Functional analysis of DNA variants

Size: px
Start display at page:

Download "Functional analysis of DNA variants"

Transcription

1 Functional analysis of DNA variants GS011143, Introduction to Bioinformatics The University of Texas GSBS program, Fall 2012 Ken Chen, Ph.D. Department of Bioinformatics and Computational Biology UT MD Anderson Cancer Center

2 Outline Lecture (1-1.5 hour) Variant annotation and functional prediction (50-60m) Break (5m) Sequence assembly (30m) Lab (30m) Variant annotation using variant effect predictor Variant annotation using Annovar NGS assembly using Velvet

3 Personalized medicine. Fernald G H et al. Bioinformatics 2011;27: The Author(s) Published by Oxford University Press.

4 Number of validated human SNPs in dbsnp overtime. Fernald G H et al. Bioinformatics 2011;27: The Author(s) Published by Oxford University Press.

5 What can we learn from variants/mutations? From individual variants Translational effect Prevalence/frequency in a population Evolutionary conservation Driver/Passenger From groups of variants (e.g. from whole genome sequencing of a population) Background mutation rate Mutation spectrum Significantly mutated genes/pathways

6 Nucleic Acids Res September; 38(16): e164 Translational effect of a variant

7 Translational effect of a variant Missense - a point mutation in which a single nucleotide is changed, resulting in a codon that codes for a different amino acid Nonsense Silent - a point mutation in a sequence of DNA that results in a premature stop codon - DNA mutations that do not result in a change to the amino acid sequence of a protein, or that do result in amino acid change but do not result in radically different properties of the changed amino acids Synonymous - A substitution in an exon that the does not alter the amino acid sequence Frameshift - A genetic mutation caused by indels (insertions or deletions) of a number of nucleotides that is not evenly divisible by three from a DNA sequence

8 DNA variants in protein coding regions Nucleic Acids Res September; 38(16): e164

9 TCGA MAF variant effect specification Frame_Shift_Del, Frame_Shift_Ins, In_Frame_Del, In_Frame_Ins, Missense_Mutation, Nonsense_Mutation, Silent, Splice_Site, Translation_Start_Site, Nonstop_Mutation, 3'UTR, 3'Flank, 5'UTR, 5'Flank, IGR, Intron, RNA, Targeted_Region De_novo_Start_InFrame, De_novo_Start_OutOfFrame

10 Nomenclature for the description of sequence variants HGVS identifier Describing genes / proteins, only official HGNC gene symbols should be used A letter indicating the type of reference sequence used - "c." for a coding DNA sequence (like c.76a>t) - "g." for a genomic sequence (like g.476a>t) - "m." for a mitochondrial sequence (like m.8993t>c) - "r." for an RNA sequence (like r.76a>u) - "p." for a protein sequence (like p.lys76asn) Reference position where the variant occurs Integers Specific changes - ">" indicates a substitution at DNA level (like c.76a>t) - "_" (underscore) indicates a range of affected residues, separating the first and last residue affected (like c.76_78delact) - "del" indicates a deletion (like c.76dela)

11 Quiz: An example HGVS identifier NOD2:NM_022162:exon4:p.R702W What does it represent? HUGO gene names NCBI Refseq database

12 RefSeq accession numbers and molecule types

13 Variant annotation software ANNOVAR Variant effect predictor

14 ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data Input Standard format of ANNOVAR input file VCF4 genotype calling format Samtools genotype-calling pileup format Complete Genomics genotype calling format GFF3-SOLiD format SOAPsnp format MAQ genotype calling format CASAVA genotype calling format Nucleic Acids Res September; 38(16): e164.

15 ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data Output Nucleic Acids Res September; 38(16): e164.

