Genetic variation of mirna sequence in pancreatic cancer

Transcription

1 Acta Biochim Biophys Sin (2009): ª The Author Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. DOI: /abbs/gmp023. Advance Access Publication 31 March 2009 Genetic variation of mirna sequence in pancreatic cancer Zheng Zhu 1, Wentao Gao 2, Zhuyin Qian 2 *, and Yi Miao 2 * 1 Department of General Surgery, The First Clinic Medical College of Nanjing Medical University, Nanjing , China 2 Department of General Surgery, The First Affiliated Hospital of Nanjing Medical University, Nanjing , China These authors contributed equally to this work. *Correspondence address. Tel: þ ; Fax: þ ; qianzhusilver@163.com (Z.Q.) & miaoyi@njmu.edu.cn (Y.M.) MicroRNAs (mirnas) are small non-coding RNAs of nucleotides (nts) and constitute a novel class of gene regulators that negatively regulate gene expression at the post-transcriptional level. The expression of mirna is deregulated in many types of cancers. Alterations in mirna expression may be an important contributor to the development of pancreatic carcinoma. We hypothesized that genetic variations in mirna genes were associated with pancreatic carcinoma and analyzed genomic sequences coding for the precursors of eight mirna genes in both pancreatic carcinoma tissues and cancer cell lines. Four novel mutations in primary mirna transcripts were identified. TaqMan mirna assays showed that mir-21 was significantly overexpressed in 20 pancreatic carcinomas and 6 cancer cell lines compared with paired benign tissues and normal pancreas. Two mutations of mir-21 did not notably alter the activity of the promoter of the mirna gene. Although most of these mutations seem to have no effect on mirna processing, an A G mutation at 29-nt downstream of pre-mir-21 led to a conformational change of the secondary structure close to the stem reaching into the pre-mir-21 and a relative reduction of the mature mir-21 expression in vivo. These results suggested that mirna might play an important role in pancreatic tumorigenesis, but the molecular mechanism underlying the particular sequence variations in mirna that can cause aberrant expression remains to be determined. Keywords micrornas; pancreatic cancer; promoter; secondary structure Received: November 23, 2008 Accepted: March 10, 2009 Introduction Pancreatic cancer is a highly lethal disease, characterized by late clinical presentation, early and aggressive local invasion, metastatic potential, strong resistance to chemotherapy and radiation therapy, and most importantly, a very poor overall prognosis [1,2]. Many previous studies have attempted to elucidate the molecular mechanisms underlying pancreatic tumorigenesis, but it is still not fully understood. Therefore, a better understanding of the genes involved in tumor growth and progression is necessary for the development of novel diagnostic and therapeutic strategies that can improve the treatment of this deadly disease. A recently identified class of non-coding small RNAs, micrornas (mirnas), may provide new insights in cancer research. mirnas are small non-coding RNAs of nucleotides and constitute an abundant class of gene regulators that negatively regulate gene expression at the post-transcriptional level. They bind with the 3 0 untranslated regions of their mrna targets and repress target-gene expression by mrna degradation or translational repression. mirnas are initially transcribed from genomic DNA as large primary mirna ( pri-mirna) transcripts that are then processed by the RNase III enzyme Drosha, in the nucleus into hairpin-shaped pre-mirnas. Pre-miRNAs are exported to the cytoplasm through Exportin-5, and further processed by another RNase III enzyme Dicer, into mature mirnas [3 5]. A total of 678 human mirnas have been reported (April 2008 release of mirbase at the Sanger Institute). Previous results indicated that mirnas could function as tumor suppressors and oncogenes, and the mirnas with a role in cancer were designated as oncogenic mirnas (oncomirs) [3]. At the present time, the main Acta Biochim Biophys Sin (2009) Volume 41 Issue 5 Page 407

