IJC International Journal of Cancer

Transcription

1 IJC International Journal of Cancer mir-181b modulates multidrug resistance by targeting BCL2 in human cancer cell lines Wei Zhu 1, Xia Shan 2, Tongshan Wang 1, Yongqian Shu 1,3 and Ping Liu 1,3 1 Department of Oncology, First Affiliated Hospital of Nanjing Medical University, Nanjing, China 2 Cancer Center of Nanjing Medical University, Nanjing, China 3 The Fourth Class of the Combined Bachelor s/master s Degree Program of Clinic Medicine, First Clinical Medical College of Nanjing Medical University, Nanjing, China MicroRNAs (mirnas) are short noncoding RNA molecules, which posttranscriptionally regulate genes expression and play crucial roles in diverse biological processes, such as development, differentiation, apoptosis and proliferation. Here, we investigated the possible role of mirnas in the development of multidrug resistance (MDR) in human gastric and lung cancer cell lines. We found that mir-181b was downregulated in both multidrug-resistant human gastric cancer cell line SGC7901/ vincristine (VCR) and multidrug-resistant human lung cancer cell line A549/cisplatin (CDDP), and the downregulation of mir- 181b in SGC7901/VCR and A549/CDDP cells was concurrent with the upregulation of BCL2 protein, compared with the parental SGC7901 and A549 cell lines, respectively. In vitro drug sensitivity assay demonstrated that overexpression of mir-181b sensitized SGC7901/VCR and A549/CDDP cells to anticancer drugs, respectively. The luciferase activity of a BCL untranslated region-based reporter construct in SGC7901/VCR and A549/CDDP cells suggests that a new target site in the 3 0 UTR of BCL2 of the mature mir-181s (mir-181a, mir-181b, mir-181c and mir-181d) was found. Enforced mir-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively. Taken together, our findings suggest that mir-181b could play a role in the development of MDR in both gastric and lung cancer cell lines, at least in part, by modulation of apoptosis via targeting BCL2. Multidrug resistance (MDR) constitutes a major obstacle to successful chemotherapy in cancer patients. In many cases, chemotherapies fail because of MDR of cancer cells either intrinsic or acquired after an initial round of treatment. 1 Accumulating studies indicate that there are 3 major mechanisms of drug resistance in cells: first, decreased uptake of watersoluble drugs; second, various changes in cells that affect the capacity of cytotoxic drugs to kill cells, including alterations in Key words: microrna, mir-181b, human cancer, multidrug resistance, BCL2 Abbreviations: 5-FU: 5-fluorouracil; ADR: adriamycin; CDDP: cisplatin; MDR: multidrug resistance; mirnas: micrornas; MMC: mitomycin C; VCR: vincristine; VP-16: etoposide Additional Supporting Information may be found in the online version of this article Wei Zhu and Xia Shan contributed equally to this work Grant sponsor: National Natural Science Foundation of China; Grant number: ; Grant sponsor: Cancer Center of Nanjing Medical University; Grant number: 08ZLKF02 DOI: /ijc History: Received 11 Dec 2009; Accepted 2 Feb 2010; Online 16 Feb 2010 Correspondence to: Ping Liu, Department of Oncology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing , China, Tel.: þ , Fax: þ , liu-ping@csco.org.cn (or) belliwether@ 163.com cell cycle, enhanced DNA repair activity, defective apoptosis pathway, altered metabolism of drugs, etc. 2 4 ; third, increased energy-dependent efflux of hydrophobic drugs, represented by overexpression of a family of energy-dependent transporters, known as ATP-binding cassette transporters, such as P-glycoprotein (Pgp), breast cancer resistance protein, etc. 5 Micro- RNAs (mirnas) are short noncoding RNA molecules, which posttranscriptionally regulate genes expression and play crucial roles in diverse biological processes, such as development, differentiation, apoptosis and proliferation. 6 9 For instance, Si et al. found that mir-21 may play a role in antiapoptosis either in vitro or in the xenograft mouse model. 10 Currently, extensive studies have indicated that the acquisition of drug resistance by cancer cells may also be modulated via the changes in mirna levels, for instance, the mirna profile in a panel of paclitaxel- and cisplatin (CDDP)-resistant ovarian cancer cells showed that 6 mirnas (let-7e, mir-30c, mir-125b, mir-130a and mir-335) were always diversely expressed in all the resistant cell lines, 12 which suggest that these 6 mirnas may be related with drug resistance and alter the levels of the drug resistance related mirnas, which maybe an effective way to modulate drug resistance of cancer cells. Exactly, upregulating mirna-451 sensitized doxorubicin-resistant MCF-7 cells to doxorubicin by downregulating its target protein Pgp. 13 Moreover, in multidrug-resistant gastric cancer cell line SGC7901/VCR, mir-15b and mir-16 were downregulated, compared with its parental SGC7901 cell line. Upregulating mir-15b and mir-

