Functional analysis of DNA variants
|
|
- Brice Snow
- 5 years ago
- Views:
Transcription
1 Functional analysis of DNA variants GS011143, Introduction to Bioinformatics The University of Texas GSBS program, Fall 2012 Ken Chen, Ph.D. Department of Bioinformatics and Computational Biology UT MD Anderson Cancer Center
2 Outline Lecture (1-1.5 hour) Variant annotation and functional prediction (50-60m) Break (5m) Sequence assembly (30m) Lab (30m) Variant annotation using variant effect predictor Variant annotation using Annovar NGS assembly using Velvet
3 Personalized medicine. Fernald G H et al. Bioinformatics 2011;27: The Author(s) Published by Oxford University Press.
4 Number of validated human SNPs in dbsnp overtime. Fernald G H et al. Bioinformatics 2011;27: The Author(s) Published by Oxford University Press.
5 What can we learn from variants/mutations? From individual variants Translational effect Prevalence/frequency in a population Evolutionary conservation Driver/Passenger From groups of variants (e.g. from whole genome sequencing of a population) Background mutation rate Mutation spectrum Significantly mutated genes/pathways
6 Nucleic Acids Res September; 38(16): e164 Translational effect of a variant
7 Translational effect of a variant Missense - a point mutation in which a single nucleotide is changed, resulting in a codon that codes for a different amino acid Nonsense Silent - a point mutation in a sequence of DNA that results in a premature stop codon - DNA mutations that do not result in a change to the amino acid sequence of a protein, or that do result in amino acid change but do not result in radically different properties of the changed amino acids Synonymous - A substitution in an exon that the does not alter the amino acid sequence Frameshift - A genetic mutation caused by indels (insertions or deletions) of a number of nucleotides that is not evenly divisible by three from a DNA sequence
8 DNA variants in protein coding regions Nucleic Acids Res September; 38(16): e164
9 TCGA MAF variant effect specification Frame_Shift_Del, Frame_Shift_Ins, In_Frame_Del, In_Frame_Ins, Missense_Mutation, Nonsense_Mutation, Silent, Splice_Site, Translation_Start_Site, Nonstop_Mutation, 3'UTR, 3'Flank, 5'UTR, 5'Flank, IGR, Intron, RNA, Targeted_Region De_novo_Start_InFrame, De_novo_Start_OutOfFrame
10 Nomenclature for the description of sequence variants HGVS identifier Describing genes / proteins, only official HGNC gene symbols should be used A letter indicating the type of reference sequence used - "c." for a coding DNA sequence (like c.76a>t) - "g." for a genomic sequence (like g.476a>t) - "m." for a mitochondrial sequence (like m.8993t>c) - "r." for an RNA sequence (like r.76a>u) - "p." for a protein sequence (like p.lys76asn) Reference position where the variant occurs Integers Specific changes - ">" indicates a substitution at DNA level (like c.76a>t) - "_" (underscore) indicates a range of affected residues, separating the first and last residue affected (like c.76_78delact) - "del" indicates a deletion (like c.76dela)
11 Quiz: An example HGVS identifier NOD2:NM_022162:exon4:p.R702W What does it represent? HUGO gene names NCBI Refseq database
12 RefSeq accession numbers and molecule types
13 Variant annotation software ANNOVAR Variant effect predictor
14 ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data Input Standard format of ANNOVAR input file VCF4 genotype calling format Samtools genotype-calling pileup format Complete Genomics genotype calling format GFF3-SOLiD format SOAPsnp format MAQ genotype calling format CASAVA genotype calling format Nucleic Acids Res September; 38(16): e164.
15 ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data Output Nucleic Acids Res September; 38(16): e164.