2 mechanism that underlies changes in the function of mirnas in cancer cells seems to be aberrant gene expression, characterized by abnormal levels of expression for mature and/or precursor mirna sequences compared with the corresponding normal tissues. The global mirna expression patterns of many tumors have been described [6 10] and the mirna expression signature that is associated with pancreatic cancer has also been identified [11 13]. The precise mechanisms regulating mirna expression and maturation are largely unknown, but studies have suggested several mechanisms, including genetic and epigenetic alterations [14,15]. A mutation or a single nucleotide polymorphism (SNP) at the mirna gene region might affect the transcription of pri-mirna transcripts, the processing of mirna precursors to mature mirnas, or mirna target interactions [16]. This study was designed to identify the genetic alterations (mutations) of mirnas in pancreatic cancer and to investigate the function of these mutations. Materials and Methods Materials Twenty pancreatic carcinoma tissues were collected from patients who had undergone resection for ductal adenocarcinoma of the pancreas between 2006 and 2008 from the First Affiliated Hospital of Nanjing Medical University (Nanjing, China). These cancer tissue specimens were freshly frozen. All cases were histopathologically diagnosed, and had received no radiotherapy or chemotherapy before surgical operation. Benign adjacent pancreas was also collected from all pancreatic cancer specimens. Five normal pancreatic tissue specimens and seven peripheral blood genomic DNA samples of healthy people were obtained from the laboratory of the Department of General Surgery of the First Affiliated Hospital of Nanjing Medical University. The following human tumor cell lines were obtained from the laboratory of the Department of General Surgery of the First Affiliated Hospital of Nanjing Medical University: BXPC-3, CFPAC-1, PANC-1, and SW1990 ( pancreatic cancer); MDA-MB-231 (breast cancer); and HEP G2 (liver cancer). Cancer cell lines were cultured in RPMI 1640 or other suitable media containing 10% fetal bovine serum in a humidified atmosphere of 95% air and 5% CO 2. AxyPrep TM Multisource Genomic DNA miniprep kit used for genomic DNA extraction was purchased from Axygen (Union City, USA). Total RNA was isolated from samples by Trizol (Invitrogen, Shanghai, China) according to the manufacturer s instructions. Identification of mirna mutations First we performed bioinformatics analyses of the available cdna-microarray data [11 13], array-based comparative genomic hybridization (acgh) data [17 21], mirbase mirna target-gene data ( sanger.ac.uk/targets/v5/), and relative articles in other tumors [6 10]. Then we chose the following eight mirnas that might be relevant to pancreatic tumorigenesis for sequence analysis: mir-15a, mir-16-1, mir-21, mir-155, mir-196a-1, mir-196a-2, mir-219, and mir-375. Sequence and genomic location data of the mirnas were obtained from the Sanger Institute mirbase ( shtml), and the surrounding genomic DNA sequences data of mirna genes were obtained by BLAT analysis ( Primers used were designed using primer3 ( frodo.wi.mit.edu/cgi-bin/primer3/primer3.cgi). Genomic DNA was extracted from freshly frozen tissue specimens and cultured cell lines, using AxyPrep TM Multisource Genomic DNA miniprep kit following the manufacturer s protocol. An 800-bp genomic DNA fragment of each mirna gene, including about 500 bp upstream and about 200 bp downstream of the pre-mirna, was amplified by PCR. The primer sequences and the PCR reaction conditions are listed in Table 1. This genomic DNA fragment contained almost all of the functional areas of a mirna gene [22]. All specimens were sent to Invitrogen Corporation in Shanghai for sequencing. In the initial screening, we sequenced the PCR products of the genomic DNA samples from six cell lines and seven peripheral blood samples of healthy people for each mirna. When a mutation was identified, we extended the screening to 20 pancreatic cancer patients and 5 normal pancreatic tissue specimens for the mutation. The mutations were first confirmed by sequencing the same sample from the other direction. Then the mutations and SNPs were further confirmed by re-pcr of the sample, and sequencing was done again to avoid any artificial mutation that could be introduced by PCR amplification. TaqMan quantitative RT-PCR Quantitative RT-PCR was used to determine the expression of mirna hsa-mir-21 (homo-sapiens mir-21). cdna was synthesized from 10 ng of total RNA and real-time PCR was performed with TaqMan Acta Biochim Biophys Sin (2009) Volume 41 Issue 5 Page 408