2 Zhu et al could sensitize SGC7901/VCR cells to VCR-induced apoptosis via targeting BCL2. 14 Recently, let-7a was found overexpressed in a doxorubicin-resistant human squamous carcinoma A431 cells subline, and downregulation of let-7a increased the doxorubicin-induced apoptosis through targeting caspase Except for above 4 studies, more and more evidence verified that mirnas may play a role in chemoresistance, 16 and modulation of some drug resistance related mirnas may increase the sensitivity of cancer cells to chemotherapy drugs. In this study, we reported that mir-181b was downregulated in both multidrug-resistant human gastric cancer cell line SGC7901/VCR and multidrug-resistant human lung cancer cell line A549/CDDP, compared with the parental SGC7901 and A549 cell lines, respectively. We demonstrated that mir-181b may play a role in the development of MDR in human cancer cell lines by targeting the antiapoptotic gene BCL2. Real-time quantification of mirnas by stem-loop RT-PCR The RNA preparation was as described above. The concentration and purity of the RNA samples were determined spectroscopically. For the TaqMan-based real-time reverse transcription-polymerase chain reaction (RT-PCR) assays, the ABI 7300 HT Sequence Detection system (Applied Biosystem, Foster City, CA) was used. All the primers and probes of hsa-mir-181b (P/N: ) and RNU6B endogenous controls (P/N: ) for TaqMan mirna assays were purchased from Applied Biosystems. Real-time PCR was performed as described. 18 The relative amount of each mirna was normalized to U6 snrna. The fold change for mirna from SGC7901/VCR cells and A549/CDDP cells relative to each control SGC7901 and A549 cells was calculated using the 2 DDCt Method, 19 where DDCt ¼ DCt SGC7901/VCR DCt SGC7901 or DDCt ¼ DCt A549/CDDP DCt A549 and DCt ¼ Ct mirna Ct U6 snrna. PCR was performed in triplicate. Material and Methods Cell culture Human gastric adenocarcinoma cell line SGC7901 (obtained from Academy of Military Medical Science, Beijing, China) and its multidrug-resistant variant SGC7901/VCR (obtained from the State Key Laboratory of Cancer Biology and Institute of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xian, China), human lung cancer cell line A549 and its multidrug-resistant variant A549/CDDP (both obtained from Biosis Biotechnology Company, Shanghai, China) were all cultured in RPMI-1640 medium supplemented with 10% fetal calf serum (Gibco BRL, Grand Island, NY) in a humidified atmosphere containing 5% CO2 at 37 C. To maintain the MDR phenotype, vincristine (VCR, with final concentration of 1 lg/ml) and CDDP (with final concentration of 4 lg/ml) were added to the culture media for SGC7901/VCR and A549/CDDP cells, respectively. mirna microarray analysis Before experimentation, SGC7901/VCR cells were cultured 1 week without VCR. Total RNA from SGC7901 and SGC7901/VCR cell lines was isolated with Trizol reagent (Invitrogen, Carlsbad, CA), and mirna fraction was further purified using a mirvana TM mirna isolation kit (Ambion, Austin, TX). The isolated mirnas from the 2 cell lines were then labeled with Hy3 using the mircury TM Array Labeling kit (Exiqon, Vedbaek, Denmark) and hybridized, respectively, on a mircury TM LNA microrna Array (v 8.0, Exiqon) as described. 17 Microarray images were acquired using a Genepix 4000B scanner (Axon Instruments, Union City, CA), processed and analyzed with Genepix Pro 6.0 software (Axon Instruments). Exogenous overexpression of the mature mir-181s through transient transfection of the mature mir-181s mimic The mature mir-181s (mir-181a, mir-181b, mir-181c and mir-181d) mimic and control mirna mimic were chemically synthesized by Shanghai GenePharma Company (Shanghai, China). The sequence of the mature mir-181s mimic and control mirna mimic is shown in Table 1. SGC7901/VCR and A549/CDDP cells were plated in 6-well plates ( cells/well) and transfected with 100 nm of the mature mir-181s mimic or 100 nm control mirna mimic using Lipofectamine 2000 (Invitrogen, Long Island, NY) according to the manufacturer s protocol. In vitro drug sensitivity assay All 4 kinds of cells (SGC7901, SGC7901/VCR, A549 and A549/CDDP) were seeded into 96-well plates ( cells/ well) and allowed to attach overnight. In addition, as to SGC7901/VCR and A549/CDDP cells, 24 hr after transfection of the mature mir-181s mimic or control mirna mimic, cells were also seeded into 96-well plates for next step experimentation. After cellular adhesion, freshly prepared anticancer drugs including VCR, adriamycin (ADR), 5-fluorouracil (5-FU), CDDP, mitomycin C (MMC) and etoposide (VP-16) were added with the final concentration being 0.01, 0.1, 1 and 10 times of the human peak plasma concentration for each drug as previously described. 14 The peak serum concentrations of various anticancer drugs are 0.4 lg/ml for ADR, 10lg/ml for 5-FU, 2.0 lg/ml for CDDP, 1.0 lg/ml for MMC, 0.5 lg/ml for VCR and 10 lg/ml for VP ,21 Forty-eight hours after addition of drugs, cell viability was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay. The absorbance at 490 nm (A490) of each well was read on a spectrophotometer. The concentration at which each drug produced 50% inhibition