16 Variant effect predictor (VEP)
17 Variant effect predictor (VEP)
18 Case study: identifying causal genes for Mendelian diseases with recessive inheritance Exome sequencing identifies the cause of a mendelian disorder. Ng SB, Buckingham KJ, Lee C, Bigham AW, Tabor HK, Dent KM, Huff CD, Shannon PT, Jabs EW, Nickerson DA, Shendure J, Bamshad MJ Nat Genet Jan; 42(1):30-5. Published Online March Science 30 April 2010: Vol. 328 no pp DOI: /science REPORT Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing Jared C. Roach1,*, Gustavo Glusman1,*, Arian F. A. Smit1,*, Chad D. Huff1,2,*, Robert Hubley1, Paul T. Shannon1, Lee Rowen1, Krishna P. Pant3, Nathan Goodman1, Michael Bamshad4, Jay Shendure5, Radoje Drmanac3, Lynn B. Jorde2, Leroy Hood1,, David J. Galas1, Miller syndrome (MIM%263750)
19 ANNOVAR case study: identifying causal genes for Mendelian diseases with recessive inheritance Artificially added in NA18507 variants two known causal mutations for Miller syndrome (G->A mutation at chr16: and G->C mutation at chr16: , representing G152R and G202A in the DHODH gene) Nucleic Acids Res September; 38(16): e164.
20 Keep in mind 1. A one-variant one-phenotype model is rather unlikely 2. Variants in non-protein-coding regions are also important 3. New methods (bioinf and statistical genetics) need to be developed to address this problem
21 Functional prediction of variants What are the factors that may be useful to predict the function of a variant? Translational effect Evolutionary conservation Physico-chemical properties of protein Protein domain
22 Sorting Tolerant From Intolerant (SIFT) algorithm Nature Protocols 4, (2009)
23 Mutation Assessor Reva B et al. Nucl. Acids Res. 2011;nar.gkr407 The Author(s) Published by Oxford University Press.
24 PolyPhen-2 Eight sequence-based and three structure-based predictive features Naïve Bayes posterior probability A mutation is also appraised qualitatively, as benign, possibly damaging, or probably damaging Nat Methods April; 7(4):
25 Nature Methods 7, (2010) Mutation Taster
26 Evolutionary Trace Olivier Lichtarge, BCM
27 How well do they work? Not very well One of the two DHODH variants was predicted as benign by both SIFT and PolyPhen. DHODH would have been missed, had Ng et al. utilized SIFT/PolyPhen predictions in their filtering procedure. In general, these tools lack consensus and results overlap by a small percentage (<30-40%)
28 Predicting driver/passenger mutations in cancer Driver mutation = a mutation that gives a selective advantage to a clone in its microenvironment, through either increasing its survival or reproduction. Driver mutations tend to cause clonal expansions. Passenger mutation = a mutation that has no effect on the fitness of a clone but may be associated with a clonal expansion because it occurs in the same genome with a driver mutation. This is known as a hitchhiker in evolutionary biology. CHASM Cancer-Specific High-Throughput Annotation of Somatic Mutations: Computational Prediction of Driver Missense Mutations. Cancer Res August 15, ; CanPredict Distinguishing cancer-associated missense mutations from common polymorphisms. Cancer Research 67, CanDrA CanDrA: Cancer-Specific Driver Missense Mutation Annotation with Optimized Features
29 CHASM and SNVbox
30 Functional characterization in systems context Loss-of-function (LOF) mutations are the result of gene product having less or no function. Gain-of-function (GOF) mutations change the gene product such that it gains a new and abnormal function. These mutations usually have dominant phenotypes. Dominant negative mutations have an altered gene product that acts antagonistically to the wild-type allele. These mutations usually result in an altered molecular function (often inactive) and are characterized by a dominant or semi-dominant phenotype Lethal mutations are mutations that lead to the death of the organisms which carry the mutations. A back mutation or reversion is a point mutation that restores the original sequence and hence the original phenotype.