3 Table 1 The primer sequences and the PCR reaction conditions mirna Forward primer (5 0! 3 0 ) Reverse primer (5 0! 3 0 ) Amplicon (bp) Melting temperature (T a m, 8C) mir-15a CTCATCATCCCAAGGATTCA TACGTGCTGCTAAGGCACTG mir-16-1 TTCATGTTTTTCCCTTGATGTG TTGATGGCATTCAATACAATTATTA mir-21 TCCGTTTTCTTGAGCGTTTT GCTGCATTATGGCACAAAAG mir-155 GCTTTCCCCAAAGGAATCTC TGAACATCCCAGTGACCAGA mir-196a-1 GCCTTCACAGCAACTGTTCA CCTTCCCCTCCTAACACACA mir-196a-2 TGTTGCTCAGTCTGGTCGTC GAGAGGACGGCATAAAGCAG mir-219 AATGAACCAGCCGATGAAAG GACAGAGGGCTCGTGAAAAG mir-375 GTCGAGGTCACCACTGGATT CCCGTATTACGACGCAGAAT a Thermocyclings were performed for 35 cycles at 958C for 30 s, Tm for 30 s and 728C for 1 min; final extension at 728C for 5 min. 2 Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems, Foster City, USA). Mature mirnas were determined using TaqMan mirna assays (Applied Biosystems). Normalization was performed with the small nuclear RNA U6 (RNU6B; Applied Biosystems). All real-time reactions, including no-template controls, were run using the Rotor-Gene 3000 real-time rotary analyzer (Corbett Research) and performed in duplicate. Relative quantities of mirna were calculated using the DDCT method after normalization with reference to the expression of RNU6B as endogenous control. The significance of the difference of the expression level of mir-21 in SW1990, normal pancreas (NP), tumor cell lines, and patient samples was determined by Student s t-test. Promoter assay The sequencing region of the interested mirna gene was amplified by PCR and inserted into pgl3-basic luciferase reporter vector (Promega, Madison, USA). Heterozygous genomic DNA containing both the wildtype (WT) allele and the mutant allele of the relevant mirna gene was used as a template for PCR. The clones that contain the WT or mutant mirna gene were identified by sequencing. BXPC-3 cells were transfected with the WT, mutant constructs, and empty vector respectively, using Lipofectamine 2000 reagent following the manufacturer s protocol (Invitrogen). Each vector was performed in triplicate. The transfection efficiency for each pair of WT and mutant constructs was normalized by the co-transfected prl-sv40 vector (Promega). Twenty-four hours after transfection, cells were lysed and each luciferase luminescent signal of the samples was quantified using Dual-Luciferase w Reporter Assay System following the manufacturer s protocol (Promega). The significance of the difference of the luciferase luminescent signal intensity in these three vectors was determined by Student s t-test. Prediction of secondary structure of mirna precursor The RNAfold web server ( cgi-bin/rnafold.cgi) was used to predict the secondary structure of pre-mirna [23]. Default parameters were employed. We used this program to predict the most stable secondary structure of both the wild-type (WT) and variant sequences. The sequence applied for prediction analysis included pre-mirna and about 200 bp upstream and about 100 bp downstream flanking sequences at each end of the precursor. In all cases, folding structures with minimal free energy were depicted. Results MiRNA mutations identified from cancer cell lines and human tumor tissues To investigate whether mutations in mirna genes play a role in the development of pancreatic cancer, we screened approximately 20 human pancreatic cancer tissues and 6 human cancer cell lines for analysis of 8 human mirnas in the present study. We amplified the genomic DNA containing the mirna precursor for each mirna gene, and its flanking sequences at both ends, and used the amplified PCR products for sequence analysis. When a mutation was identified in a cancer cell Acta Biochim Biophys Sin (2009) Volume 41 Issue 5 Page 409

4 Table 2 New mutations identified in mirna genes from pancreatic carcinoma tissues and cancer cell lines mirna Mutations a Location Zygosity Patients or cell lines Ratio of mutants (number/total number) Normal subjects (number/total number) mir-21 A 2 233G pri-mirna Heterozygous BXPC-3 1/26 0/5 mir-21 A þ 29G pri-mirna Heterozygous SW1990 1/26 0/5 mir-155 C 2 62A pri-mirna Heterozygous SW1990 1/26 0/5 mir-155 A þ 59G pri-mirna Heterozygous Case 233 1/26 0/5 a The locations of SNPs are numbered according to their upstream position 5 0 (negative base count, 2 ) to the start of the pre-mirna or downstream 3 0 (positive base count, þ ) to the end of the pre-mirna. pancreatic cancer tissues relative to benign pancreatic tissue with P, 0.05 [Fig. 2(A)]. These data correspond to the cdna-microarray data [11 13], indicating that mir-21 may function as a proto-oncogene Fig. 1 The locations of four novel sequence variations in the pri-mirna transcripts The mutations localized to pri-mirna