3 2522 Role of micrornas in multidrug resistance Table 1. The sequence of the control mirna mimic and the mature mir-181s mimic mirna mimics Sequence has-mir control mimic 5 0 to 3 0 Sense UUCUCCGAACGUGUCACGUTT Antisense ACGUGACACGUUCGGAGAATT has-mir-181a mimic 5 0 to 3 0 Sense AACAUUCAACGCUGUCGGUGAGU Antisense UCACCGACAGCGUUGAAUGUUUU has-mir-181b mimic 5 0 to 3 0 Sense AACAUUCAUUGCUGUCGGUGGGU Antisense CCACCGACAGCAAUGAAUGUUUU has-mir-181c mimic 5 0 to 3 0 Sense AACAUUCAACCUGUCGGUGAGU Antisense UCACCGACAGGUUGAAUGUUUU has-mir-181d mimic 5 0 to 3 0 Sense AACAUUCAUUGUUGUCGGUGGGU Antisense CCACCGACAACAAUGAAUGUUUU of growth (IC50) was estimated by the relative survival curve. Three independent experiments were performed in quadruplicate. the transfected SGC7901/VCR and A549/CDDP cells by determining the relative amount of AnnexinV-FITC-positive, PI-negative cells as previously described, 23 respectively. Dual luciferase activity assay The 3 0 UTR of human BCL2 cdna containing the putative target site for the mature mir-181s (sequence shown in Supporting Information 1) was chemically synthesized and inserted at the XbaI site, immediately downstream of the luciferase gene in the pgl3-control vector (Promega, Madison, WI) by Biomics Biotechnologies (Nantong, China). Twentyfour hours before transfection, cells were plated at cells/well in 24-well plates. Two hundred nanograms of pgl3-bcl2-3 0 UTR plus 80 ng prl-tk (Promega) were transfected in combination with 60 pmol of the mature mir- 181s mimic or the control mirna mimic using Lipofectamine 2000 (Invitrogen) according to the manufacturer s protocol as described. 14 Luciferase activity was measured 24 hr after transfection using the Dual Luciferase Reporter Assay System (Promega). Firefly luciferase activity was normalized to renilla luciferase activity for each transfected well. Three independent experiments were performed in triplicate. Western blot analysis Cells were harvested and homogenized with lysis buffer 24, 48 and 72 hr after the transfection. Total protein was separated by denaturing 15% SDS-polyacrylamide gel electrophoresis. Western analysis was performed as described. 22 The primary antibodies for BCL2, b-actin and a-tubulin were purchased from Bioworld Technology and Santa Cruz Biotechnology, respectively. Protein levels were normalized to b-actin or a-tubulin. Fold changes were determined. Apoptosis assay Twenty-four hours after the transfection as described above, SGC7901/VCR and A549/CDDP cells were treated by VCR and CDDP, with final concentration of 5 and 20 lg/ml, respectively. Forty-eight hours after the treatment of VCR and CDDP, flow cytometry was used to detect apoptosis of Statistical analysis Each experiment was repeated at least 3 times. Numerical data were presented as mean 6 SD. The difference between means was analyzed with Student s t-test. All statistical analyses were performed using SPSS11.0 software (Chicago, IL). Differences were considered significant when p < Results mir-181b is downregulated in both SGC7901/VCR and A549/CDDP cells, compared with SGC7901 and A549 cells, respectively mirna microarray analysis of SGC7901 and SGC7901/VCR cells showed that there were 24 mirnas downregulated more than 2-fold and 11 mirnas upregulated more than 2-fold in SGC7901/VCR cells, compared with SGC7901 cells (Table 2). Among the downregulated mirnas were the mature mir-181s. Quantitative RT-PCR for mir-181b further verified that mir-181b was downregulated 4.03-fold in SGC7901/VCR and 2.88-fold in A549/CDDP cells, compared with SGC7901 and A549 cells, respectively (Fig. 1). mir-181b modulates MDR of SGC7901/VCR and A549/CDDP cell lines In vitro drug sensitivity assay verified the MDR phenotype of SGC7901/VCR and A549/CDDP cell lines, compared with the parental SGC7901 and A549 cell lines, respectively (Supporting Information 2). To investigate whether mir-181b has a direct function in MDR development or is just differentially modulated in MDR cancer cells, we transfected SGC7901/VCR and A549/ CDDP cells with the mature mir-181s mimic and the control mirna mimic, respectively, to observe the effects on MDR phenotype thereafter. In SGC7901/VCR cells, MTT assay revealed that only those transfected with mir-181b mimic exhibited greatly enhanced sensitivity to VCR, 5-Fu, CDDP,

