of the Legend: somatic imprint SDF-1 gradient CXCR4 + epiblast derived cells/pgc (VSEL) Genital Ridges Adrenal Glands Ratajczak et al. J Autoimmunity 2008:30;
10 Reprogramming of Genomic Imprinting in VSELs VSEL HSC BMMNC H19-DMR % 41.9 % 50.0 % 100 ** Paternally methylated DMRs DNA methylation level (%) ** ** ** Maternally methylated DMRs H19-DMR1 Rasgrf1-DMR Igf2R-DMR2 KvDMR 0 VSEL HSC BMMNC Proliferation promoting genes (Igf2, Rasgrf1) Shin et al. Leukemia, 2009, 23, Proliferation repressing genes (H19, P57kip2, Igf2R)
11 Confocal Analysis of VSEL from various murine organs Zuba-Surma et al. Cytometry 2008, 73,
12 VSEL-derived spheres in co-cultures with C2C12 cells AP staining on VSEL derived embryonic like bodies Analysis of DNA ploidy AFP Oct4 GATA-6 Cdx2 Sox2 HNF3 AFP Oct4 GATA-6 Cdx2 Sox2 HNF3 VSELs VSELs derived embryonic like bodies
13 The phenotype of most primitive Hematopoietic Stem Cell is still not well defined -Very primitive small ALDH high lin - lymphohematopoietic stem cells were described that i) do not radioprotect lethally irradiated mice, ii) lack spleen colony-forming (CFU-S) activity, however, iii) if cotransplanted with short-term engrafting HSC produce delayed multilineage engraftment (Jones et al., Blood 1996, 88; ). - UCB was reported to contain rare primitive HSC (CD34 - flt - Lin - ) that in contrast to normal adult HSC do not engraft after intravenous injection but if transplanted directly into the bones reveal hematopoietic potential (Kimura T et al. Stem Cells 2007, 25; ). - Human BM also contains a population of rare CD34 - lin - CD38 - HSC that show decreased clonogeneic activity in vitro, but in vivo engraft robustly in immunodeficient mice (Bhatia M et al. Nat Med 1998, 4; ). - Similar cells were recently also found among human BM-derived CD133 + lin - ALDH high cells (Hess DA et al. Blood 2006, 107; ).
14 - no radioprotection - no colonies Sca-1 + lin - CD45 - VSEL OP9 cells VSEL-derived cobble stone area - colonies - radioprotection
15 - no radioprotection - no colonies Sca-1 + lin - CD45 - VSEL OP9 cells VSEL-derived cobble stone area - colonies - radioprotection
16 Freshly isolated Cells expanded from HSC VSEL ctr Ikaros Ikaros HSC VSEL ctr Lmo2 Lmo2 GATA-2 GATA-2 PU.1 PU.1 SCL SCL myb myb Oct-4 Oct-4 Lin-Sca-1+CD45- VSELs CD45 CD41 Gr-1 M1 M % 25% M % 47% Lin-Sca-1+CD45+ HSCs M M M
17 Chimerism after intravenous injection of cells expanded over OP9 cell line 1x10 6 GFP LIN - /CD45 - /Sca-1 + iv (VSEL) 49,48% 32% 11% Peripheral blood 23% 2% 10% 3% B220 CD3 Gr-1 M GFP 50% 7% 59% 16% 70% 17% GFP 1x10 6 GFP LIN - /CD45 + /Sca-1 + iv (HSC) Peripheral blood 69,94% 45% 21% 18% 4% 8% 8% B220 B220 CD3 CD3 Gr-1 Gr-1 M GFP 19% 15% 46% 32% 55% 9% GFP
18 VSELs as circulating para-medics in the body
19 Oct-4 + cells in human Cord Blood Baal N et al. Expression of transcription factor Oct-4 and other embryonic genes in CD133 positive cells from human umbilical cord blood. Thromb Haemost 2004; 92: McGuckin CP et al. Production of stem cells with embryonic characteristics from human umbilical cord blood. Cell Prolif 2005; 38: Zhao Y, Wang H, Mazzone T. Identification of stem cells from human umbilical cord blood with embryonic and hematopoietic characteristics. Exp Cell Res 2006; 312: Sun B et al. Induction of human umbilical cord blood-derived stem cells with embryonic stem cell phenotypes into insulin producing islets-like structure. BBRC 2007; 354:
20 VSEL are mobilized into Umbilical Cord Blood
21 Sorting strategy for isolating UCB- derived VSELs SSC SSC Beads ( >2µm) R1 ~90% R1 FSC FSC R3 R4 ~0.01% ~0.15% CD133 Counts R2 ~5.5% VSELs CD133 + Lin - CD45 - CD45 HSCs CD133 + Lin - CD45 + Lineage
22 Human UCB-VSELs, Erythrocytes and Platelets 10µm 6µm 4µm 2µm 1µm Synthetic beads Platelets 2.98±0.45µm CB-VSELs 6.75 ± 1.04µm Erythrocytes 7.87±0.85µm
23 UCB-derived VSELS SSEA-4 DAPI OCT4 DAPI NANOG Leukemia 2007, 21, DAPI
24 TEM of UCB-derived VSELs 1 μm 1 μm 1 μm Leukemia 2007, 21,
25 Large Scale Isolation of VSELs from UCB Removal of erythrocytes - Ficoll/Paque centrifugation - Hypotonic lysis Enrichment for cells to be sorted - Immunomagnetic selection - Aldefluor staining
26 Recovery of VSELs from Cord Blood processed with MicroBeads Protocol 1: Lysis of RBCs with Ammonium Chloride UCB sample Protocol 2: Centrifugation on Ficoll-Paque Nucleated Cells (NCs) Mononuclear Cells (MNCs) MACS Isolation SSEA1 beads negative selection CD133 beads positive selection CD45 beads negative selection CD34 beads positive selection Lineage beads negative selection
27 Recovery of VSELs from UCB Processed with Ficoll-Paque and Lysis of RBCs Protocol 1: Lysis of RBCs with Ammonium Chloride UCB sample Protocol 2: Centrifugation on Ficoll-Paque Total Nucleated Cells (TNCs) Mononuclear Cells (MNCs) No. of cells/ ml UCB Lin - CD45 - fraction * * No. of cells/ ml UCB Lin - CD45 + fraction CD34 + CD133 + CD34 + CD133 + Protocol 1 (Lysis of RBCs) Protocol 2 (Ficoll-Paque)
28 Separation of UCB-VSELs based on ALDH activity CB Total NCs MACS Isolation CD133 + cells Lysis of RBCs Staining for CD133 SORT CD45 - /GlyA - /CD133 + / ALDH HIGH CD45 - /GlyA - /CD133 + / ALDH LOW CD45 + /GlyA - /CD133 + / ALDH HIGH SORT FACS Isolation (MoFlo cell sorter) Staining for CD133, GlyA, CD45 Staining for ALDH CD45 + /GlyA - /CD133 + / ALDH HIGH
29 Gating strategy for FACS sorting UCB-VSELs and HSCs based on ALDH activity R1 SSC GlyA R2 R3 FSC CD45 R4 R5 R6 R7 CD133 CD133 ALDH ALDH R4: CD45-/GlyA-/CD133+/ALDH LOW R5: CD45-/GlyA-/CD133+/ALDH HIGH R6: CD45+/GlyA-/CD133+/ALDH LOW R7: CD45+/GlyA-/CD133+/ALDH HIGH
30 Number of VSELs per 100 ml of UCB blood Phenotype of cells Number per 100 ml of UCB CD45 - /GlyA - /CD133 + /ALDH high ~ 10 3 CD45 - /GlyA - /CD133 + /ALDH low ~3.6x10 3 CD45 + /GlyA - /CD133 + /ALDH low ~46x10 3 CD45 + /GlyA - /CD133 + /ALDH high ~375x10 3
31 In vitro assays - UCB-VSELs CD45 + /GlyA - /CD133 + / ALDH HIGH CD45 + /GlyA - /CD133 + / ALDH LOW CD45 - /GlyA - /CD133 + / ALDH HIGH CD45 - /GlyA - /CD133 + / ALDH LOW Co-culture with OP-9 cells 5 days Clonogenic Assay 10 days CD133 + /GlyA - /CD45 - CD133 + /GlyA - /CD45 - /ALDH LOW /ALDH HIGH
32 Oct-4 Expression in Freshly Isolated Subpopulations of UCB-VSELs CD45 - /GlyA - /CD133 + /ALDH LOW Oct-4/ CD45 Oct-4/ DAPI ALDH/ DAPI Combo/ Br 10µm CD45 - /GlyA - /CD133 + /ALDH HIGH Oct-4/ CD45 Oct-4/ DAPI ALDH/ DAPI Combo/ Br 10µm
33 ALDH lo CD45- ALDH hi CD45- ALDH lo CD45+ ALDH hi CD ALDH lo CD45- ALDH hi CD45- ALDH lo CD45+ ALDH hi CD45+ CD45 - /GlyA - /CD133 + ALDH low CD45 - /GlyA - /CD133 + ALDH high CD45 + /GlyA - /CD133 + ALDH low CD45 + /GlyA - /CD133 + ALDH high CD45 - /GlyA - /CD133 + ALDH low CD45 - /GlyA - /CD133 + ALDH high CD45 + /GlyA - /CD133 + ALDH low CD45 + /GlyA - /CD133 + ALDH high Clonogenic Potential of Sorted Cells ALDH lo CD45- ALDH hi CD45- ALDH lo CD45+ ALDH hi CD45+ Number of CFU-C from 1x10 3 cells CD45 - /GlyA - /CD133 + ALDH low CD45 - /GlyA - /CD133 + ALDH high CD45 + /GlyA - /CD133 + ALDH low CD45 + /GlyA - /CD133 + ALDH high Number of CFU-C from 1x10 3 cells Number of CFU-C from 1x10 3 cells Freshly isolated CB-VSEL CB-VSELs after co-culture with OP-9 cells CB-VSELs expanded over OP-9 cell line and replated in MethoCult
34 Hematopoietic Differentiation of UCB-VSELs % of cells expressing CD45 among all cultured cells % of cells expressing each marker among the CD45+ cells % of CD45+ cells CD45-/GlyA-/CD133+/ALDH HIGH CD45-/GlyA-/CD133+/ALDH LOW N=3; P< CD45 CD14 GlyA * CD3 CD19 CD41
35 In Vivo Transplants CD45 - /GlyA - /CD133 + / ALDH HIGH CD45 - /GlyA - /CD133 + / ALDH LOW CD45 + /GlyA - /CD133 + / ALDH HIGH Sorted cells 5 days Co-culture with OP-9 cells 1 mo Flow cytometric analysis CD45 + /GlyA - /CD133 + / ALDH LOW Chimerism: -BM -PB -Spleen
36 CHIMERISM of SCID/NOD MICE chimerism (%) Bone Marrow chimerism (%) Spleen CD45 CD3 CD19 CD66b GlyA 0 CD45 CD3 CD19 CD66b GlyA Peripheral Blood chimerism (%) CD45 CD3 CD19 CD66b GlyA Legend: CD45 - /ALDH low CD45 - /ALDH high CD45 + /ALDH low CD45 + /ALDH high
37 Recovery of CB-VSELs from UCB Processed with AXP AutoXpress Platform UCB Unit Full UCB sample Processing Freezing/ Thawing Procedure 1 SCs Concentrate 2 SCs Concentrate No. of cells [x10 6 ] CD133 + Lin - CD45 - (CB-VSELs) ± 0.0 (x 10 6 ) 58.5 ± 15.9% * 40.5 ± 8.5% Sample # 1 # 2 # 3 3
38 Conclusions: Bone marrow is the home not only of hematopoietic stem cells but we obtained an evidence that in bone marrow as well as in other organs reside a population of germ line/epiblast-derived pluripotent very small embryonic-like (VSELs) stem cells. VSELs stem cells could be released/mobilized from neonatal BM (and other niches?) and circulate in neonatal peripheral blood (cord blood). VSELs may give rise to hematopoietic cells. Based on our in vitro and in vivo data we postulate following hierarchy of hematopoietic stem cells in UCB (from most primitive to more differentiated) i) CD45 - /CD133 + /ALDH low, ii) CD45 - /CD133 + /ALDH high, iii) CD45 + /CD133 + /ALDH low and iv) CD45 + /CD133 + /ALDH high. We also postulate that as we have already shown for murine BM-derived VSELs, human UCB-derived CD45 negative VSELs could correspond to a population of most primitive long term repopulating HSC (LT-HSC). Of note, we also found that currently employed, routine UCB processing strategies may lead up to ~50% unwanted loss of these small cells that are endowed with such remarkable hematopoietic activity.
39 Acknowledgments: JGB CC Stem Cell Institute: Thank you for your attention!!! Janina Ratajczak Magda Kucia Ewa Zuba-Surma Marcin Wysoczynski Dong Myung-Shin Iza Klich Rui Liu Wu Wan Case Western University and Cleveland Cord Blood Center: Mary J Laughlin Nick Greco
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
BCR-ABL - LSK BCR-ABL + LKS - (%)
Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8
CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow
White Paper September 2016 CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow Lily C. Trajman, PhD Introduction: Hematopoietic Stem Cells (HSCs)
Pearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
Circulating Very Small Embryonic-Like Stem Cells in Cardiovascular Disease
J. of Cardiovasc. Trans. Res. (2011) 4:138 144 DOI 10.1007/s12265-010-9254-y Circulating Very Small Embryonic-Like Stem Cells in Cardiovascular Disease Wojciech Wojakowski & Magda Kucia & Rui Liu & Ewa
Hematopoiesis. - Process of generation of mature blood cells. - Daily turnover of blood cells (70 kg human)
Hematopoiesis - Process of generation of mature blood cells - Daily turnover of blood cells (70 kg human) 1,000,000,000,000 total cells 200,000,000,000 red blood cells 70,000,000,000 neutrophils Hematopoiesis
Nature Medicine: doi: /nm.2109
HIV 1 Infects Multipotent Progenitor Cells Causing Cell Death and Establishing Latent Cellular Reservoirs Christoph C. Carter, Adewunmi Onafuwa Nuga, Lucy A. M c Namara, James Riddell IV, Dale Bixby, Michael
Nature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
Effective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
SUPPLEMENTARY INFORMATION doi: /nature12026
doi:1.138/nature1226 a 4 35 3 MCSF level (pg/ml) 25 2 15 1 5 1h3 3h 5h 7h 15h 24h b MPP (CD135 KSL) HSC (CD34 CD15 KSLF) c % 4 ** LPS 3 GFP pos cells 2 PU.1 GFP LPS 1 FSCA Ctl NI 24h LPS Sup.Fig.1 Effect
Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research.
Stem cells: units of development and regeneration Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research Concepts 1. Embryonic vs. adult stem cells 2. Hematopoietic stem
SUPPLEMENTARY INFORMATION
a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
Getting to the root of Cancer
Cancer Stem Cells: Getting to the root of Cancer Dominique Bonnet, Ph.D Senior Group Leader, Haematopoietic Stem Cell Laboratory Cancer Research UK, London Research Institute Venice, Sept 2009 Overview
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and
PRODUCTS FOR CANCER RESEARCH
PRODUCTS FOR CANCER RESEARCH TABLE OF CONTENTS 3 4 6 10 11 12 Introduction ALDEFLUOR A Powerful Tool to Study Cancer Stem Cells Culture Media for Cancer Research Culture Media Products for Breast Cancer
Haematopoietic stem cells
Haematopoietic stem cells Neil P. Rodrigues, DPhil NIH Centre for Biomedical Research Excellence in Stem Cell Biology Boston University School of Medicine neil.rodrigues@imm.ox.ac.uk Haematopoiesis: An
The DLK1-MEG3 locus in malignant cells of proposed primordial germ cell origins.
University of Louisville ThinkIR: The University of Louisville's Institutional Repository Electronic Theses and Dissertations 8-2017 The DLK1-MEG3 locus in malignant cells of proposed primordial germ cell
The Role of Rac Signaling in The Perivascular Niche
The Role of Rac Signaling in The Perivascular Niche Felicia Ciuculescu Diaspora and Higher Education and Research Perspectives in Personalized Medicine- from Concept to Clinical Application Center for
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
TISSUE-SPECIFIC STEM CELLS
TISSUE-SPECIFIC STEM CELLS Inhibition of Aldehyde Dehydrogenase Expands Hematopoietic Stem Cells with Radioprotective Capacity GARRETT G. MURAMOTO, a J. LAUREN RUSSELL, a RACHID SAFI, b ALICE B. SALTER,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Pleiotrophin Regulates the Expansion and Regeneration of Hematopoietic Stem Cells Heather A Himburg 1, Garrett G Muramoto 1 *, Pamela Daher 1*, Sarah K Meadows 1, J. Lauren Russell
Mariusz Z. Ratajczak 1, 2. Introduction. Louisville, Kentucky, USA 2 Department of Physiology, Pomeranian Medical University, Szczecin, Poland
FOLIA HISTOCHEICA ET CYTOBIOLOGICA Vol. 50, No. 2, 2012 pp. 171 179 REVIEW -, an imprinted tandem gene, is an important regulator of embryonic development, a guardian of proliferation of adult pluripotent
Applications for the MACSQuant Analyzer *
For research use only Enumeration of CD34/CD133 positive cells with the CD34/CD133 Enumeration Kit Applications for the MACSQuant Analyzer * Background The CD34 antigen is a single-chain transmembrane
Supplementary Materials for
www.sciencemag.org/content/348/6241/aaa825/suppl/dc1 Supplementary Materials for A mucosal vaccine against Chlamydia trachomatis generates two waves of protective memory T cells Georg Stary,* Andrew Olive,
DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS
DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS James Clinton, Ph.D. Scientist, ATCC February 19, 2015 About ATCC Founded in 1925, ATCC is a non-profit
Graft source and Stem cell collection SULADA PUKIAT, MD
+ Graft source and Stem cell collection SULADA PUKIAT, MD + Hematopoietic stem cells Hematopoietic stem cells are CD34 + /CD45 dim /SSC low /FSClow to intermediate Neutrophils Bone NK cells T cells Basophils
CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies
CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies Jennifer Gori American Society of Gene & Cell Therapy May 11, 2017 editasmedicine.com 1 Highlights Developed
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
In vitro human regulatory T cell expansion
- 1 - Human CD4 + CD25 + regulatory T cell isolation, Workflow in vitro expansion and analysis In vitro human regulatory T cell expansion Introduction Regulatory T (Treg) cells are a subpopulation of T
Cell therapeutics for the Insulin-Dependent Diabetes Mellitus
Cell therapeutics for the Insulin-Dependent Diabetes Mellitus Haekwon Kim Dept. of Biotechnology Seoul Women s University Introduction Type I diabetes is caused by the autoimmune destruction of pancreatic
IN VIVO EFFECTS OF SODIUM FLUORIDE ON BONE MARROW TRANSPLANTATION IN LETHALLY IRRADIATED MICE
Fluoride Vol. 35 No. 2 81-89 2002 Research Report 81 IN VIVO EFFECTS OF SODIUM FLUORIDE ON BONE MARROW TRANSPLANTATION IN LETHALLY IRRADIATED MICE Anna Machalinska, a Jaroslaw Nowak, b Alina Jarema, c
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
D Bonnet 1,2, M Bhatia 1,3, JCY Wang 1, U Kapp 1 and JE Dick 1. Summary:
Bone Marrow Transplantation, (1999) 23, 203209 1999 Stockton Press All rights reserved 02683369/99 $12.00 http://www.stockton-press.co.uk/bmt Cytokine treatment or accessory cells are required to initiate
Normal & Leukaemic haematopoiesis. Dr. Liu Te Chih Dept of Haematology / Oncology National University Health Services Singapore
Normal & Leukaemic haematopoiesis 2010 Dr. Liu Te Chih Dept of Haematology / Oncology National University Health Services Singapore Use of Immunophenotyping today Lineage assignment Differentiation of
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
Stem Cell Epigenetics
Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )
Strategic delivery: Setting standards Increasing and. Details: Output: Demonstrating efficiency. informing choice.
Strategic delivery: Setting standards Increasing and informing choice Demonstrating efficiency economy and value Details: Meeting Scientific and Clinical Advances Advisory Committee Agenda item 6 Paper
CLINICAL USE OF CELLULAR SUBPOPULATION ANALYSIS IN BM
CLINICAL USE OF CELLULAR SUBPOPULATION ANALYSIS IN BM CANCER RESEARCH CENTRE, UNIVERSITY AND UNIVERSITY HOSPITAL OF SALAMANCA (SPAIN)( Sao Paulo, 18th of April, 2009 IDENTIFICATION OF HPC (I) 1.- In vivo
Meeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A
Meeting Report Affiliation Department of Transfusion Medicine and Cell Therapy Name Hisayuki Yao Name of the meeting Period and venue Type of your presentation Title of your presentation The 54 th Annual
Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells
Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells Liying Yan,2,5, Mingyu Yang,5, Hongshan Guo, Lu Yang, Jun Wu, Rong Li,2, Ping Liu, Ying Lian, Xiaoying Zheng, Jie
Aldehyde dehydrogenase activity as a marker for the quality of hematopoietic stem cell transplants
(25) 35, 99 914 & 25 Nature Publishing Group All rights reserved 268-3369/5 $3. www.nature.com/bmt Aldehyde dehydrogenase activity as a marker for the quality of hematopoietic stem cell transplants MV
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
Cord blood transplantation and stem cell regenerative potential
Experimental Hematology 2011;39:393 412 Cord blood transplantation and stem cell regenerative potential Yanling Liao a, Mark B. Geyer a, Albert J. Yang a, and Mitchell S. Cairo a,b,c a Department of Pediatrics,
Aldehyde Dehydrogenase Activity as a Marker of Quality in Cryopreserved Cord Blood
Showa Univ J Med Sci 25 4, 297 306, December 2013 Original Aldehyde Dehydrogenase Activity as a Marker of Quality in Cryopreserved Cord Blood Hirokazu IKEDA, Daisuke TOYAMA, Ryosuke MATSUNO, Yoko FUJIMOTO
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
In vitro human regulatory T cell expansion
- 1 - Human CD4 + CD25 + CD127 dim/- regulatory T cell Workflow isolation, in vitro expansion and analysis In vitro human regulatory T cell expansion Introduction Regulatory T (Treg) cells are a subpopulation
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 (n=3 independent differentiation experiments for each
Quantitative PPARγ expression affects the balance between tolerance and immunity
Quantitative PPARγ expression affects the balance between tolerance and immunity Ya-Hui Liu 1, Yau-Sheng Tsai 1,2,3, Shih-Chieh Lin 4, Nan-Shih Liao 5, Ming-Shiou Jan 6, Chung-Tiang Liang 7, Shih-Wen Hsu
PhD THESIS Epigenetic mechanisms involved in stem cell differentiation
Romanian Academy Institute of Cellular Biology and Pathology "Nicolae Simionescu" PhD THESIS Epigenetic mechanisms involved in stem cell differentiation Coordinator: Acad. Maya Simionescu PhD Student:
Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
UMBILICAL CORD BLOOD STEM CELLS EXPANDED IN THE PRESENCE OF NICOTINAMIDE (NICORD) PROVIDE LONG TERM MULITI-LINEAGE ENGRAFTMENT
UMBILICAL CORD BLOOD STEM CELLS EXPANDED IN THE PRESENCE OF NICOTINAMIDE (NICORD) PROVIDE LONG TERM MULITI-LINEAGE ENGRAFTMENT Mitchell E. Horwitz, MD Duke University Medical Center Duke Cancer Institute
Insights into the Cell-of-Origin of the Histiocytoses Using Patient-Derived Xenograft Models
Insights into the Cell-of-Origin of the Histiocytoses Using Patient-Derived Xenograft Models 4 th Annual International Erdheim-Chester Disease Medical Symposium Paris, France September 15, 2016 Benjamin
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
TISSUE-SPECIFIC STEM CELLS
TISSUE-SPECIFIC STEM CELLS Concise Review: Recent Advances on the Significance of Stem Cells in Tissue Regeneration and Cancer Therapies MURIELLE MIMEAULT, SURINDER K. BATRA Department of Biochemistry
Journal Club WS 2012/13 Stefanie Nickl
Journal Club WS 2012/13 Stefanie Nickl Background Mesenchymal Stem Cells First isolation from bone marrow 30 ys ago Isolation from: spleen, heart, skeletal muscle, synovium, amniotic fluid, dental pulp,
Hematopoietic Stem Cells, Stem Cell Processing, and Transplantation
Hematopoietic Stem Cells, Stem Cell Processing, and Joseph (Yossi) Schwartz, M irector, Hemotherapy and Stem Cell Processing Facility Bone Marrow Can Cure: Leukemia Lymphoma Multiple Myeloma Genetic iseases:
Role of the Immune System and Bioactive Lipids in Trafficking Bone Marrow-Derived Stem Cells in Patients with Ischemic Heart Disease
University of Kentucky UKnowledge Theses and Dissertations--Microbiology, Immunology, and Molecular Genetics Microbiology, Immunology, and Molecular Genetics 2012 Role of the Immune System and Bioactive
In vitro human regulatory T cell suppression assay
Human CD4 + CD25 + regulatory T cell isolation, in vitro suppression assay and analysis In vitro human regulatory T cell suppression assay Introduction Regulatory T (Treg) cells are a subpopulation of
Rapid antigen-specific T cell enrichment (Rapid ARTE)
Direct ex vivo characterization of human antigen-specific CD154+CD4+ T cell Rapid antigen-specific T cell enrichment (Rapid ARTE) Introduction Workflow Antigen (ag)-specific T cells play a central role
CHAPTER 3 LABORATORY PROCEDURES
CHAPTER 3 LABORATORY PROCEDURES CHAPTER 3 LABORATORY PROCEDURES 3.1 HLA TYPING Molecular HLA typing will be performed for all donor cord blood units and patients in the three reference laboratories identified
Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway
Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway Jieyuan Zhang, Xiaolin Liu, Haiyan Li, Chunyuan Chen, Bin Hu, Xin Niu, Qing
Supplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
Selective Enhancement of Donor Hematopoietic Cell Engraftment by the CXCR4 Antagonist AMD3100 in a Mouse Transplantation Model
Selective Enhancement of Donor Hematopoietic Cell Engraftment by the CXCR4 Antagonist AMD3100 in a Mouse Transplantation Model Yubin Kang 1, Benny J. Chen 2, Divino DeOliveira 2, Jeffrey Mito 2, Nelson
Key Words. AC133 antigen CD34 antigen Cord blood Peripheral blood 2003;21:
Stem Cells Original Article Differences Between Peripheral Blood and Cord Blood in the Kinetics of Lineage-Restricted Hematopoietic Cells: Implications for Delayed Platelet Recovery Following Cord Blood
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
IN UTERO HEMATOPOIETIC STEM CELL TRANSPLANTATION IN CANINES: THE GESTATIONAL WINDOW OF OPPORTUNITY TO MAXIMIZE ENGRAFTMENT
IN UTERO HEMATOPOIETIC STEM CELL TRANSPLANTATION IN CANINES: THE GESTATIONAL WINDOW OF OPPORTUNITY TO MAXIMIZE ENGRAFTMENT Karin J. Blakemore, M.D. Division of Maternal-Fetal Medicine The Bone Marrow Transplant
Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature19814 Figure 3e - - - Beads: Hep SA Sup Hep SA Sup Hep - SA - Sup 150 102 76 102 76 Blot: NP-1 Blot: MECA-32 Blot: VEGF Figure 3f Rbt IgG ctrl IP VEGF IP Extended
The nucleotide sugar UDP-glucose mobilizes long-term repopulating primitive hematopoietic cells
Research article The nucleotide sugar UDP-glucose mobilizes long-term repopulating primitive hematopoietic cells Sungho Kook, 1 Joonseok Cho, 1 Sean Bong Lee, 2 and Byeong-Chel Lee 1 1 University of Pittsburgh
Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells
Immunity, Volume 46 Supplemental Information Genomic Characterization of Murine Monocytes Reveals C/EBPb Transcription Factor Dependence of Ly6C Cells Alexander Mildner, Jörg Schönheit, Amir Giladi, Eyal
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature19360 Supplementary Tables Supplementary Table 1. Number of monoclonal reads in each sample Sample Number of cells Total reads Aligned reads Monoclonal reads
Supplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
Comprehensive evaluation of human immune system reconstitution in NSG. and NSG -SGM3 mouse models toward the development of a novel ONCO-HU
Comprehensive evaluation of human immune system reconstitution in NSG and NSG -SGM3 mouse models toward the development of a novel ONCO-HU xenograft model Aaron Middlebrook, 1 Eileen Snowden, 2 Warren
Bone marrow derived cells in the tumour microenvironment contain cells with primitive haematopoietic phenotype
J. Cell. Mol. Med. Vol 14, No 7, 2010 pp. 1946-1952 Bone marrow derived cells in the tumour microenvironment contain cells with primitive haematopoietic phenotype Erika Deak a, b, Stephan Göttig a, Brigitte
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
Chronic variable stress activates hematopoietic stem cells
SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur
Supplementary Information:
Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema
Bone marrow stem cell mobilization in stroke: a bonehead may be good after all!
(2011) 25, 1674 1686 & 2011 Macmillan Publishers Limited All rights reserved 0887-6924/11 www.nature.com/leu REVIEW Bone marrow stem cell mobilization in stroke: a bonehead may be good after all! Department
Direct ex vivo characterization of human antigen-specific CD154 + CD4 + T cells Rapid antigen-reactive T cell enrichment (Rapid ARTE)
Direct ex vivo characterization of human antigen-specific CD154 + CD4 + T cells Rapid antigen-reactive T cell enrichment (Rapid ARTE) Introduction Workflow Antigen (ag)-specific T cells play a central
Nature Medicine doi: /nm.3150
Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG
McAb and rhil-2 activated bone marrow on the killing and purging of leukemia cells
Effects of McAb and rhil-2 activated bone marrow on the killing and purging of leukemia cells X.C. Wei, D.D. Yang, X.R. Han, Y.A. Zhao, Y.C. Li, L.J. Zhang and J.J. Wang Institute of hematological research,
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
Circulating Endothelial Cells and Their Clinical Significance Jaco Kraan
Circulating Endothelial Cells and Their Clinical Significance Jaco Kraan Department of Medical Oncology Erasmus MC Cancer Institute Rotterdam, The Netherlands ISLH 2016 - Milano, Italy Financial disclosure
Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
Joint Department of Biomedical Engineering
Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2018 Supplementary Data Systemic Delivery of CRISPR/Cas9 with PEG-PLGA Nanoparticles for
Today. Genomic Imprinting & X-Inactivation
Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic
COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze.
This document is available at www.stemcell.com/pis EasySep Mouse Monocyte Isolation Kit Catalog #19861 For processing 1 x 10^9 cells Description Isolate untouched and highly purified monocytes from mouse
Application Information Bulletin: Human NK Cells Phenotypic characterizing of human Natural Killer (NK) cell populations in peripheral blood
Application Information Bulletin: Human NK Cells Phenotypic characterizing of human Natural Killer (NK) cell populations in peripheral blood Christopher A Fraker, Ph.D., University of Miami - Miami, Florida
Hematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne
Hematopoiesis BHS Liège 27/1/2012 Dr Sonet Anne UCL Mont-Godinne Hematopoiesis: definition = all the phenomenons to produce blood cells Leukocytes = White Blood Cells Polynuclear = Granulocytes Platelet