transcripts (black line) upstream (negative base count, 2 ) or downstream ( positive base count, þ ) of the precursor hairpin (filled box) that also contains the mature mirna (unfilled box). line, the human tumor tissues were also further screened. A total of four novel mutations in two mirnas, including mir-21 and mir-155, from two pancreatic cancer cell lines (BXPC-3, SW1990) and one human tumor specimen (Case 233) were identified in the screening (Table 2). These mutations were confirmed by repeated PCR amplification and sequencing of the re-amplified products. We further analyzed genomic DNA from five normal individuals to determine whether the identified mutations are associated with human cancer. We found no mutations in the normal subjects, suggesting that the mutations may be potentially associated with human cancer. Further studies of the adjacent unaffected tissues from the same patients (Case 233) suggested that the mutation was germline mutation. Among these four mutations, all of them were in the pri-mirna regions (Fig. 1). Expression profile of mir-21 in pancreatic carcinoma Total RNAs were extracted from the 6 cancer cells lines, 19 pancreatic cancer tissues, 12 benign adjacent pancreatic tissues and 4 normal pancreatic tissues, and the expression level of mature mir-21 was evaluated by TaqMan mirna assays. The results revealed that mir-21 was overexpressed in both cancer cell lines and Effect of mutations on mirna transcription Functional analysis was performed to determine whether the identified mutations of mirna genes could affect the expression (transcription) of the mutated mirna in vivo. We cloned both WT and mutated alleles of the mir-21 gene into a mammalian expression vector. BXPC-3 cells were transfected with the constructed expression vectors. Total luciferase reporter enzymes were extracted from the transfected cells and the luminescent signal from each sample was quantified by Dual-Luciferasew Reporter Assay (Promega). The average intensities of the luminescent signal of the three specimens (relative to prl-sv40 control vector) were, respectively, (A þ 29G vector), (A 2 233G vector), and (WT vector). The results revealed that none of the sequence changes in mirna precursors notably affect the activity of the promoter of mir-21 gene (P. 0.05; Table 3). These results indicated that mutation of mirna might not represent a main mechanism underlying modulation of the mirna gene transcription. Effects of sequence variations on the secondary structures of mirna precursors The RNase III-mediated processing and maturation of a mirna precursor in vivo lead to the final product, a functional mature mirna. Thus, it is expected that the processing and maturation of a mirna precursor require appropriate secondary structures and specific sequence elements within the mirna precursor or pri-mirna [15,24 26]. Interestingly, while most of the mutations identified in this study did not cause major conformational changes (data not shown), the A þ 29G variant Acta Biochim Biophys Sin (2009) Volume 41 Issue 5 Page 410

5 MicroRNA mutations in pancreatic carcinoma Fig. 2 TaqMan mirna assay for mir-21 The relative expression level of mir-21 in NP was normalized to 1. (A) The expression level of mir-21 in tumor cell lines and patient samples versus those in NP. mir-21 was highly overexpressed in both cancer cell lines and pancreatic cancer tissues relative to benign pancreatic tissue (P, 0.05). (B) The expression level of mir-21 in SW1990 versus those in NP, tumor cell lines and patient samples. The mature mir-21 expression level was relatively lower in SW1990 than other cancer cell lines and pancreatic carcinoma tissues (P, 0.05). Cell line, cancer cell lines (BXPC-3, CFPAC-1, PANC-1, HEP G2, MDA-MB-231); Tumor, pancreatic carcinoma tissues; Para N, Benign adjacent pancreatic tissues. Table 3 Effect of identified mutations of mir-21 on promoter activity Vectora Luminescent signal P value WT A þ 29G A 2 233G a Vector, the reconstructed vector contains WT or mutated (A þ 29G, A 2 233G) allele of the mir-21 gene; P value, the significance of the difference of the promoter activity of the mutant construct compared to WT construct. of mir-21 appeared to alter the secondary structure close to the stem reaching into the pre-mirna (Fig. 3). Discussion A strong link between mutations, aberrant expression, or altered mature mirna processing and cancer susceptibility and progression has been demonstrated over the past few years. A germline mutation in the primary precursor of mir-16-1 mir-15a has been linked to familial Fig. 3 Sequence variations in the pri-mirna can translate into structural alterations RNA secondary structure prediction using RNAfold web server [23] revealed conformational changes in the secondary structure of the primary transcripts of mir-21 that could affect the base-pairing close to the stem region of the precursor hairpin (blue). The mature mir-21 was painted in green. Depicted are only the most stable secondary structures with the lowest free energy. (A) WT mir-21. (B) Variant mir-21. Acta Biochim Biophys Sin (2009) Volume 41 Issue 5 Page 411

6 chronic lymphocytic leukemia [27], which was further supported in a spontaneous mouse model of chronic lymphocytic leukemia [28]. In the present study, we screened sequence variations in 8 human mirnas in 20 human pancreatic cancer tissues and 6 human cancer cell lines. A total of four variations in two mirnas, including mir-21 and mir-155, were identified. It has also been shown that mirna expression patterns are relevant to the biologic and clinical behavior of human solid tumors. mir-21 was highly expressed in many kinds of human tumors, and the elevated expression might directly decrease the phosphatase and tensin homolog deleted on chromosome 10 (an important tumorsuppressor gene) expression [6 13,29]. mir-21 was identified as significantly overexpressed in pancreatic cancer versus NP in our study, suggesting that mir-21 plays an important role in preventing apoptosis, thus functioning as a proto-oncogene in pancreatic cancer. Most known mirna genes have the same type of promoters, within the 500-bp upstream proximal regions of pre-mirna hairpins, as protein-coding genes have [22]. Mutations that affect the activity of the promoters of mirna genes may also be important for mirna expression levels. But promoter assays showed that the two identified mutations of mir-21 did not significantly alter the activity of the promoter of mir-21 gene in our study. Hypothetically, mutations in the pri- and pre-mirna regions of mirna genes could affect processing of the precursor to the mature form of mirna, resulting in aberrant expression of mirna. Using the RNAfold program, we found that the A þ 29G mutation of mir-21 in SW1990 disrupted the base-pairing close to the stem region of the pre-mirna [Fig. 3(B)], and the mature mir-21 expression level was relatively lower in SW1990 than in other cancer lines [P, 0.05; Fig. 2(B)]. Calin et al. had found that a sequence transition at 7-bp (C þ 7T) downstream of the mir-16-1 precursor did result in lower expression level of mature mirna [27]. The functional implications of the A þ 29G mutation of mir-21 identified here need further investigation. In summary, we presented evidence that mirna sequences vary in pancreatic cancer, and mir-21 was highly expressed in pancreatic carcinoma. Most of the mutations so far identified in cancer did not exert any apparent effect on mirna function. However, one identified sequence variant disrupted the base-pairing close to the stem region and relatively reduced the expression of the mirna. Our study indicated that mirnas might play an important role in pancreatic tumorigenesis, but the molecular mechanism underlying the particular sequence variations in mirna that can cause aberrant expression remains to be determined. Acknowledgements We greatly appreciate the technical support of the functional assays from Dr. Li Wu (Laboratory of the Department of Gerontology of the First Affiliated Hospital of Nanjing Medical University) and Xiao Han (Jiangsu Province Key Laboratory of Human Functional Genomics, Nanjing Medical University). We thank Yi Zhu for providing us the pathologic data of the tissue specimens and Wei Li for technical assistance. Funding This work was supported in part by the grants from the National Natural Science Foundation of China (No ) and by the Natural Science Foundation of Jiangsu Province of China (No. BK ). References 1 Li D, Xie K, Wolff R and Abbruzzese JL. Pancreatic cancer. Lancet 2004, 363: Postier RG. The challenge of pancreatic cancer. Am J Surg 2003, 186: Esquela-Kerscher A and Slack FJ. Oncomirs micrornas with a role in cancer. Nat Rev Cancer 2006, 6: Calin GA and Croce CM. MicroRNA signatures in human cancers. Nat Rev Cancer 2006, 6: Sevignani C, Calin GA, Siracusa LD and Croce CM. Mammalian micrornas: a small world for fine-tuning gene expression. Mamm Genome 2006, 17: Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A