4 Zhu et al Table 2. mirnas differentially expressed in SGC7901/VCR cell line and SGC7901 cell line mirna decreased Fold change mirna increased Fold change hsa-let-7d 3.97 hsa-mir-129-5p 2.07 hsa-let-7f 7.58 hsa-mir-182-3p 2.01 hsa-let-7g 9.28 hsa-mir hsa-mir hsa-mir hsa-mir hsa-mir hsa-mir-10a hsa-mir hsa-mir-125b 4.40 hsa-mir hsa-mir-181a hsa-mir hsa-mir-181b 2.16 hsa-mir hsa-mir-181c 6.70 hsa-mir-886-3p 3.21 hsa-mir-181d hsa-mir-886-5p 3.62 hsa-mir-15a-3p 5.41 hsa-mir-15b hsa-mir hsa-mir-216a hsa-mir hsa-mir-33a hsa-mir hsa-mir hsa-mir hsa-mir hsa-mir hsa-mir hsa-mir VP-16 and ADR, but not to MMC, compared with those transfected with the control mirna mimic, as indicated by significantly decreased IC50 values (Fig. 2a). In A549/CDDP cells, MTT assay revealed that all A549/ CDDP cells transfected with the mature mir-181s mimic exhibited greatly enhanced sensitivity to VCR, 5-Fu, CDDP, VP-16 and ADR, but not to MMC, compared with those transfected with the control mirna mimic, respectively (Fig. 2b). BCL2 is a target gene of the mature mir-181s TargetScanHuman 5.1 ( was used for the prediction of the mature mir-181s target genes. The sequence alignment of the mature mir-181s with BCL2 3 0 UTR of different species is conserved, which indicates that BCL2 is one of the potential targets of the mature mir-181s. More interestingly, there are 2 conserved target sites of the mature mir-181s in the 3 0 UTR of BCL2 by TargetScan prediction (Supporting Information 3). The study by Neilson JR et al. shows that the position of BCL2 3 0 UTR is a Figure 1. Real-time quantification of mir-181b by stem-loop RT-PCR showed that mir-181b was downregulated in both SGC7901/VCR and A549/CDDP cell lines, compared with SGC7901 and A549 cell lines, respectively. Triplicate assays were performed for each RNA sample, and the relative amount of mir-181b was normalized to U6 snrna. Data were shown as fold changes of mir-181b levels in SGC7901/VCR and A549/CDDP cell lines relative to SGC7901 and A549 cell lines, respectively, which were set as 1 (mean 6 SD). *p < target site by mmu-mir-181a, which was verified by luciferase activity assay. 24 To explore whether the other predicted position of BCL2 3 0 UTR is also a target site by the mature mir- 181s, we constructed a luciferase reporter vector with the putative BCL2 3 0 UTR target site for the mature mir-181s downstream of the luciferase gene (pgl3-bcl2-3 0 UTR). Luciferase reporter vector together with the mature mir-181s mimic or the control mirna mimic were transfected into SGC7901/VCR and A549/CDDP cells, respectively. In SGC7901/VCR and A549/CDDP cells, a significant decrease in relative luciferase activity was noted when pgl3- BCL2-3 0 UTR was cotransfected with the mature mir-181s mimic but not with the control mirna mimic, respectively (Figs. 3a and 3b), which suggests that the position of BCL2 3 0 UTR is also a target site by the mature mir-181s. mir-181b modulates MDR by repressing the BCL2 protein expression Worth of note, in our study, the decreased expression of mir-181b in SGC7901/VCR and A549/CDDP cells was concurrent with the overexpression of BCL2 protein, compared

5 2524 Role of micrornas in multidrug resistance Figure 2. mir-181b modulates multidrug resistance of SGC7901/VCR and A549/CDDP cell lines. (a) In SGC7901/VCR cells, only those transfected with mir-181b mimic exhibited greatly enhanced sensitivity to VCR, 5-Fu, CDDP, VP-16 and ADR, but not to MMC, compared with those transfected with the control mirna mimic. (b) In A549/CDDP cells, all those transfected with the mature mir-181s mimic exhibited greatly enhanced sensitivity to VCR, 5-Fu, CDDP, VP-16 and ADR, but not to MMC, compared with those transfected with the control mirna mimic, respectively. The data shown represent the mean 6 SD from 3 independent experiments. *p < with the parental SGC7901 and A549 cells, respectively (Fig. 4). As BCL2 is an antiapoptotic protein and a target of the mature mir-181s, we hypothesized that the mir-181b might modulate MDR of cancer cells by repressing the BCL2 protein expression. To ascertain our hypothesis, we transfected the mature mir-181s mimic and the control mirna mimic into SGC7901/VCR and A549/CDDP cells to detect the BCL2 expression level changes, respectively. No significant changes in BCL2 expression level were found neither in SGC7901/VCR nor in A549/CDDP cells 24 hr after the transfection of the mature mir-181s mimic, compared with the transfection of the control mirna mimic, respectively. However, 48 and 72 hr after the transfection, significant changes were found. In SGC7901/VCR cells, 48 hr after the transfection, Western Blot demonstrated no significantly decreased BCL2 protein level in all the mature mir-181s mimic transfected cells, compared with the control mirna mimic transfected cells (Supporting Information 4a), whereas 72 hr after the transfection, Western Blot demonstrated significantly decreased BCL2 protein level only in mir-181b mimic transfected cells compared with the control mirna mimic transfected cells (Fig. 5a). In A549/CDDP cells, 48 hr after the transfection, Western Blot demonstrated significantly decreased BCL2 protein level in mir-181b mimic transfected cells, compared Int. J. Cancer: 127, (2010) VC 2010 UICC