16 Variant effect predictor (VEP)

17 Variant effect predictor (VEP)

18 Case study: identifying causal genes for Mendelian diseases with recessive inheritance Exome sequencing identifies the cause of a mendelian disorder. Ng SB, Buckingham KJ, Lee C, Bigham AW, Tabor HK, Dent KM, Huff CD, Shannon PT, Jabs EW, Nickerson DA, Shendure J, Bamshad MJ Nat Genet Jan; 42(1):30-5. Published Online March Science 30 April 2010: Vol. 328 no pp DOI: /science REPORT Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing Jared C. Roach1,*, Gustavo Glusman1,*, Arian F. A. Smit1,*, Chad D. Huff1,2,*, Robert Hubley1, Paul T. Shannon1, Lee Rowen1, Krishna P. Pant3, Nathan Goodman1, Michael Bamshad4, Jay Shendure5, Radoje Drmanac3, Lynn B. Jorde2, Leroy Hood1,, David J. Galas1, Miller syndrome (MIM%263750)

19 ANNOVAR case study: identifying causal genes for Mendelian diseases with recessive inheritance Artificially added in NA18507 variants two known causal mutations for Miller syndrome (G->A mutation at chr16: and G->C mutation at chr16: , representing G152R and G202A in the DHODH gene) Nucleic Acids Res September; 38(16): e164.

20 Keep in mind 1. A one-variant one-phenotype model is rather unlikely 2. Variants in non-protein-coding regions are also important 3. New methods (bioinf and statistical genetics) need to be developed to address this problem

21 Functional prediction of variants What are the factors that may be useful to predict the function of a variant? Translational effect Evolutionary conservation Physico-chemical properties of protein Protein domain

22 Sorting Tolerant From Intolerant (SIFT) algorithm Nature Protocols 4, (2009)

23 Mutation Assessor Reva B et al. Nucl. Acids Res. 2011;nar.gkr407 The Author(s) Published by Oxford University Press.

24 PolyPhen-2 Eight sequence-based and three structure-based predictive features Naïve Bayes posterior probability A mutation is also appraised qualitatively, as benign, possibly damaging, or probably damaging Nat Methods April; 7(4):

25 Nature Methods 7, (2010) Mutation Taster

26 Evolutionary Trace Olivier Lichtarge, BCM

27 How well do they work? Not very well One of the two DHODH variants was predicted as benign by both SIFT and PolyPhen. DHODH would have been missed, had Ng et al. utilized SIFT/PolyPhen predictions in their filtering procedure. In general, these tools lack consensus and results overlap by a small percentage (<30-40%)

28 Predicting driver/passenger mutations in cancer Driver mutation = a mutation that gives a selective advantage to a clone in its microenvironment, through either increasing its survival or reproduction. Driver mutations tend to cause clonal expansions. Passenger mutation = a mutation that has no effect on the fitness of a clone but may be associated with a clonal expansion because it occurs in the same genome with a driver mutation. This is known as a hitchhiker in evolutionary biology. CHASM Cancer-Specific High-Throughput Annotation of Somatic Mutations: Computational Prediction of Driver Missense Mutations. Cancer Res August 15, ; CanPredict Distinguishing cancer-associated missense mutations from common polymorphisms. Cancer Research 67, CanDrA CanDrA: Cancer-Specific Driver Missense Mutation Annotation with Optimized Features

29 CHASM and SNVbox

30 Functional characterization in systems context Loss-of-function (LOF) mutations are the result of gene product having less or no function. Gain-of-function (GOF) mutations change the gene product such that it gains a new and abnormal function. These mutations usually have dominant phenotypes. Dominant negative mutations have an altered gene product that acts antagonistically to the wild-type allele. These mutations usually result in an altered molecular function (often inactive) and are characterized by a dominant or semi-dominant phenotype Lethal mutations are mutations that lead to the death of the organisms which carry the mutations. A back mutation or reversion is a point mutation that restores the original sequence and hence the original phenotype.

31 Mutation spectrum in a population Questions: which ones are GOF? which ones are LOF?

32 Mutation significance Question: among ~20,000 genes, which ones are more important for a disease? Significantly mutated genes (SMG)=Genes that are accumulated significantly more mutations than expected by chance in a population Chance? Background mutation rate Significance? Binomial test Combined P values Software CaMP MutSig MuSiC

33 A case study: Significantly mutated genes in breast and colorectal cancers

34

35 Mutation spectrum

36 Mutation prevalence, drivers/passengers Over 1000 genes were somatically mutated (81% missense mutations) in 22 cell-line samples. Are they all important? Need statistical methods to estimate the probability that the number of mutations in a given gene was greater than expected from the background mutation rate. The cancer mutation prevalence (CaMP) score reflects the probability that the number of mutations actually observed in a gene is higher than that expected to be observed by chance given the background mutation rate

37 CAN-genes and their CaMP scores more in the original article CaMP scores greater than 1.0 => 122 and 69 CAN genes identified in breast and colorectal cancers

38 Each dot represents a gene Heights represent CaMP scores Mountains and hills

39 Mutation significance at gene level

40 Lawrence, TCGA symposium, 2011 Mutation rate/spectrum

41 Quiz Question: A disease has an average random background mutation rate 1e-6 per bp per patient, 3 mutations are observed in a 10,000 bp gene in a patient. Is this gene significantly mutated in this patient? Answer: In R: > 1-ppois(3, * 1e-6) [1] e-10

42 Lawrence, TCGA symposium, 2011 Rate/Spectrum cluster of human cancers

43 Lawrence, TCGA symposium, 2011 Mutation rate and replication timing

44 Mutation rate vs gene expression

45 Lawrence, TCGA symposium, 2011 Estimation of background mutation rate

46 Significantly mutated genes using gene-specific background mutation rate Lawrence, TCGA symposium, 2011

47 Significantly mutated genes across tumor types (TCGA) Lawrence, TCGA symposium, 2011

48 Significantly mutated genes in lung SQCC PS Hammerman et al. Nature 000, 1-7 (2012) doi: / nature11404

49 Most significantly mutated genes in breast cancer as determined by whole-exome sequencing (n =103) S Banerji et al. Nature 486, (2012) doi: /nature11154

50 Netbox: Automated Network Analysis Identifies Core Pathways in Glioblastoma Hypothesis: cellular networks contain functional modules, and that tumors target specific modules critical to their growth Software Netbox Hotnet Pathscan PLoS ONE 5(2): e8918

51 Mutual exclusivity of mutations in pathways Software MEMo Dendrix Genome Res February; 22(2):

52 The cbio Cancer Genomics Portal 2012 by American Association for Cancer Research Cerami E et al. Cancer Discovery 2012;2:

53 Summary Variant detection is becoming straightforward, but variant function is very difficult to predict. Ten fold of reduction in hypothesis space without losing too much sensitivity is achievable. However, the consensus among the existing tools are poor (<30-40%). Unfortunately, functional prediction is an indispensable step towards functionizing genomics due to low-throughput of functional assay, which can only afford to examine most promising hypotheses. Therefore, we need more efforts on bioinformatics/computational biology to handle things quantitatively, systematically, cost-effectively and intelligently, and more synergy between computational and experimental biologists.

Reporting TP53 gene analysis results in CLL

Reporting TP53 gene analysis results in CLL Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review

More information

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA

More information

CITATION FILE CONTENT/FORMAT

CITATION FILE CONTENT/FORMAT CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined

More information

MutationTaster & RegulationSpotter

MutationTaster & RegulationSpotter MutationTaster & RegulationSpotter Pathogenicity Prediction of Sequence Variants: Past, Present and Future Dr. rer. nat. Jana Marie Schwarz Klinik für Pädiatrie m. S. Neurologie Exzellenzcluster NeuroCure

More information

Protein Domain-Centric Approach to Study Cancer Somatic Mutations from High-throughput Sequencing Studies

Protein Domain-Centric Approach to Study Cancer Somatic Mutations from High-throughput Sequencing Studies Protein Domain-Centric Approach to Study Cancer Somatic Mutations from High-throughput Sequencing Studies Dr. Maricel G. Kann Assistant Professor Dept of Biological Sciences UMBC 2 The term protein domain

More information

Concurrent Practical Session ACMG Classification

Concurrent Practical Session ACMG Classification Variant Effect Prediction Training Course 6-8 November 2017 Prague, Czech Republic Concurrent Practical Session ACMG Classification Andreas Laner / Anna Benet-Pagès 1 Content 1. Background... 3 2. Aim

More information

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

Identifying Mutations Responsible for Rare Disorders Using New Technologies

Identifying Mutations Responsible for Rare Disorders Using New Technologies Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Variant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18

Variant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Variant interpretation exercise ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Format of exercise Compile a list of tricky variants across solid cancer and haematological malignancy.

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

Variant Annotation and Functional Prediction

Variant Annotation and Functional Prediction Variant Annotation and Functional Prediction Copyrighted 2018 Isabelle Schrauwen and Suzanne M. Leal This exercise touches on several functionalities of the program ANNOVAR to annotate and interpret candidate

More information

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016 Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases

More information

Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing

Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing www.sciencemag.org/cgi/content/full/science.1186802/dc1 Supporting Online Material for Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing Jared C. Roach, Gustavo Glusman, Arian

More information

Identifying driver mutations in sequenced cancer genomes: computational approaches to enable precision medicine

Identifying driver mutations in sequenced cancer genomes: computational approaches to enable precision medicine Raphael et al. Genome Medicine 2014, 6:5 REVIEW Identifying driver mutations in sequenced cancer genomes: computational approaches to enable precision medicine Benjamin J Raphael 1,2*, Jason R Dobson 1,2,3,

More information

Introduction. Introduction

Introduction. Introduction Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts

More information

THE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS. Pr. Thierry Soussi

THE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS. Pr. Thierry Soussi THE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS Pr. Thierry Soussi thierry.soussi@ki.se thierry.soussi@upmc.fr TP53: 33 YEARS AND COUNTING STRUCTURE FUNCTION RELATIONSHIP OF WILD AND MUTANT TP53 1984

More information

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease

More information

Beta Thalassemia Case Study Introduction to Bioinformatics

Beta Thalassemia Case Study Introduction to Bioinformatics Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha

More information

Variant Detection & Interpretation in a diagnostic context. Christian Gilissen

Variant Detection & Interpretation in a diagnostic context. Christian Gilissen Variant Detection & Interpretation in a diagnostic context Christian Gilissen c.gilissen@gen.umcn.nl 28-05-2013 So far Sequencing Johan den Dunnen Marja Jakobs Ewart de Bruijn Mapping Victor Guryev Variant

More information

Rare Variant Burden Tests. Biostatistics 666

Rare Variant Burden Tests. Biostatistics 666 Rare Variant Burden Tests Biostatistics 666 Last Lecture Analysis of Short Read Sequence Data Low pass sequencing approaches Modeling haplotype sharing between individuals allows accurate variant calls

More information

Finding subtle mutations with the Shannon human mrna splicing pipeline

Finding subtle mutations with the Shannon human mrna splicing pipeline Finding subtle mutations with the Shannon human mrna splicing pipeline Presentation at the CLC bio Medical Genomics Workshop American Society of Human Genetics Annual Meeting November 9, 2012 Peter K Rogan

More information

Lecture 20. Disease Genetics

Lecture 20. Disease Genetics Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE

CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE is_clinical dbsnp MITO GENE chr1 13273 G C heterozygous - - -. - DDX11L1 chr1 949654 A G Homozygous 52 - - rs8997 - ISG15 chr1 1021346 A G heterozygous

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl. GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant

More information

Shashikant Kulkarni, M.S (Medicine)., Ph.D., FACMG Associate Professor of Pathology & Immunology Associate Professor of Pediatrics and Genetics

Shashikant Kulkarni, M.S (Medicine)., Ph.D., FACMG Associate Professor of Pathology & Immunology Associate Professor of Pediatrics and Genetics Shashikant Kulkarni, M.S (Medicine)., Ph.D., FACMG Associate Professor of Pathology & Immunology Associate Professor of Pediatrics and Genetics Director of Cytogenomics and Molecular Pathology Evidence-based

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature13908 Supplementary Tables Supplementary Table 1: Families in this study (.xlsx) All families included in the study are listed. For each family, we show: the genders of the probands and

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Evolutionary Analysis of Genetic Variants Involved in Rare Diseases Sandra Walsh Capdevila

Evolutionary Analysis of Genetic Variants Involved in Rare Diseases Sandra Walsh Capdevila Evolutionary Analysis of Genetic Variants Involved in Rare Diseases Sandra Walsh Capdevila Treball de Fi de Grau Biologia Humana 2009-2013 Supervisor: Ferran Casals López TUTOR AUTHORIZATION En Ferran

More information

Supplementary Figure 1: Classification scheme for non-synonymous and nonsense germline MC1R variants. The common variants with previously established

Supplementary Figure 1: Classification scheme for non-synonymous and nonsense germline MC1R variants. The common variants with previously established Supplementary Figure 1: Classification scheme for nonsynonymous and nonsense germline MC1R variants. The common variants with previously established classifications 1 3 are shown. The effect of novel missense

More information

JULY 21, Genetics 101: SCN1A. Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology

JULY 21, Genetics 101: SCN1A. Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology JULY 21, 2018 Genetics 101: SCN1A Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology Disclosures: I have no financial interests or relationships to disclose. Objectives 1. Review genetic

More information

Clinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues

Clinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues Clinical Genetics Leading the way in genetic issues Functional validation in a diagnostic context Robert Hofstra Clinical Genetics Leading the way in genetic issues Future application of exome sequencing

More information

HBV. Next Generation Sequencing, data analysis and reporting. Presenter Leen-Jan van Doorn

HBV. Next Generation Sequencing, data analysis and reporting. Presenter Leen-Jan van Doorn HBV Next Generation Sequencing, data analysis and reporting Presenter Leen-Jan van Doorn HBV Forum 3 October 24 th, 2017 Marriott Marquis, Washington DC www.forumresearch.org HBV Biomarkers HBV biomarkers:

More information

Bioinformatics Laboratory Exercise

Bioinformatics Laboratory Exercise Bioinformatics Laboratory Exercise Biology is in the midst of the genomics revolution, the application of robotic technology to generate huge amounts of molecular biology data. Genomics has led to an explosion

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

TP53 mutational profile in CLL : A retrospective study of the FILO group.

TP53 mutational profile in CLL : A retrospective study of the FILO group. TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :

More information

Computational Systems Biology: Biology X

Computational Systems Biology: Biology X Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#4:(October-0-4-2010) Cancer and Signals 1 2 1 2 Evidence in Favor Somatic mutations, Aneuploidy, Copy-number changes and LOH

More information

Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines

Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines Tracy Brandt, Ph.D., FACMG Disclosure I am an employee of GeneDx, Inc., a wholly-owned

More information

Introduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015

Introduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Introduction to Cancer Bioinformatics and cancer biology Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Why cancer bioinformatics? Devastating disease, no cure on the horizon Major

More information

David Tamborero, PhD

David Tamborero, PhD David Tamborero, PhD Lopez-Bigas' lab Study of Tumor Genomes Study of Tumor Genomes Study sequencing data of tumors to understand the biological mechanisms shaping the mutational processes observed at

More information

Bio 111 Study Guide Chapter 17 From Gene to Protein

Bio 111 Study Guide Chapter 17 From Gene to Protein Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and

More information

PERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST

PERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST INCLUDED IN THIS REPORT: REVIEW OF YOUR GENETIC INFORMATION RELEVANT TO ENDOMETRIOSIS PERSONAL EDUCATIONAL INFORMATION RELEVANT TO YOUR GENES INFORMATION FOR OBTAINING YOUR ENTIRE X-SCREEN DATA FILE PERSONALIZED

More information

Home Brewed Personalized Genomics

Home Brewed Personalized Genomics Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome

More information

Variant Classification: ACMG recommendations. Andreas Laner MGZ München

Variant Classification: ACMG recommendations. Andreas Laner MGZ München Variant Classification: ACMG recommendations Andreas Laner MGZ München laner@mgz-muenchen.de Overview Introduction ACMG-AMP Classification System Evaluation of inter-laboratory concordance in variant classification

More information

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department

More information

CS2220 Introduction to Computational Biology

CS2220 Introduction to Computational Biology CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS

More information

Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT

Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT GBinsight Sample Name: GB4411 Race: Gender: Female Reason for Testing: Type 2 diabetes, early onset MRN: 0123456789 Specimen: Saliva Received: 07/26/2016 Test ID: 113-1487118782-4 Test: Type 2 Diabetes

More information

Analyzing Genomic Data with PyEnsembl and Varcode. Alex Rubinsteyn SciPy - July 9th, 2015

Analyzing Genomic Data with PyEnsembl and Varcode. Alex Rubinsteyn SciPy - July 9th, 2015 Analyzing Genomic Data with PyEnsembl and Varcode Alex Rubinsteyn SciPy - July 9th, 2015 HammerLab @ Mount Sinai http://www.hammerlab.org/research/ Not biologists! Most lab members have a background in

More information

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

MEDICAL GENOMICS LABORATORY. Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG)

MEDICAL GENOMICS LABORATORY. Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG) Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with

More information

Advances in genetic diagnosis of neurological disorders

Advances in genetic diagnosis of neurological disorders Acta Neurol Scand 2014: 129 (Suppl. 198): 20 25 DOI: 10.1111/ane.12232 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd ACTA NEUROLOGICA SCANDINAVICA Review Article Advances in genetic diagnosis

More information

Using SuSPect to Predict the Phenotypic Effects of Missense Variants. Chris Yates UCL Cancer Institute

Using SuSPect to Predict the Phenotypic Effects of Missense Variants. Chris Yates UCL Cancer Institute Using SuSPect to Predict the Phenotypic Effects of Missense Variants Chris Yates UCL Cancer Institute c.yates@ucl.ac.uk Outline SAVs and Disease Development of SuSPect Features included Feature selection

More information

Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing

Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC.

Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC. Supplementary Figure 1 Rates of different mutation types in CRC. (a) Stratification by mutation type indicates that C>T mutations occur at a significantly greater rate than other types. (b) As for the

More information

Introduction to Genetics

Introduction to Genetics Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist

More information

Bio 312, Spring 2017 Exam 3 ( 1 ) Name:

Bio 312, Spring 2017 Exam 3 ( 1 ) Name: Bio 312, Spring 2017 Exam 3 ( 1 ) Name: Please write the first letter of your last name in the box; 5 points will be deducted if your name is hard to read or the box does not contain the correct letter.

More information

NGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht

NGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht NGS panels in clinical diagnostics: Utrecht experience Van Gijn ME PhD Genome Diagnostics UMCUtrecht 93 Gene panels UMC Utrecht Cardiovascular disease (CAR) (5 panels) Epilepsy (EPI) (11 panels) Hereditary

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Missense damaging predictions as a function of allele frequency

Nature Neuroscience: doi: /nn Supplementary Figure 1. Missense damaging predictions as a function of allele frequency Supplementary Figure 1 Missense damaging predictions as a function of allele frequency Percentage of missense variants classified as damaging by eight different classifiers and a classifier consisting

More information

New Enhancements: GWAS Workflows with SVS

New Enhancements: GWAS Workflows with SVS New Enhancements: GWAS Workflows with SVS August 9 th, 2017 Gabe Rudy VP Product & Engineering 20 most promising Biotech Technology Providers Top 10 Analytics Solution Providers Hype Cycle for Life sciences

More information

6.3 DNA Mutations. SBI4U Ms. Ho-Lau

6.3 DNA Mutations. SBI4U Ms. Ho-Lau 6.3 DNA Mutations SBI4U Ms. Ho-Lau DNA Mutations Gene expression can be affected by errors that occur during DNA replication. Some errors are repaired, but others can become mutations (changes in the nucleotide

More information

ISOWN: accurate somatic mutation identification in the absence of normal tissue controls

ISOWN: accurate somatic mutation identification in the absence of normal tissue controls Kalatskaya et al. Genome Medicine (2017) 9:59 DOI 10.1186/s13073-017-0446-9 SOFTWARE ISOWN: accurate somatic mutation identification in the absence of normal tissue controls Irina Kalatskaya 1*, Quang

More information

Mutational and phenotypical spectrum of phenylalanine hydroxylase deficiency in Denmark

Mutational and phenotypical spectrum of phenylalanine hydroxylase deficiency in Denmark Clin Genet 2016: 90: 247 251 Printed in Singapore. All rights reserved Short Report 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd CLINICAL GENETICS doi: 10.1111/cge.12692 Mutational and

More information

DNA is the genetic material that provides instructions for what our bodies look like and how they function. DNA is packaged into structures called

DNA is the genetic material that provides instructions for what our bodies look like and how they function. DNA is packaged into structures called DNA is the genetic material that provides instructions for what our bodies look like and how they function. DNA is packaged into structures called chromosomes. We have 23 pairs of chromosomes (for a total

More information

Germline Testing for Hereditary Cancer with Multigene Panel

Germline Testing for Hereditary Cancer with Multigene Panel Germline Testing for Hereditary Cancer with Multigene Panel Po-Han Lin, MD Department of Medical Genetics National Taiwan University Hospital 2017-04-20 Disclosure No relevant financial relationships with

More information

Supplementary Information

Supplementary Information 1 Supplementary Information MATERIALS AND METHODS Study subjects Exome-sequenced HBOC patients Clinical characteristics of 24 exome-sequenced HBOC patients are presented in Table 1. Table 1. Clinical characteristics

More information

Leveraging the Exome Sequencing Project: Creating a WHI Resource Through Exome Imputation in SHARe. Chris Carlson on behalf of WHISP May 5, 2011

Leveraging the Exome Sequencing Project: Creating a WHI Resource Through Exome Imputation in SHARe. Chris Carlson on behalf of WHISP May 5, 2011 Leveraging the Exome Sequencing Project: Creating a WHI Resource Through Exome Imputation in SHARe Chris Carlson on behalf of WHISP May 5, 2011 Exome Sequencing Project (ESP) Three cohort-based groups

More information

Molecular Characterization of the NF2 Gene in Korean Patients with Neurofibromatosis Type 2: A Report of Four Novel Mutations

Molecular Characterization of the NF2 Gene in Korean Patients with Neurofibromatosis Type 2: A Report of Four Novel Mutations Korean J Lab Med 2010;30:190-4 DOI 10.3343/kjlm.2010.30.2.190 Original Article Diagnostic Genetics Molecular Characterization of the NF2 Gene in Korean Patients with Neurofibromatosis Type 2: A Report

More information

Genetics Mutations 2 Teacher s Guide

Genetics Mutations 2 Teacher s Guide Genetics Mutations 2 Teacher s Guide 1.0 Summary Mutations II is an extension activity, which reviews and enhances the previous Core activities. We recommend that it follow Mutations and X-Linkage. This

More information

Tumor suppressor genes D R. S H O S S E I N I - A S L

Tumor suppressor genes D R. S H O S S E I N I - A S L Tumor suppressor genes 1 D R. S H O S S E I N I - A S L What is a Tumor Suppressor Gene? 2 A tumor suppressor gene is a type of cancer gene that is created by loss-of function mutations. In contrast to

More information

How many disease-causing variants in a normal person? Matthew Hurles

How many disease-causing variants in a normal person? Matthew Hurles How many disease-causing variants in a normal person? Matthew Hurles Summary What is in a genome? What is normal? Depends on age What is a disease-causing variant? Different classes of variation Final

More information

Variant Classification: ACMG recommendations. Andreas Laner MGZ München

Variant Classification: ACMG recommendations. Andreas Laner MGZ München Variant Classification: ACMG recommendations Andreas Laner MGZ München laner@mgz-muenchen.de OVERVIEW Introduction ACMG-AMP Classification System Evaluation of inter-laboratory concordance in variant classification

More information

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet

Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet All cancer is due to genetic mutations. However, in cancer that clusters in families (familial cancer) at least one of these mutations

More information

The Molecular Evolution of Gene Birth and Death. Author: Ann Brokaw AP Biology Teacher Rocky River High School Rocky River, Ohio

The Molecular Evolution of Gene Birth and Death. Author: Ann Brokaw AP Biology Teacher Rocky River High School Rocky River, Ohio The Molecular Evolution of Gene Birth and Death Author: Ann Brokaw AP Biology Teacher Rocky River High School Rocky River, Ohio The Birth and Death of Genes To the student: The following slides provide

More information

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin

More information

38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16

38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 PGAR: ASD Candidate Gene Prioritization System Using Expression Patterns Steven Cogill and Liangjiang Wang Department of Genetics and

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20

More information

Cancer troublemakers: a tale of usual suspects and novel villains

Cancer troublemakers: a tale of usual suspects and novel villains Cancer troublemakers: a tale of usual suspects and novel villains Abel González-Pérez and Núria López-Bigas Biomedical Genomics Group Lab web: http://bg.upf.edu Driver genes/mutations: the troublemakers

More information

Whole exome sequencing identifies a novel DFNA9 mutation, C162Y

Whole exome sequencing identifies a novel DFNA9 mutation, C162Y Clin Genet 2013: 83: 477 481 Printed in Singapore. All rights reserved Short Report 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd CLINICAL GENETICS doi: 10.1111/cge.12006 Whole exome

More information

5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?

5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits? corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or

More information

variant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still

variant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still 157 Neurological disorders primarily affect and impair the functioning of the brain and/or neurological system. Structural, electrical or metabolic abnormalities in the brain or neurological system can

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences

More information

De novo mutational profile in RB1 clarified using a mutation rate modeling algorithm

De novo mutational profile in RB1 clarified using a mutation rate modeling algorithm Aggarwala et al. BMC Genomics (2017) 18:155 DOI 10.1186/s12864-017-3522-z RESEARCH ARTICLE Open Access De novo mutational profile in RB1 clarified using a mutation rate modeling algorithm Varun Aggarwala

More information

MEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)

MEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;

More information

Predicting the Functional Consequences of Cancer-Associated Amino Acid Substitutions

Predicting the Functional Consequences of Cancer-Associated Amino Acid Substitutions Bioinformatics Advance Access published April 25, 2013 Sequence Analysis Predicting the Functional Consequences of Cancer-Associated Amino Acid Substitutions Hashem A. Shihab 1, Julian Gough 2, David N.

More information

TADA: Analyzing De Novo, Transmission and Case-Control Sequencing Data

TADA: Analyzing De Novo, Transmission and Case-Control Sequencing Data TADA: Analyzing De Novo, Transmission and Case-Control Sequencing Data Each person inherits mutations from parents, some of which may predispose the person to certain diseases. Meanwhile, new mutations

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

Lecture: Variability. Different types of variability in Biology and Medicine. Cytological essentials of heritable diseases. Plan of the lecture

Lecture: Variability. Different types of variability in Biology and Medicine. Cytological essentials of heritable diseases. Plan of the lecture Lecture: Variability. Different types of variability in Biology and Medicine. Cytological essentials of heritable diseases Plan of the lecture 1. Notion of variability. Different types of variability.

More information

A guide to understanding variant classification

A guide to understanding variant classification White paper A guide to understanding variant classification In a diagnostic setting, variant classification forms the basis for clinical judgment, making proper classification of variants critical to your

More information