and Petrocca F, et al. A microrna expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 2006, 103: Ciafrè SA, Galardi S, Mangiola A, Ferracin M, Liu CG, Sabatino G and Negrini M, et al. Extensive modulation of a set of micrornas in primary glioblastoma. Biochem Biophys Res Commun 2005, 334: Iorio MV, Ferracin M and Liu CG. MicroRNA gene expression deregulation in human breast cancer. Cancer Res 2005, 65: Michael MZ, O Connor SM, van Holst Pellekaan NG, Young GP and James RJ. Reduced accumulation of specific micrornas in colorectal neoplasia. Mol Cancer Res 2003, 1: He H, Jazdzewski K, Li W, Liyanarachchi S, Nagy R, Volinia S and Calin GA, et al. The role of microrna genes in papillary thyroid carcinoma. Proc Natl Acad Sci U S A 2005, 102: Szafranska AE, Davison TS, John J, Cannon T, Sipos B, Maghnouj A and Labourier E, et al. MicroRNA expression alterations are linked to tumorigenesis and non-neoplastic processes in pancreatic ductal adenocarcinoma. Oncogene 2007, 26: Acta Biochim Biophys Sin (2009) Volume 41 Issue 5 Page 412

7 12 Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder H, Hagan JP and Liu CG, et al. MicroRNA expression patterns to differentiate pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis. JAMA 2007, 297: Lee EJ, Gusev Y, Jiang J, Nuovo GJ, Lerner MR, Frankel WL and Morgan DL, et al. Expression profiling identifies microrna signature in pancreatic cancer. Int J Cancer 2007, 120: Lujambio A, Ropero S, Ballestar E, Fraga MF, Cerrato C, Setién F and Casado S, et al. Genetic unmasking of an epigenetically silenced microrna in human cancer cells. Cancer Res 2007, 67: Duan R, Pak C and Jin P. Single nucleotide polymorphism associated with mature mir-125a alters the processing of pri-mirna. Hum Mol Genet 2007, 16: Yang W, Chendrimada TP, Wang Q, Higuchi M, Seeburg PH, Shiekhattar R and Nishikura K. Modulation of microrna processing and expression through RNA editing by ADAR deaminases. Nat Struct Mol Biol 2006, 13: Gysin S, Rickert P, Kastury K and McMahon M. Expression patterns in a panel of human pancreatic cancer cell lines. Genes Chromosomes Cancer 2005, 44: Harada T, Baril P, Gangeswaran R, Kelly G, Chelala C, Bhakta V and Caulee K, et al. Identification of genetic alterations in pancreatic cancer by the combined use of tissue microdissection and array-based comparative genomic hybridization. Br J Cancer 2007, 96: Nowak NJ, Gaile D, Conroy JM, McQuaid D, Cowell J, Carter R and Goggins MG, et al. Genome-wide aberrations in pancreatic adenocarcinoma. Cancer Genet Cytogenet 2005, 161: Mahlamäki EH, Kauraniemi P, Monni O, Wolf M, Hautaniemi S and Kallioniemi A. High-resolution genomic and expression profiling reveals 105 putative amplification target genes in pancreatic cancer. Neoplasia 2004, 6: Holzmann K, Kohlhammer H, Schwaenen C, Wessendorf S, Kestler HA, Schwoerer A and Rau B, et al. Genomic DNA-chip hybridization reveals a higher incidence of genomic amplifications in pancreatic cancer than conventional comparative genomic hybridization and leads to the identification of novel candidate genes. Cancer Res 2004, 64: Zhou X, Ruan J, Wang G and Zhang W. Characterization and identification of microrna promoters in four model species. PLoS Comput Biol 2007, 3: e Gruber AR, Lorenz R, Bernhart SH, Neuböck R and Hofacker IL. The Vienna RNA websuite. Nucleic Acids Res 2008, 36: W70 W Zeng Y, Yi R and Cullen BR. Recognition and cleavage of primary microrna precursors by the nuclear processing enzyme Drosha. EMBO J 2005, 24: Han J, Lee Y, Yeom KH, Nam JW, Heo I, Rhee JK and Sohn SY, et al. Molecular basis for the recognition of primary micrornas by the Drosha-DGCR8 complex. Cell 2006, 125: Zeng Y and Cullen BR. Efficient processing of primary microrna hairpins by Drosha requires flanking nonstructured RNA sequences. J Biol Chem 2005, 280: Calin GA, Ferracin M, Cimmino A, Di Leva G, Shimizu M, Wojcik SE and Iorio MV, et al. A microrna signature associated with prognosis and progression in chronic lymphocytic leukemia. N Engl J Med 2005, 353: Raveche ES, Salerno E, Scaglione BJ, Manohar V, Abbasi F, Lin YC and Fredrickson T, et al. Abnormal microrna-16 locus with synteny to human 13q14 linked to CLL in NZB mice. Blood 2007, 109: Meng F, Henson R, Lang M, Wehbe H, Maheshwari S, Mendell JT and Jiang J, et al. Involvement of human micro-rna in growth and response to chemotherapy in human cholangiocarcinoma cell lines. Gastroenterology 2006, 130: Acta Biochim Biophys Sin (2009) Volume 41 Issue 5 Page 413