6 Zhu et al Figure 3. Dual luciferase assay performed in SGC7901/VCR and A549/CDDP cells suggests that the position of BCL2 3 0 UTR is also a target site by the mature mir-181s. Luciferase reporter vector together with the mature mir-181s mimic or the control mirna mimic were cotransfected into SGC7901/VCR and A549/CDDP cells, respectively. (a) In SGC7901/VCR cells, a significant decrease in relative luciferase activity was noted when pgl3-bcl2-3 0 UTR was cotransfected with the mature mir-181s mimic but not with the control mirna mimic. (b) In A549/CDDP cells, the same effect was found. The results shown represent the mean 6 SD from 3 independent experiments. *p < with the control mirna mimic transfected cells (Supporting Information 4b), whereas 72 hr after the transfection, Western Blot demonstrated significantly decreased BCL2 protein level in all the mature mir-181s mimic transfected cells, compared with the control mirna mimic transfected cells (Fig. 5b). These results demonstrated that mir-181b may modulate MDR of cancer cell lines, at least in part, by repressing the BCL2 protein expression. mir-181b sensitizes SGC7901/VCR and A549/CDDP cells to VCR- and CDDP-induced apoptosis, respectively The development of drug resistance in various cancer cells has been linked to a reduced susceptibility to drug-induced apoptosis, which was shown to be a consequence, at least in some cases, of overexpression of antiapoptotic proteins, such as BCL2 and BCL-XL As mir-181b may modulate MDR of cancer cell lines by repressing the BCL2 protein expression, considering the wellcharacterized role of BCL2 in apoptosis and drug resistance, we suggest a hypothesis that mir-181b may play a role in the development of MDR, at least in part, by modulation of apoptosis via targeting BCL2. To confirm this hypothesis, we evaluated VCR- and CDDP-induced apoptosis after transfection SGC7901/VCR and A549/CDDP cells with the mature mir-181s mimic and the control mirna mimic, respectively. In SGC7901/VCR cells, a marked increase in apoptosis, as assessed by flow cytometry, was observed in only mir-181b mimic transfected cells after VCR treatment, compared with the control mirna mimic transfected cells (Figs. 6a and 6c), whereas in A549/CDDP cells, a significant increase in apoptosis was found in all the mir-181s mimic transfected cells after CDDP treatment, compared with the control mirna mimic transfected cells (Figs. 6b and 6c). Taken together, our findings suggest that mir-181b could play a role in the development of MDR in both gastric and lung cancer cell lines, at least in part, by modulation of apoptosis via targeting BCL2. Discussion One major mechanism of drug resistance in cancer cells is the defective apoptosis pathway. 2 4 Recently, more and more findings have established that mirnas modulate drug resistance of cancer cells, at least in part, through this mechanism In our study, we found that the antiapoptotic protein BCL2 is upregulated, whereas mir-181b is downregulated in both SGC7901/VCR and A549/CDDP cells, compared with SGC7901 and A549 cells, respectively. The mechanistic connection of mir-181b dysregulation with the establishment of MDR in SGC7901/VCR and A549/CDDP cells was evidenced by the correlation between exogenous overexpression of mir-181b and corresponding changes in the protein levels of its target BCL2, which has a documented