31 Mutation spectrum in a population Questions: which ones are GOF? which ones are LOF?
32 Mutation significance Question: among ~20,000 genes, which ones are more important for a disease? Significantly mutated genes (SMG)=Genes that are accumulated significantly more mutations than expected by chance in a population Chance? Background mutation rate Significance? Binomial test Combined P values Software CaMP MutSig MuSiC
33 A case study: Significantly mutated genes in breast and colorectal cancers
34
35 Mutation spectrum
36 Mutation prevalence, drivers/passengers Over 1000 genes were somatically mutated (81% missense mutations) in 22 cell-line samples. Are they all important? Need statistical methods to estimate the probability that the number of mutations in a given gene was greater than expected from the background mutation rate. The cancer mutation prevalence (CaMP) score reflects the probability that the number of mutations actually observed in a gene is higher than that expected to be observed by chance given the background mutation rate
37 CAN-genes and their CaMP scores more in the original article CaMP scores greater than 1.0 => 122 and 69 CAN genes identified in breast and colorectal cancers
38 Each dot represents a gene Heights represent CaMP scores Mountains and hills
39 Mutation significance at gene level
40 Lawrence, TCGA symposium, 2011 Mutation rate/spectrum
41 Quiz Question: A disease has an average random background mutation rate 1e-6 per bp per patient, 3 mutations are observed in a 10,000 bp gene in a patient. Is this gene significantly mutated in this patient? Answer: In R: > 1-ppois(3, * 1e-6) [1] e-10
42 Lawrence, TCGA symposium, 2011 Rate/Spectrum cluster of human cancers
43 Lawrence, TCGA symposium, 2011 Mutation rate and replication timing
44 Mutation rate vs gene expression
45 Lawrence, TCGA symposium, 2011 Estimation of background mutation rate
46 Significantly mutated genes using gene-specific background mutation rate Lawrence, TCGA symposium, 2011
47 Significantly mutated genes across tumor types (TCGA) Lawrence, TCGA symposium, 2011
48 Significantly mutated genes in lung SQCC PS Hammerman et al. Nature 000, 1-7 (2012) doi: / nature11404
49 Most significantly mutated genes in breast cancer as determined by whole-exome sequencing (n =103) S Banerji et al. Nature 486, (2012) doi: /nature11154
50 Netbox: Automated Network Analysis Identifies Core Pathways in Glioblastoma Hypothesis: cellular networks contain functional modules, and that tumors target specific modules critical to their growth Software Netbox Hotnet Pathscan PLoS ONE 5(2): e8918
51 Mutual exclusivity of mutations in pathways Software MEMo Dendrix Genome Res February; 22(2):
52 The cbio Cancer Genomics Portal 2012 by American Association for Cancer Research Cerami E et al. Cancer Discovery 2012;2:
53 Summary Variant detection is becoming straightforward, but variant function is very difficult to predict. Ten fold of reduction in hypothesis space without losing too much sensitivity is achievable. However, the consensus among the existing tools are poor (<30-40%). Unfortunately, functional prediction is an indispensable step towards functionizing genomics due to low-throughput of functional assay, which can only afford to examine most promising hypotheses. Therefore, we need more efforts on bioinformatics/computational biology to handle things quantitatively, systematically, cost-effectively and intelligently, and more synergy between computational and experimental biologists.
Reporting TP53 gene analysis results in CLL
Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review
More information6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels
Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA
More informationCITATION FILE CONTENT/FORMAT
CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined
More informationMutationTaster & RegulationSpotter
MutationTaster & RegulationSpotter Pathogenicity Prediction of Sequence Variants: Past, Present and Future Dr. rer. nat. Jana Marie Schwarz Klinik für Pädiatrie m. S. Neurologie Exzellenzcluster NeuroCure
More informationProtein Domain-Centric Approach to Study Cancer Somatic Mutations from High-throughput Sequencing Studies
Protein Domain-Centric Approach to Study Cancer Somatic Mutations from High-throughput Sequencing Studies Dr. Maricel G. Kann Assistant Professor Dept of Biological Sciences UMBC 2 The term protein domain
More informationConcurrent Practical Session ACMG Classification
Variant Effect Prediction Training Course 6-8 November 2017 Prague, Czech Republic Concurrent Practical Session ACMG Classification Andreas Laner / Anna Benet-Pagès 1 Content 1. Background... 3 2. Aim
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationIdentifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationVariant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18
Variant interpretation exercise ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Format of exercise Compile a list of tricky variants across solid cancer and haematological malignancy.
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationVariant Annotation and Functional Prediction
Variant Annotation and Functional Prediction Copyrighted 2018 Isabelle Schrauwen and Suzanne M. Leal This exercise touches on several functionalities of the program ANNOVAR to annotate and interpret candidate
More informationIntroduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
More informationAnalysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing
www.sciencemag.org/cgi/content/full/science.1186802/dc1 Supporting Online Material for Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing Jared C. Roach, Gustavo Glusman, Arian
More informationIdentifying driver mutations in sequenced cancer genomes: computational approaches to enable precision medicine
Raphael et al. Genome Medicine 2014, 6:5 REVIEW Identifying driver mutations in sequenced cancer genomes: computational approaches to enable precision medicine Benjamin J Raphael 1,2*, Jason R Dobson 1,2,3,
More informationIntroduction. Introduction
Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts
More informationTHE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS. Pr. Thierry Soussi
THE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS Pr. Thierry Soussi thierry.soussi@ki.se thierry.soussi@upmc.fr TP53: 33 YEARS AND COUNTING STRUCTURE FUNCTION RELATIONSHIP OF WILD AND MUTANT TP53 1984
More informationWelcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm
Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease
More informationBeta Thalassemia Case Study Introduction to Bioinformatics
Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha
More informationVariant Detection & Interpretation in a diagnostic context. Christian Gilissen
Variant Detection & Interpretation in a diagnostic context Christian Gilissen c.gilissen@gen.umcn.nl 28-05-2013 So far Sequencing Johan den Dunnen Marja Jakobs Ewart de Bruijn Mapping Victor Guryev Variant
More informationRare Variant Burden Tests. Biostatistics 666
Rare Variant Burden Tests Biostatistics 666 Last Lecture Analysis of Short Read Sequence Data Low pass sequencing approaches Modeling haplotype sharing between individuals allows accurate variant calls
More informationFinding subtle mutations with the Shannon human mrna splicing pipeline
Finding subtle mutations with the Shannon human mrna splicing pipeline Presentation at the CLC bio Medical Genomics Workshop American Society of Human Genetics Annual Meeting November 9, 2012 Peter K Rogan
More informationLecture 20. Disease Genetics
Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationCHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE
CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE is_clinical dbsnp MITO GENE chr1 13273 G C heterozygous - - -. - DDX11L1 chr1 949654 A G Homozygous 52 - - rs8997 - ISG15 chr1 1021346 A G heterozygous
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationGenome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.
GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant
More informationShashikant Kulkarni, M.S (Medicine)., Ph.D., FACMG Associate Professor of Pathology & Immunology Associate Professor of Pediatrics and Genetics
Shashikant Kulkarni, M.S (Medicine)., Ph.D., FACMG Associate Professor of Pathology & Immunology Associate Professor of Pediatrics and Genetics Director of Cytogenomics and Molecular Pathology Evidence-based
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature13908 Supplementary Tables Supplementary Table 1: Families in this study (.xlsx) All families included in the study are listed. For each family, we show: the genders of the probands and
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationEvolutionary Analysis of Genetic Variants Involved in Rare Diseases Sandra Walsh Capdevila
Evolutionary Analysis of Genetic Variants Involved in Rare Diseases Sandra Walsh Capdevila Treball de Fi de Grau Biologia Humana 2009-2013 Supervisor: Ferran Casals López TUTOR AUTHORIZATION En Ferran
More informationSupplementary Figure 1: Classification scheme for non-synonymous and nonsense germline MC1R variants. The common variants with previously established
Supplementary Figure 1: Classification scheme for nonsynonymous and nonsense germline MC1R variants. The common variants with previously established classifications 1 3 are shown. The effect of novel missense
More informationJULY 21, Genetics 101: SCN1A. Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology
JULY 21, 2018 Genetics 101: SCN1A Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology Disclosures: I have no financial interests or relationships to disclose. Objectives 1. Review genetic
More informationClinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues
Clinical Genetics Leading the way in genetic issues Functional validation in a diagnostic context Robert Hofstra Clinical Genetics Leading the way in genetic issues Future application of exome sequencing
More informationHBV. Next Generation Sequencing, data analysis and reporting. Presenter Leen-Jan van Doorn
HBV Next Generation Sequencing, data analysis and reporting Presenter Leen-Jan van Doorn HBV Forum 3 October 24 th, 2017 Marriott Marquis, Washington DC www.forumresearch.org HBV Biomarkers HBV biomarkers:
More informationBioinformatics Laboratory Exercise
Bioinformatics Laboratory Exercise Biology is in the midst of the genomics revolution, the application of robotic technology to generate huge amounts of molecular biology data. Genomics has led to an explosion
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationTP53 mutational profile in CLL : A retrospective study of the FILO group.
TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :
More informationComputational Systems Biology: Biology X
Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#4:(October-0-4-2010) Cancer and Signals 1 2 1 2 Evidence in Favor Somatic mutations, Aneuploidy, Copy-number changes and LOH
More informationMerging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines
Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines Tracy Brandt, Ph.D., FACMG Disclosure I am an employee of GeneDx, Inc., a wholly-owned
More informationIntroduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015
Introduction to Cancer Bioinformatics and cancer biology Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Why cancer bioinformatics? Devastating disease, no cure on the horizon Major
More informationDavid Tamborero, PhD
David Tamborero, PhD Lopez-Bigas' lab Study of Tumor Genomes Study of Tumor Genomes Study sequencing data of tumors to understand the biological mechanisms shaping the mutational processes observed at
More informationBio 111 Study Guide Chapter 17 From Gene to Protein
Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and
More informationPERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST
INCLUDED IN THIS REPORT: REVIEW OF YOUR GENETIC INFORMATION RELEVANT TO ENDOMETRIOSIS PERSONAL EDUCATIONAL INFORMATION RELEVANT TO YOUR GENES INFORMATION FOR OBTAINING YOUR ENTIRE X-SCREEN DATA FILE PERSONALIZED
More informationHome Brewed Personalized Genomics
Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome
More informationVariant Classification: ACMG recommendations. Andreas Laner MGZ München
Variant Classification: ACMG recommendations Andreas Laner MGZ München laner@mgz-muenchen.de Overview Introduction ACMG-AMP Classification System Evaluation of inter-laboratory concordance in variant classification
More informationNGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
More informationCS2220 Introduction to Computational Biology
CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS
More informationGenetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT
GBinsight Sample Name: GB4411 Race: Gender: Female Reason for Testing: Type 2 diabetes, early onset MRN: 0123456789 Specimen: Saliva Received: 07/26/2016 Test ID: 113-1487118782-4 Test: Type 2 Diabetes
More informationAnalyzing Genomic Data with PyEnsembl and Varcode. Alex Rubinsteyn SciPy - July 9th, 2015
Analyzing Genomic Data with PyEnsembl and Varcode Alex Rubinsteyn SciPy - July 9th, 2015 HammerLab @ Mount Sinai http://www.hammerlab.org/research/ Not biologists! Most lab members have a background in
More informationUsing the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationMEDICAL GENOMICS LABORATORY. Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG)
Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with
More informationAdvances in genetic diagnosis of neurological disorders
Acta Neurol Scand 2014: 129 (Suppl. 198): 20 25 DOI: 10.1111/ane.12232 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd ACTA NEUROLOGICA SCANDINAVICA Review Article Advances in genetic diagnosis
More informationUsing SuSPect to Predict the Phenotypic Effects of Missense Variants. Chris Yates UCL Cancer Institute
Using SuSPect to Predict the Phenotypic Effects of Missense Variants Chris Yates UCL Cancer Institute c.yates@ucl.ac.uk Outline SAVs and Disease Development of SuSPect Features included Feature selection
More informationAssessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing
Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical
More informationNature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC.
Supplementary Figure 1 Rates of different mutation types in CRC. (a) Stratification by mutation type indicates that C>T mutations occur at a significantly greater rate than other types. (b) As for the
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationBio 312, Spring 2017 Exam 3 ( 1 ) Name:
Bio 312, Spring 2017 Exam 3 ( 1 ) Name: Please write the first letter of your last name in the box; 5 points will be deducted if your name is hard to read or the box does not contain the correct letter.
More informationNGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht
NGS panels in clinical diagnostics: Utrecht experience Van Gijn ME PhD Genome Diagnostics UMCUtrecht 93 Gene panels UMC Utrecht Cardiovascular disease (CAR) (5 panels) Epilepsy (EPI) (11 panels) Hereditary
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Missense damaging predictions as a function of allele frequency
Supplementary Figure 1 Missense damaging predictions as a function of allele frequency Percentage of missense variants classified as damaging by eight different classifiers and a classifier consisting
More informationNew Enhancements: GWAS Workflows with SVS
New Enhancements: GWAS Workflows with SVS August 9 th, 2017 Gabe Rudy VP Product & Engineering 20 most promising Biotech Technology Providers Top 10 Analytics Solution Providers Hype Cycle for Life sciences
More information6.3 DNA Mutations. SBI4U Ms. Ho-Lau
6.3 DNA Mutations SBI4U Ms. Ho-Lau DNA Mutations Gene expression can be affected by errors that occur during DNA replication. Some errors are repaired, but others can become mutations (changes in the nucleotide
More informationISOWN: accurate somatic mutation identification in the absence of normal tissue controls
Kalatskaya et al. Genome Medicine (2017) 9:59 DOI 10.1186/s13073-017-0446-9 SOFTWARE ISOWN: accurate somatic mutation identification in the absence of normal tissue controls Irina Kalatskaya 1*, Quang
More informationMutational and phenotypical spectrum of phenylalanine hydroxylase deficiency in Denmark
Clin Genet 2016: 90: 247 251 Printed in Singapore. All rights reserved Short Report 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd CLINICAL GENETICS doi: 10.1111/cge.12692 Mutational and
More informationDNA is the genetic material that provides instructions for what our bodies look like and how they function. DNA is packaged into structures called
DNA is the genetic material that provides instructions for what our bodies look like and how they function. DNA is packaged into structures called chromosomes. We have 23 pairs of chromosomes (for a total
More informationGermline Testing for Hereditary Cancer with Multigene Panel
Germline Testing for Hereditary Cancer with Multigene Panel Po-Han Lin, MD Department of Medical Genetics National Taiwan University Hospital 2017-04-20 Disclosure No relevant financial relationships with
More informationSupplementary Information
1 Supplementary Information MATERIALS AND METHODS Study subjects Exome-sequenced HBOC patients Clinical characteristics of 24 exome-sequenced HBOC patients are presented in Table 1. Table 1. Clinical characteristics
More informationLeveraging the Exome Sequencing Project: Creating a WHI Resource Through Exome Imputation in SHARe. Chris Carlson on behalf of WHISP May 5, 2011
Leveraging the Exome Sequencing Project: Creating a WHI Resource Through Exome Imputation in SHARe Chris Carlson on behalf of WHISP May 5, 2011 Exome Sequencing Project (ESP) Three cohort-based groups
More informationMolecular Characterization of the NF2 Gene in Korean Patients with Neurofibromatosis Type 2: A Report of Four Novel Mutations
Korean J Lab Med 2010;30:190-4 DOI 10.3343/kjlm.2010.30.2.190 Original Article Diagnostic Genetics Molecular Characterization of the NF2 Gene in Korean Patients with Neurofibromatosis Type 2: A Report
More informationGenetics Mutations 2 Teacher s Guide
Genetics Mutations 2 Teacher s Guide 1.0 Summary Mutations II is an extension activity, which reviews and enhances the previous Core activities. We recommend that it follow Mutations and X-Linkage. This
More informationTumor suppressor genes D R. S H O S S E I N I - A S L
Tumor suppressor genes 1 D R. S H O S S E I N I - A S L What is a Tumor Suppressor Gene? 2 A tumor suppressor gene is a type of cancer gene that is created by loss-of function mutations. In contrast to
More informationHow many disease-causing variants in a normal person? Matthew Hurles