7 2526 Role of micrornas in multidrug resistance Figure 4. Quantified Western analysis of BCL2 expression level showed significant overexpression of BCL2 protein in SGC7901/ VCR and A549/CDDP cell lines, compared with the parental SGC7901 and A549 cell lines, respectively. Representative Western blots were attached below the graphs. The results shown represent the mean 6 SD from 3 independent experiments. *p < importance in the development of cancer cells drug resistance. Function research of mir-181s was first focused on hematopoietic lineage differentiation in mouse, and mmu-mir- 181s was reported to show an obviously high expression at the adult stage, compared with embryonic and early postnatal stages in hematopoietic lineage differentiation. 28 Recent studies by Fanini et al. and Shi et al. showed that mir-181a and mir-181b may serve as tumor suppressors in human acute monocytic leukemia (AML) and human glioma cells, respectively. Agents that increase mir-181a expression induced apoptosis of AML blasts, while exogenous overexpression of mir-181a and mir-181b also induced apoptosis of human glioma cells 29,30 ; however, study by Ji et al. showed that hsamir-181s was highly expressed in EpCAM-positive hepatic cancer stem cells, which was more aggressive, compared with alpha-fetoprotein-positive hepatic cancer cells, and inhibition of mir-181 led to a reduction in EpCAM-positive hepatic cancer stem cell quantity and tumor-initiating ability; furthermore, hsa-mir-181s was also highly expressed in embryonic livers and in isolated hepatic stem cells. 31 The above 3 studies suggest that mir-181s may play a totally different role in different types of cancer cells. Our study was in concordance with the studies by Fanini et al. and Shi et al., 29,30 and we Figure 5. The mature mir-181s mimic modulates BCL2 protein level in SGC7901/VCR and A549/CDDP cells, respectively. (a) In SGC7901/VCR cells, quantified Western analysis of BCL2 expression level showed that 72 hr after the transfection, significantly decreased BCL2 protein level in mir-181b mimic transfected cells was found, compared with the control mirna mimic transfected cells. (b) In A549/CDDP cells, 72 hr after the transfection, significantly decreased BCL2 protein level was found in all the mature mir-181s mimic transfected cells, compared with the control mirna mimic transfected cells. Representative Western blots were attached beside the graphs. The results shown represent the mean 6 SD from 3 independent experiments. *p < also found that exogenous overexpression of mir-181b sensitizes SGC7901/VCR and A549/CDDP cells to VCR- and CDDP-induced apoptosis, respectively, and except for VCR and CDDP, exogenous overexpression of mir-181b also altered sensitivity of both SGC7901/VCR and A549/CDDP cells to ADR, VP-16, 5-Fu, but not to MMC, a possible explanation for this phenomenon could be that MMC triggers apoptosis of cancer cells via a pathway where BCL2 is not necessarily involved Although a common function of mir-181b in modulating MDR of cancer cell lines was found in our study, the function of other mir-181s seems to be inconsistent between gastric and lung cancer cell lines. In SGC7901/VCR cells, exogenous overexpression of other mature mir-181s (mir-181a, mir-181c and mir-181d) has no significant effect on MDR, whereas in A549/CDDP cells, exogenous overexpression of Int. J. Cancer: 127, (2010) VC 2010 UICC

8 Zhu et al Figure 6. mir-181b sensitizes SGC7901/VCR and A549/CDDP cells to VCR- and CDDP-induced apoptosis, respectively. (a) In SGC7901/VCR cells, apoptosis evaluated by flow cytometry showed that a marked increase in apoptosis only in mir-181b mimic transfected cells after VCR treatment. (b) In A549/CDDP cells, apoptosis evaluated by flow cytometry showed that a marked increase in apoptosis in all the mature mir-181s mimic transfected cells after CDDP treatment. The results shown represent the mean 6 SD from 3 independent experiments. *p < (c) Representative flow cytometry report was attached under the graphs. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.] other mir-181s (mir-181a, mir-181c and mir-181d) has the same significant effect on MDR as mir-181b. It is well known that the 4 mir-181 family members are evolutionarily conserved among the vertebrate lineage with high homology, implicating their functional redundancy, 31 just like what we found in lung cancer cell line; however, in gastric cancer cell line, inconsistence was found; one possible explanation for this is that the function of mirnas may exist cell-type specificity just as mentioned above. In gastric cancer cell line, the other mir-181 family members may play a weaker function than mir-181b. Although BCL2 is a target gene by the mature mir-181s, the silencing effect between each member of the mature mir-181s is different. For instance, in the study by Shi et al., 30 the apoptosis induction effect of hsamir-181b in glioma cells was more apparent than the effect of hsa-mir-181a. The molecular mechanism underlying this different silencing effect between each member of the mature mir-181s may be explained by the different length of the seed region of the target gene. One of the seed region of BCL2 3 0 UTR for the mature mir-181s verified by our experiment showed that the seed region for mir-181b is 5 bases longer than that for the other members of the mature mir- 181s. However, as to the intrinsic mechanism, more research is needed.

9 2528 Role of micrornas in multidrug resistance In our study, we overexpressed the mature mir-181s through transient transfection of the mature mir-181s mimic. It is reported that transfection of small RNAs (such as small interfering RNAs and mirnas) into cells exhibited concentration and temporal dependence. 35 Therefore, we checked the BCL2 expression levels 24, 48 and 72 hr after the transfection; indeed, the most significant effect of small RNAs happened 72 hr after the transfection, which was consistent with the study by Xia L et al. 14 However, the concentration dependence of transfection of small RNAs was not done in our study, which was a limitation of our experiment. In addition, among the differentially expressed mirnas in SGC7901/VCR cells compared with SGC7901 cells are some with well-characterized drug resistance association such as mir-15b, mir-16 and mir-451, which indicated that MDR of cancer cell lines may be a mirna net regulated biological process. In summary, the findings we reported here presented the first evidence that mir-181b may be involved in the development of MDR in gastric and lung cancer cell lines. mir- 181b could modulate the sensitivity of gastric and lung cancer cell lines to some anticancer drugs, at least in part, through target BCL2 expression. Our study may have implications for cancer chemotherapy whose efficiency is often impeded by the development of MDR. Therapeutic strategies targeting the MDR-related mirnas, such as mir- 181b, may be another promising way to enhance therapeutic effect. However, it should be noted that our data are derived from cell lines, which have been removed from their in vivo context and cannot be considered accurate surrogates for clinical tumors. Thus, future studies to assess the roles of mir-181b in vivo and in clinical context are warranted. References 1. Fan D, Zhang X, Chen X, Mou Z, Hu J, Zhou S, Ding J, Wu K. Bird s-eye view on gastric cancer research of the past 25 years. J Gastroenterol Hepatol 2005;20: Rabik CA, Dolan ME. Molecular mechanisms of resistance and toxicity associated with platinating agents. Cancer Treat Rev 2007;33: Johnstone RW, Ruefli AA, Lowe SW. Apoptosis: a link between cancer genetics and chemotherapy. Cell 2002; 108: Zhang K, Mack P, Wong KP. Glutathionerelated mechanisms in cellular resistance to anticancer drugs. Int J Oncol 1998;12: Szakacs G, Paterson JK, Booth-Genthe C, Gottesman MM. Targeting multidrug resistance in cancer. Nat Rev Drug Disc 2006;5: Osada H, Takahashi T. MicroRNAs in biological processes and carcinogenesis. Carcinogenesis 2007;28: Harfe BD. MicroRNAs in vertebrate development. Curr Opin Genet 2005;15: Hwang HW, Mendell JT. MicroRNAs in cell proliferation, cell death, and tumorigenesis. Br J Cancer 2006;94: Chen CZ, Li L, Lodish HF, Bartel DP. MicroRNAs modulate hematopoietic lineage differentiation. Science 2004;303: Si ML, Zhu S, Wu H, Lu Z, Wu F, Mo YY. mir-21-mediated tumor growth. Oncogene 2007;26: Blower PE, Verducci JS, Lin S, Zhou J, Chung JH, Dai Z, Liu CG, Reinhold W, Lorenzi PL, Kaldjian EP, Croce CM, Weinstein JN, et al. MicroRNA expression profiles for the NCI-60 cancer cell panel. Mol Cancer Ther 2007;6: Sorrentino A, Liu CG, Addario A, Peschle C, Scambia G, Ferlini C. Role of micrornas in drug-resistant ovarian cancer cells. Gynecol Oncol 2008;111: Kovalchuk O, Filkowski J, Meservy J, Ilnytskyy Y, Tryndyak VP, Chekhun VF, Pogribny IP. Involvement of microrna- 451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther 2008;7: Xia L, Zhang D, Du R, Pan Y, Zhao L, Sun S, Hong L, Liu J, Fan D. mir-15b and mir-16 modulate multidrug resistance by targeting BCL2 in