How many disease-causing variants in a normal person? Matthew Hurles Summary What is in a genome? What is normal? Depends on age What is a disease-causing variant? Different classes of variation Final
More informationVariant Classification: ACMG recommendations. Andreas Laner MGZ München
Variant Classification: ACMG recommendations Andreas Laner MGZ München laner@mgz-muenchen.de OVERVIEW Introduction ACMG-AMP Classification System Evaluation of inter-laboratory concordance in variant classification
More informationNEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca
NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationGenome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet
Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet All cancer is due to genetic mutations. However, in cancer that clusters in families (familial cancer) at least one of these mutations
More informationThe Molecular Evolution of Gene Birth and Death. Author: Ann Brokaw AP Biology Teacher Rocky River High School Rocky River, Ohio
The Molecular Evolution of Gene Birth and Death Author: Ann Brokaw AP Biology Teacher Rocky River High School Rocky River, Ohio The Birth and Death of Genes To the student: The following slides provide
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More information38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16
38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 PGAR: ASD Candidate Gene Prioritization System Using Expression Patterns Steven Cogill and Liangjiang Wang Department of Genetics and
More informationSession 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20
More informationCancer troublemakers: a tale of usual suspects and novel villains
Cancer troublemakers: a tale of usual suspects and novel villains Abel González-Pérez and Núria López-Bigas Biomedical Genomics Group Lab web: http://bg.upf.edu Driver genes/mutations: the troublemakers
More informationWhole exome sequencing identifies a novel DFNA9 mutation, C162Y
Clin Genet 2013: 83: 477 481 Printed in Singapore. All rights reserved Short Report 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd CLINICAL GENETICS doi: 10.1111/cge.12006 Whole exome
More information5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?
corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or
More informationvariant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still
157 Neurological disorders primarily affect and impair the functioning of the brain and/or neurological system. Structural, electrical or metabolic abnormalities in the brain or neurological system can
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationCRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
More informationDe novo mutational profile in RB1 clarified using a mutation rate modeling algorithm
Aggarwala et al. BMC Genomics (2017) 18:155 DOI 10.1186/s12864-017-3522-z RESEARCH ARTICLE Open Access De novo mutational profile in RB1 clarified using a mutation rate modeling algorithm Varun Aggarwala
More informationMEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)
Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;
More informationPredicting the Functional Consequences of Cancer-Associated Amino Acid Substitutions
Bioinformatics Advance Access published April 25, 2013 Sequence Analysis Predicting the Functional Consequences of Cancer-Associated Amino Acid Substitutions Hashem A. Shihab 1, Julian Gough 2, David N.
More informationTADA: Analyzing De Novo, Transmission and Case-Control Sequencing Data
TADA: Analyzing De Novo, Transmission and Case-Control Sequencing Data Each person inherits mutations from parents, some of which may predispose the person to certain diseases. Meanwhile, new mutations
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationLecture: Variability. Different types of variability in Biology and Medicine. Cytological essentials of heritable diseases. Plan of the lecture
Lecture: Variability. Different types of variability in Biology and Medicine. Cytological essentials of heritable diseases Plan of the lecture 1. Notion of variability. Different types of variability.
More informationA guide to understanding variant classification
White paper A guide to understanding variant classification In a diagnostic setting, variant classification forms the basis for clinical judgment, making proper classification of variants critical to your
More information