human gastric cancer cells. Int J Cancer 2008; 123: Tsang WP, Kwok TT. Let-7a microrna suppresses therapeutics-induced cancer cell death by targeting caspase-3. Apoptosis 2008;13: Zheng T, Wang J, Chen X, Liu L. Role of microrna in anticancer drug resistance. Int J Cancer 2010;126: Castoldi M, Schmidt S, Benes V, Noerholm M, Kulozik AE, Hentze MW, Muckenthaler MU. A sensitive array for microrna expression profiling (michip) based on locked nucleic acids (LNA). RNA 2006;12: Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR, Lao KQ, Livak KJ, et al. Real-time quantification of micrornas by stem-loop RT-PCR. Nucleic Acids Res 2005;33:e Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25: Yamaue H, Tanimura H, Noguchi K, Hotta T, Tani M, Tsunoda T, Iwahashi M, Tamai M, Iwakura S. Chemosensitivity testing of fresh human gastric cancer with highly purified tumor cells using the MTT assay. Br J Cancer 1992;66: Yamaue H, Tani M, Onishi H, Kinoshita H, Nakamori M, Yokoyama S, Iwahashi M, Uchiyama K. Locoregional chemotherapy for patients with pancreatic cancer intraarterial adjuvant chemotherapy after pancreatectomy with portal vein resection. Pancreas 2002;25: Zeng Y, Zhang X, Huang Z, Cheng L, Yao S, Qin D, Chen X, Tang Q, Lv Z, Zhang L, Lu C. Intracellular Tat of human immunodeficiency virus type 1 activates lytic cycle replication of Kaposi s sarcomaassociated herpesvirus: role of JAK/STAT signaling. J Virol 2007;81: Malugin A, Kopeckova P, Kopecek J. HPMA copolymer-bound doxorubicin induces apoptosis in human ovarian carcinoma cells by a Fas-independent pathway. Mol Pharm 2004;1: Neilson JR, Zheng GX, Burge CB, Sharp PA. Dynamic regulation of mirna expression in ordered stages of cellular development. Genes Dev 2007;21: Reed JC. Regulation of apoptosis by bcl-2 family proteins and its role in cancer and chemoresistance. Curr Opin Oncol 1995;7: Wang S, Yang D, Lippman ME. Targeting Bcl-2 and Bcl-XL with nonpeptidic smallmolecule antagonists. Semin Oncol 2003;30: Reed JC. Drug insight: cancer therapy strategies based on restoration of endogenous cell death mechanisms. Nat Clin Pract Oncol 2006;3: Int. J. Cancer: 127, (2010) VC 2010 UICC

10 Zhu et al Chen CZ, Li L, Lodish HF, Bartel DP. MicroRNAs modulate hematopoietic lineage differentiation. Science 2004;303: Fanini F, Vannini I, Faabbri M. MicroRNAs: tiny players with a big role in the pathogenesis of leukemias and lymphomas. Hematol Rev 2009;1: Shi L, Cheng Z, Zhang J, Li R, Zhao P, Fu Z, You Y. hsa-mir-181a and hsa-mir-181b function as tumor suppressors in human glioma cells. Brain Res 2008;1236: Ji J, Yamashita T, Budhu A, Forgues M, Jia HL, Li C, Deng C, Wauthier E, Reid LM, Ye QH, Qin LX, Yang W, et al. Identification of microrna-181 by genome-wide screening as a critical player in EpCAM-positive hepatic cancer stem cells. Hepatology 2009;50: Park IC, Park MJ, Hwang CS, Rhee CH, Whang DY, Jang JJ, Choe TB, Hong SI, Lee SH. Mitomycin C induces apoptosis in a caspasesdependent and Fas/CD95- independent manner in human gastric adenocarcinoma cells. Cancer Lett 2000; 158: Kang YH, Lee KA, Ryu CJ, Lee HG, Lim JS, Park SN, Paik SG, Yoon DY. Mitomycin C induces apoptosis via Fas/ FasL dependent pathway and suppression of IL-18 in cervical carcinoma cells. Cancer Lett 2006;237: Liedtke C, Lambertz D, Schnepel N, Trautwein C. Molecular mechanism of Mitomycin C-dependent caspase-8 regulation: implications for apoptosis and synergism with interferonalpha signalling. Apoptosis 2007;12: Khan AA, Betel D, Miller ML, Sander C, Leslie CS, Marks DS. Transfection of small RNAs globally perturbs gene regulation by endogenous micrornas. Nat Biotechnol 2009;27: