Evidence for a Hierarchy within Breast Cancer Stem Cells: Relevance to Metastasis and Therapy

Transcription

1 University of Miami Scholarly Repository Open Access Dissertations Electronic Theses and Dissertations Evidence for a Hierarchy within Breast Cancer Stem Cells: Relevance to Metastasis and Therapy Diana Azzam University of Miami, amazindi@hotmail.com Follow this and additional works at: Recommended Citation Azzam, Diana, "Evidence for a Hierarchy within Breast Cancer Stem Cells: Relevance to Metastasis and Therapy" (2012). Open Access Dissertations This Embargoed is brought to you for free and open access by the Electronic Theses and Dissertations at Scholarly Repository. It has been accepted for inclusion in Open Access Dissertations by an authorized administrator of Scholarly Repository. For more information, please contact repository.library@miami.edu.

2 UNIVERSITY OF MIAMI EVIDENCE FOR A HIERARCHY WITHIN BREAST CANCER STEM CELLS: RELEVANCE TO METASTASIS AND THERAPY By Diana J. Azzam A DISSERTATION Submitted to the Faculty of the University of Miami in partial fulfillment of the requirements for the degree of Doctor of Philosophy Coral Gables, Florida August 2012

3 2012 Diana J. Azzam All Rights Reserved

4 UNIVERSITY OF MIAMI A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy EVIDENCE FOR A HIERARCHY WITHIN BREAST CANCER STEM CELLS: RELEVANCE TO METASTASIS AND THERAPY Diana J. Azzam Approved: Joyce Slingerland, M.D., Ph.D. Professor of Medicine and of Biochemistry & Molecular Biology M. Brian Blake, Ph.D. Dean of the Graduate School Zafar Nawaz, Ph.D. Professor of Biochemistry & Molecular Biology Karoline Briegel, Ph.D. Associate Professor of Biochemistry & Molecular Biology Dorraya El Ashry, Ph.D. Associate Professor of Medicine Tan Ince, M.D., Ph.D. Associate Professor of Pathology

5 AZZAM, DIANA (Ph.D., Biochemistry & Molecular Biology) (August, 2012) Evidence for a Hierarchy within Breast Cancer Stem Cells: Relevance to Metastasis And Therapy Abstract of a dissertation at the University of Miami. Dissertation supervised by Joyce M. Slingerland, M.D., Ph.D. No. of pages in text. (92) Accumulating evidence over the past decade has established the existence of a cancer stem cell (CSC) subpopulation within breast cancers that is responsible for tumor initiation, progression and drug resistance. However, few models have characterized phenotypically distinct subsets of cells within CSC populations that may underlie the heterogeneity of tumor responses to standard chemo and radiation therapies. Similarly, despite the widely accepted postulate that CSCs generate metastasis, few studies have demonstrated experimentally the existence of heterogeneity within the CSCs with regard to metastatic potential. The work in this thesis was undertaken to identify whether such discrete subsets exist among CSCs of the most deadly form of breast cancer: that lacking estrogen and progesterone receptors and HER2 amplification (so called triple negative hereafter TNBC). We postulated that, as for normal stem cells, primary TNBC-derived cultures and immortal lines would have a CSC hierarchy with precursor/progeny populations that differ in molecular pathways conferring self-renewal, tumorigenicity and metastatic potential. We show that CSC-enriched CD44 + CD24 neg/low breast cancer cells comprise a functional hierarchy: a minor CD44 + CD24 low+ subpopulation generates CD44 + CD24 neg progeny with reduced self-renewal and tumorigenicity. In both triple negative breast

6 cancer (TNBC) lines and primary dissociated tumor (DT) cultures, CD44 + CD24 low+ generate more tumor spheres, while CD44 + CD24 neg -generated spheres decline with serial passage. Tumor-initiating CSCs were more frequent in CD44 + CD24 low+ : fewer cells yielded orthotopic xenograft tumors with reduced latency. Furthermore, metastasis arose exclusively from CD44 + CD24 low+ cells which preferentially express embryonic stem cell gene profiles and metastatic gene signatures. CD44 + CD24 low+ but not CD44 + CD24 neg cells express Notch-1 intracellular domain (N1-ICD) and a Notch-activated gene profile. N1-ICD transactivates SOX2 mediating Sox2-dependent increases in the percentaged of ALDH1+, CD44 + CD24 low+ and sphere forming cells. ϒ -Secretase Inhibitors (GSI) that block Notch pathway activation notably reduced serial sphere formation and xenograft growth from CD44 + CD24 low+ cells while CD44 + CD24 neg showed no response. While Notch family members are implicated in stem cell self-renewal many cancers, the existence of stem cell hierarchies such as that observed herein could limit potential GSI efficacy.

7 TABLE OF CONTENTS Page LIST OF FIGURES... LIST OF TABLES... ABBREVIATIONS... PUBLICATION NOTE... vii x xi xii CHAPTER 1: INTRODUCTION Defining properties of normal stem cells The cancer stem cell model Stochastic versus stem cell model Evidence from leukemia supporting malignant stem cells Evidence for solid tumor stem cells Isolation and enrichment of breast cancer stem cells Side population technique Tumorsphere technique Surface markers The Aldefluor assay Use of cell lines to study breast cancer stem cells Heterogeneity within cancer stem cell subpopulations Cancer stem cells may have a metastatic hierarchy Resistance of cancer stem cells to standard chemotherapy and radiation Signaling pathways in cancer stem cell biology iii

8 1.8.1 Notch signaling pathway Role of embryonic transcription factors in cancer stem cells Sox Clinical implications of cancer stem cells Summary CHAPTER 2: MATERIALS AND METHODS Materials Methods CD44 and CD24 staining Aldefluor assay Flow sorting of CD44 + CD24 neg and CD44 + CD24 low+ cells Sphere formation assay and growth in soft agar Drug effects on proliferation Western analysis Chromatin immunoprecipitation assay In vivo tumorigenicity In vivo imaging Microarray data acquisition and analysis Microarray data processing and normalization Gene set enrichment analysis N1-ICD overexpression and sirna transfections Quantitative real-time PCR MicroRNA profiling iv

9 Statistical analyses CHAPTER 3: EVIDENCE FOR A FUNCTIONAL AND MOLECULAR HIERARCHY WITHIN BREAST CANCER STEM CELLS IN TRIPLE NEGATIVE BREAST CANCERS Summary Background Results Identification of two distinct stem cell subpopulations in TNBC lines and primary dissociated tumors CD44 + CD24 low+ cells can self-renew and give rise to CD44 + CD24 neg progeny CD44 + CD24 low+ have a higher proportion of tumor-initiating cells than CD44 + CD24 neg Metastasis arose uniquely from CD44 + CD24 low+ generated tumors CD44 + CD24 low+ cells preferentially express lung and brain metastatic profiles CD44 + CD24 low+ show activated Notch1 and higher embryonic stem cell gene expression Self-renewal in the CD44 + CD24 low+ cells is regulated via a Notch1- mediated Sox2 activation Differential sensitivity to ϒ-secretase inhibitors in CSC populations Discussion CHAPTER 4: SUMMARY AND FUTURE DIRECTIONS Summary Future Directions Therapeutic strategies to target signaling v

10 pathways preferentially activated in the CD44 + CD24 low+ compared to CD44 + CD24 neg breast CSCs Preliminary results Therapeutic relevance of differential MEK/MAPK, Src and PI3-K/mTOR pathway activation Future Directions Investigating the functional roles of micrornas in the CD44 + CD24 low+ breast CSCs Introductory remarks Preliminary results Investigating the role of mirnas in mediating chemoresistance of CD44 + CD24 low+ cells Functional analysis of new mirnas as potential mediators of self-renewal and metastasis in CD44 + CD24 low+ cells Concluding remarks REFERENCES vi

11 LIST OF FIGURES FIGURE 1.1: Development of hematopoietic stem cells 3 FIGURE 1.2: Model of the epithelial cell hierarchy in the normal 4 mammary gland FIGURE 1.3: Two models for tumor heterogeneity and propagation 5 FIGURE 1.4: Illustration of the normal and leukemic hematopoietic 8 hierarchy FIGURE 1.5: The Notch signaling pathway 21 FIGURE 3.1: Representative CD44/CD24 profiles for 43 ER positive and ER negative breast cancer cell lines and TNBC-derived dissociated tumor cultures FIGURE 3.2: CD44 + CD24 low+ and CD44+CD24 neg population 44 characteristics. FIGURE 3.3: Enhanced self-renewal potential of CD44 + CD24 low+ 45 than CD44 + CD24 neg FIGURE 3.4: CD44 + CD24 low+ and CD44+CD24 neg population 46 characteristics in DT-23 and DT-25 FIGURE 3.5: CD44 + CD24 low+ give rise to both CD44 + CD24 low+ 48 and CD44 + CD24 neg progeny while CD44 + CD24 neg yield only CD44 + CD24 neg FIGURE 3.6: CD44 + CD24 low+ give rise to both CD44 + CD24 low+ 49 and CD44 + CD24 neg progeny while CD44 + CD24 neg yield only CD44 + CD24 neg vii

12 FIGURE 3.7: CD44 + CD24 neg spheres contain only CD44 + CD24 neg 50 cells while CD44 + CD24 low+ spheres contain both FIGURE 3.8: CD44 + CD24 low+ generate orthotopic tumors with 52 shorter latency than CD44 + CD24 neg FIGURE 3.9: Metastasis arose uniquely from CD44 + CD24 low+ 53 -generated tumors FIGURE 3.10: CD44 + CD24 low+ cells preferentially expressed 54 lung and brain metastasis signatures FIGURE 3.11: Notch1-ICD and embryonic transcription factors 56 are preferentially expressed in CD44 + CD24 low+ FIGURE 3.12: Notch1-mediated Sox2 activation governs 58 stem cell-like phenotype CD44 + CD24 low+ cells. FIGURE 3.13: ϒ -secretase inhibitors target CD44 + CD24 low+ 59 but not CD44 + CD24 neg population FIGURE 3.14: ϒ -secretase inhibitors attenuate self-renewal in 60 CD44 + CD24 low+ but not CD44 + CD24 neg FIGURE 3.15: ϒ -secretase inhibitors target CD44 + CD24 low+ 61 but not CD44 + CD24 neg population FIGURE 4.1: Activation of MAPK, PI3-K and Src pathways 71 in the CD44 + CD24 low+ cells FIGURE 4.2: mirna expression profiling in the CD44 + CD24 low+ 76 and CD44 + CD24 neg from MDA-MB-231 and primary DT-23 viii

13 FIGURE 4.3: Standard chemotherapy enriches for 77 CD44 + CD24 low+ cells FIGURE 4.4: Direct interaction networks of mirnas and 78 their common target genes represented in the CD44 + CD24 low+ cells compared to CD44 + CD24 neg cells ix

14 LIST OF TABLES TABLE 1.1: Pathways involved in CSC self-renewal 19 TABLE 2.1: Cell lines 26 TABLE 2.2: Primary Dissociated tumors 27 TABLE 2.3: Reagents 28 TABLE 2.4: Oligonucleotide sequences 29 x

15 ABBREVIATIONS AML ALDH1 BRCA1 CSC CML DT ER ESA EMT GSI HSC LSC MMP mirna N1-ICD PTEN SP SOX2 TNBC Acute myeloid leukemia Aldehyde dehydrogenase enzyme Breast cancer type 1 susceptibility protein Cancer stem cell Chronic myeloid leukemia Dissociated tumors Estrogen receptor Epithelial specific antigen Epithelial to mesenchymal transition Gamma secretase inhibitors Hematopoietic stem cell Leukemic stem cell Matrix metalloproteinases MicroRNA Notch-1 intracellular domain Phosphatase and tensin homolog Side-population Sex determining region Y-box2 Triple-negative breast cancer xi

16 PUBLICATION NOTE Chapter 1: INTRODUCTION A version of this chapter will be submitted as a Review article for publication in Breast Cancer Research and Treatment Chapter 3: EVIDENCE FOR A FUNCTIONAL AND MOLECULAR HIERARCHY WITHIN BREAST CANCER STEM CELLS IN TRIPLE NEGATIVE BREAST CANCERS A version of this Chapter was submitted to Cancer Discovery in May 2012 and is currently under review as: Evidence for a functional and molecular hierarchy in tumor-initiating stem cells in triple-negative breast cancer: relevance to metastasis and therapy Diana J. Azzam 1, Katherine Drews-Elger 2, Dekuang Zhao,3, Candace Gilbert 4, Prathibha Ranganathan 5, Xiaoqing Han 6, Jun Sun 7, Andy J. Minn 8, Chendong Pan 9, Seth A. Wander 10, Anthony J. Capobianco 11, Dorraya El-Ashry 12, and Joyce M. Slingerland 13 1 First author designed all studies and performed experimental work, interpreted results, and wrote the manuscript. 2 Assisted in experimental work for Figures 3.1, 3.2, Assisted in animal experimental work for Figures 3.5. Generated DT-22 cells expressing luciferase for Figure 3.9F&G and assisted with this work?. 4 Assisted in animal experimental work for Figures 3.9F &G. 5 Generated MDA-MB-231 stably expressing N1-ICD and did experiment shown in Figure 3.8 A&B 6 Performed experimental work for Figure 3.8B 7 Performed experimental work for Figure 3.8D&E 8 Provided luciferase-tagged MDA-MB-231 and Performed microarray expression data analysis for Figures 3.5 & Assisted in animal experimental work for Figure 3.9F &G 10 Assisted in animal experimental work for Figure 3.9F &G 11 Collaborating Principle Investigator, assisted in conception of experiment for Fig Collaborating Principle Investigator, generated and provided the primary dissociated tumor cultures and assisted in conception of experiments using those cells 13 Supervisor, Mentor and Principal Investigator. xii

17 CHAPTER 1 INTRODUCTION There is increasing evidence that diverse solid tumors are hierarchically organized and sustained by a distinct subpopulation of tumorigenic cancer stem cells (CSC). The CSC hypothesis may ultimately lead to improved understanding of cancer biology and new approaches for cancer treatment. The work described in this thesis supports the CSC hypothesis and herein, we demonstrate the existence of distinct CSCs subsets in the most aggressive form of breast cancers (triple-negative or TNBC) whose tumorigenic and metastatic properties support the existence of a hierarchy within TNBC CSC. Our findings also support a critical role for CSCs in metastatic breast cancer progression. These observations in TNBC suggest a model in which two distinct subsets of CSCs may coexist in the same cancer: CD44 + CD24 neg cells, that have a reduced capacity to selfrenew and are generated by a CD44 + CD24 low+ progenitor population that can both selfrenew and form metastasis with a higher frequency. We demonstrate a lineage relationship between these two subsets in which the CD44 + CD24 low+ metastatic CSCs can give rise to CD44 + CD24 neg cells, but not vice-versa, suggesting that the expression of CD24 may be linked to the potential to form metastasis. The following provides a review of the areas relevant to this work including the current evidence for the existence of cancer stem cells in solid tumors, the presence of a hierarchy of stem/progenitor subsets in the normal mammary gland, role of cancer stem cells in metastasis. I also review the commonly used approaches for isolating breast cancer stem cells, and characteristics of breast cancer stem cells including signaling 1

18 2 pathways, self-renewal pathways, resistance to cancer drugs and expression of embryonic transcription factors of potential importance to cancer stem cell self-renewal. 1.1 DEFINING PROPERTIES OF NORMAL STEM CELLS To understand the biology of cancer stem cells, it is useful to review the unique properties of normal stem cells. Two essential properties of normal stem cells are their ability to self-renew and their multilineage differentiation. Stem cells give rise to progeny with increasing degrees of differentiation accompanied by reduced potential for selfrenewal. Stem cells undergo semi-conservative cell division that enables a stem cell to produce another identical stem cell with the same development and replication potential, and also to yield a daughter cell committed to further differentiation with reduced potential for self-renewal. In the hematopoietic system, stem cells exist in a hierarchy with differing potential for self-renewal. Hematopoietic stem cells (HSCs) can be divided into three different populations: long-term self-renewing HSCs which give rise to short-term self-renewing HSCs which in turn give rise to multipotent progenitors that eventually form mature differentiated cells. As HSCs mature from the long-term selfrenewing pool to multipotent progenitors, they progressively lose their potential to selfrenew generating more differentiated progeny (Reya et al., 2001).

19 3 Self-renewal Lymphocytes Granulocytes Platelets Long-term self-renewing HSCs Short-term self-renewing HSCs Multipotent progenitors Oligolineage progenitors Monocytes/ Macrophages Red cells Differentiated cells Figure 1.1: Development of hematopoietic stem cells. HSCs can be subdivided into long-term self renewing HSCs, short-term self renewing HSC and multipotent progenitors which give rise to differentiated cells. The stem cells in normal tissue compartments and putative cancer stem cells share the ability to self-renew and many pathways that regulate normal stem cell development have also been associated with cancer. Key pathways include the sonic hedgehog, Notch, and Wnt pathways and other key regulators include Bmi-1, phosphatase and tensin homolog (PTEN) and p53. These pathways are frequently deregulated during tumor development, and thus believed to lead to or reflect deregulation of stem cell self-renewal and to contribute to neoplastic proliferation (Molofsky et al., 2004). Although normal stem cells have the capacity for self-renewal, most stem cell populations are relatively quiescent; that is, they have proliferative capacity but largely remain in a state of G 0 -like cell cycle arrest, until tissue damage or cell loss leads to their highly regulated recruitment into cycle to initiate tissue regeneration (Boyer and Cheng, 2008).

20 4 In addition to the above mentioned properties, stem cells express drug transporters, DNA repair systems, and are refractory to many triggers of programmed cell death. In the normal development of the mouse and human mammary gland, there appear to be several distinct populations of stem/progenitor cells that display different degrees of commitment with a hierarchy of stem and progenitor cells, analogous to that in the hematopoietic system. The long-term self-renewing stem cell expresses high levels of integrins that mediate interactions between these basal cells and the surrounding matrix. Experimental data also support the existence of short-term self-renewing stem cells downstream of the long-term self-renewing stem cell (Visvader and Lindeman, 2006). As they become further committed, these become transit-amplifying progenitors that express bipotential markers which then differentiate into mature luminal or myoepithelial cells (Figure 1.2) (Woodward et al., 2005). Figure 1.2: Model of the epithelial cell hierarchy in the normal mammary gland. A hierarchy of stem/progenitor cells may exist in the mammary gland, differing in their activation state and self-renewing ability (Adapted from Visvader and Lindeman, 2008).

21 5 1.2 THE CANCER STEM CELL MODEL Stochastic versus stem cell model Intense research in cancer biology aims to understand the cellular mechanisms underlying tumor heterogeneity. Cancers and other solid malignancies have long been known to contain cells that exhibit distinct proliferative and differentiative capacities. At least two models have been put forward to account for the heterogeneity present in solid tumors-(a) the Stochastic/Clonal evolution model (Nowell, 1986) and (b) the Cancer stem cell model (Clarke et al., 2006). Figure 1.3: Two models for tumor heterogeneity and propagation A, Stochastic model where most cells can proliferate extensively and have similar potential to form new tumors, B, Cancer stem cell model in which only the cancer stem cells (CSC; yellow) has the ability to proliferate extensively and form new tumors The first model, known as the stochastic model, states that all cells in a tumor can proliferate extensively and have similar potential to form new tumors (Figure 1.3A). However, early observations in both liquid and solid tumors showed that not all tumor cells have equal tumorigenic potential in experimental assays. Usually, less than 1% of primary tumor cells can be cultured in vitro and even fewer cells can give rise to colonies

22 6 in soft agar. Very few cells are able to form tumors when transplanted into immunodeficient mice. These observations led to the notion that there may be a hierarchy in tumors were only a subset of cells within a tumor, called tumor-initiating stem cells or cancer stem cells is able to self-renew and to proliferate extensively to give rise to a new tumor at a different site (Hamburger and Slamon, 1977). Thus, the cancer stem cell model (Figure. 1.3B) proposes a hierarchical organization of cells within the tumor, in which the CSC (in yellow) undergoes asymmetric division to give rise to a daughter CSC and a cell of more limited proliferative potential. These CSC are able to sustain tumor growth. Both the stochastic and CSC tumor propagation models may have relevance to human cancer but only the CSC model is hierarchical. It is important to note that the clonal evolution and stem cell models are not mutually exclusive and within stem cell populations, clonal evolution may generate stem cells with increasing potential to invade, metastasize and evade cancer therapies. (Visvader and Lindeman, 2008; Magee et al., 2012). CSCs themselves may undergo clonal evolution to give rise to progeny of greater malignant potential due to genomic instability and the acquisition of additional genetic or epigenetic changes. A more dominant daughter CSC may emerge if a mutation confers more aggressive self-renewal or growth (Barabe et al., 2007) Evidence from leukemia supporting malignant stem cells Evidence supporting a hierarchical model of cancer stem cells came from extensive work done in leukemia. Acute myeloid leukemia (AML) is organized as a hierarchy of distinct, functionally heterogeneous classes of cells that is ultimately sustained by a small number of leukemia stem cells (LSCs). The cells capable of

23 7 initiating human AML in NOD/SCID (non-obese diabetic/severe combined immunodeficiency) mice have a CD34 + CD38 neg phenotype (Lapidot et al., 1994) similar to that of normal HSCs in many respects (Bonnet and Dick, 1997) (See Figure 1.4). Disruption of pathways regulating self-renewal and differentiation through the acquisition of transforming mutations generates LSCs capable of sustaining growth of the leukemic clone in vivo. In addition, a transformation event may occur in progenitor cells rather than the most primitive hematopoietic cells (See Figure 1.4). Experiments using mouse models generated from expression of transgenes in the restricted progenitor population developed leukemias that resembled chronic myeloid leukemia (Lagasse and Weissman, 1994). Subsequently, leukemic stem cells have revealed heterogeneity in their ability to repopulate secondary and tertiary recipients, pointing to the existence of distinct classes of LSC with differing self-renewal capacity, similar to what is seen in the normal HSC (Wang and Dick, 2005). It is also formally possible that cancer stem cells may originate from other cell types in addition to normal stem cells. Cancer stem cells could also be derived from mature cells that have undergone a de-differentiation or a trans-differentiation process. Weinberg and colleagues demonstrated that differentiated populations of normal human breast cells can be made to undergo Epithelial to Mesenchymal transition (EMT) following sustained expression of the transcription factors Snail or Twist and generate cells with characteristics of cancer stem cells (Mani et al., 2008).

24 8 Figure 1.4: Illustration of the normal and leukemic hematopoietic hierarchy. There is evidence that leukemias can arise from different points in the HSC hierarchy (Adapted from Reya et al & Wang and Dick, 2005) Similar to the what has been described in leukemias, various models have been proposed in which human breast cancers arise from stem/progenitor populations with both self-renewal and different types of lineage commitment (Polyak, 2007; Visvader and Lindeman, 2008) but much experimental work remains to be done to confirm proposed models.

25 Evidence for solid tumor stem cells Although significant progress was made in leukemia stem cell research, it was several years before experimental evidence for solid tumor stem cells, breast cancer stem cells, was reported by Clarke and colleagues in 2003 (Al Hajj et al., 2003). These authors isolated a population of cells from primary human breast cancer specimens, that expressed CD44 + CD24 neg/low ESA + surface markers and had very high capacity to form tumors following transplantation into NOD/SCID mice. As few as one hundred CD44 + CD24 neg/low ESA + cells were able to form tumors, whereas tens of thousands of the CD44 neg CD24 + cells did not. Since then, cells with cancer stem cell properties have been characterized in many different types of human tumors, including brain tumors (Singh et al., 2004), colon cancer (Ricci-Vitiani et al., 2007), prostate cancer (Collins et al., 2005), head and neck cancer (Prince et al., 2007), melanoma (Fang et al., 2005), pancreatic cancer (Li et al., 2007) and lung cancer (Eramo et al., 2008). 1.3 ISOLATION AND ENRICHMENT OF BREAST CANCER STEM CELLS Cancer stem cells are proposed to have the ability to self-renewal and to generate the heterogeneous tumor population. Four methods, described below, have been used to demonstrate the presence of, or enrich for, breast cancer stem cells (Charafe-Jauffret et al., 2008). Stem cell populations are enriched for several features that can be identified experimentally. These are detected by methods that include (a) the existence of a side population (SP, see below), (b) the ability to form tumorospheres or mammospheres from single cells (c) expression of discrete surface marker expression profiles, (d) enzymatic activity of ALDH1 that can be detected using an Aldefluor assay and finally,

26 10 (e) the ability to generate tumors upon transplantation into immunodeficient mice. Each method has its advantages and limitations. A standard method to show enrichment for human CSC is to carry out limiting dilution assays to show that an experimental population is enriched for cells with the ability to form tumors on xenotransplant Side Population (SP) Technique Stem cells have been shown to exclude Hoechst through expression of transmembrane ATP-binding transporter molecules. These cells do not exclude Hoechst in presence of verapamil, an ATP-binding protein inhibitor (Zhou et al., 2007). However, since Hoechst dye is toxic to cells, stem populations defined as such by this method cannot be readily propagated for further analysis of functional characteristics after sorting Tumorsphere (Mammosphere) Technique This is a cell culture technique adapted for breast tumor tissue based on the mammosphere culture, which was used to isolate and expand normal breast stem/progenitor cells (Dontu et al., 2003). This technique is based on the property of stem/progenitor cells to survive and proliferate in non-adherent and serum-free culture conditions, while more differentiated cells undergo anoikis and die in these conditions. While the sphere is thought to arise from a single progenitor cell, once formed, the sphere population is heterogeneous and comprised of cells with more limited self-renewal and more differentiated phenotypes. Only a minority of cells within the spheres has selfrenewal ability and represents stem cells. Thus, while the formation of the mammosphere

27 11 is indicative of a stem cell phenotype, the resulting population is no longer comprised of a pure stem population, but includes the CSC more differentiated progeny (Magee et al., 2012) Surface Markers (CD44 + CD24 neg/low ) Isolation or demonstration of cells with a putative cancer stem phenotype by surface marker characteristics has been commonly used to demonstrate putative cancer stem cells, but in the absence of additional functional assays, does not fully define cancer stem cells. The first surface markers shown to enrich for breast cancer stem cells were CD44 + CD24 neg/low CD44 is a cell surface receptor for hyaluronic acid, and regulates cell migration and adhesion when interacting with other ligands including osteopontin (OPN), collagens, and matrix metalloproteinases (MMPs). CD44 expression in primary tumors has been linked to aggressive behavior and tumor metastasis, supporting the idea that these stem-like, tumor-initiating cells may also be the cells that survive to form clinically relevant metastases (Yang et al., 2008; Shipitsin et al., 2007). Recently, the Weinberg group demonstrated that CD44 expression is essential for the growth and tumor-initiating ability of highly tumorigenic mammary epithelial cells. Their data indicate that CD44 is a key tumor-promoting agent in transformed tumor cells lacking p53 function. Derepression of CD44 resulting from inactivation of p53 appears to aid the survival of immortalized, premalignant cells (Godar et al., 2008). CD44 regulates adhesion, motility, and proliferation, and its expression is associated with spontaneous metastasis from human breast cancer orthotopic xenograft models (Liu et al., 2010).

28 12 CD24 is a small, heavily glycosylated cell-surface protein linked to the membrane via a glycosylphosphatidylinositol (GPI-) anchor and it localizes in lipid rafts. In contrast to CD44, the relationship between CD24 surface expression and stemness differs between solid tumors. Overexpression of this heavily glycosylated cell-surface protein increases proliferation and migration (Aigner et al., 1998). While surface CD24 is observed in subsets of CSC from liver (Lee et al., 2011), colon (Yeung et al., 2010) and pancreas (Li et al., 2007), the CSC phenotype CD44 + CD24 low/neg of primary breast cancers is depleted for CD24 (Al Hajj et al., 2003). This contrasts with normal mammary progenitors, which express CD24 (Pece et al., 2010). In addition, there are reports associating CD24 expression with breast cancer progression and metastasis (Bircan et al., 2006). Immunohistochemical analysis of seventy patients with invasive breast carcinomas showed that increased overall and cytoplasmic expression of CD24 was correlated with adverse prognostic factors and worse survival rates (Athanassiadou et al., 2009). It is noteworthy that Polyak and colleagues observed an increase in the proportion of CD24 + cells in metastasic cancer tissues compared to primary tumors (Shipitsin et al., 2007). In an effort to elucidate the role of CD24 surface expression in breast cancer stem cell biology, we investigated in the work of this thesis the relative contributions of CD24 negative versus low CD44 + subpopulations to breast cancer stem cell potential The Aldefluor Assay This method was recently used to isolate stem/ progenitor cells from normal and malignant mammary epithelia. It is based on enzymatic activity of aldehyde dehydrogenase 1 (ALDH1), a detoxifying enzyme that oxidizes intracellular aldehydes,

29 13 which may have a role in early differentiation of stem cells through its role in oxidizing retinol to retinoic acid. High ALDH1 activity was shown to select for both normal and tumorigenic human mammary epithelial cells with stem/progenitor properties (Ginestier et al., 2007). This group also showed that immunohistochemical expression of ALDH1 protein in primary breast tumors was a predictor of poor clinical outcome. Recovery of cells with ALDH activity allows non-toxic and efficient isolation of human stem-like cells based on a developmentally conserved stem/progenitor cell function. It is noteworthy that CSC subpopulations defined by CD44 + CD24 neg/low and ALDH1 + showed little overlap in breast tumors. At the time this thesis work was initiated, it was not clear how these two assays relate to each other and whether they individually or both describe different CSC populations in different breast cancer subtypes. 1.4 USE OF CELL LINES TO STUDY BREAST CANCER STEM CELLS Development of therapies directed at CSC specific pathways, abrogation of chemoresistance and induction of differentiation await further molecular characterization of CSC subsets. A challenge inherent to the field is the difficulty of isolating viable cells with stem cell phenotypes from solid tumors in sufficient quantity to permit their molecular characterization. Recent studies and my own thesis work suggest that although cell lines may be clonally derived, they contain a cellular hierarchy analogous to those found in primary breast tissue that may represent cells with different degrees of selfrenewal/loss of replicative capacity. Thus, use of breast cancer cell lines may permit isolation of greater numbers of CSC subpopulations for functional characterization

30 14 (Sheridan et al., 2006; Fillmore and Kuperwasser, 2008; Croker et al., 2008; Charafe- Jauffret et al., 2009). Kuperwasser and colleagues found that the percentage of CD44 + CD24 neg/low cells within human breast cancer cell lines did not correlate with tumorigenicity in nude mice, rather the ESA+ fraction of CD44 + CD24 -/low better identified the stem phenotype, and as few as 100 CD44 + CD24 neg/low ESA + cells could form xenograft tumors. CD44 + CD24 neg ESA + cells can self-renew, reconstitute the parental cell line, divide very slowly and thus retain BrdU on long-term labeling, and preferentially survive chemotherapy (Fillmore and Kuperwasser, 2008). CSC populations were isolated based on the ALDH1 enzymatic activity from thirty three different breast cancer cell lines displayed stem cell properties in vitro and in NOD/SCID xenografts (Charafe-Jauffret et al., 2009). ALDH1 + CD44 + CD24 low/neg subpopulations in breast cancer lines demonstrated enhanced metastasis relative to ALDH1 - CD44 - CD24 + in xenografts (Croker et al., 2008). However, ALDH1 - populations could also generate lung micrometastasis, thus metastatic potential is not exclusive to ALDH1+ populations, which may represent only a fraction of CSCs. Hence, the use of cell lines can facilitate recovery of CSC in sufficient numbers to permit the characterization of regulatory pathways of cancer stem cells and identify potential stem cell markers and therapeutic targets. 1.5 HETEROGENEITY WITHIN CANCER STEM CELL POPULATIONS Leukemic cells are not functionally homogenous but, like the normal hematopoietic system, comprise distinct hierarchically arranged leukemic stem cell

31 15 classes with different self-renewal potential (Hope et al., 2004). Phenotypic heterogeneity within CSC subpopulations from solid tumors is likely to exist analogous to what is observed in leukemic stem cells. For most of the primary tumors analyzed by El Hajj et al., the tumor initiating CSC were enriched in populations with the CD44 + CD24 neg/low ESA+ surface marker phenotype. However, in one patient s primary breast cancer, with a generally more aggressive type of adenocarcinoma, the tumorigenic cell population was noted to be CD44 + CD24 + ESA + (Al Hajj et al., 2003). In this tumor, there may have been a distinct CSC subpopulation. In gliomas, CD133 + cells were similarly tumorigenic to CD133 neg cells in nude mice, although CD133 neg tumor cells appeared to have a distinct molecular profile. However, long-term self-renewal was not measured in this study (Beier et al., 2007). The CSC phenotype may not necessarily be uniform between cancer subtypes or even within tumors of the same subtype. Furthermore, cell lines derived from Brca1-deficient mouse mammary tumors were shown to harbor heterogeneous cancer stem cell populations; subpopulations with either CD44 + CD24 neg or CD133 + cells of the Brca1-deficient cancers could elicit tumors in immunocompromised mice when injected in low cell numbers (Wright et al., 2008). Significantly, there was no overlap between the CD44 + CD24 neg and CD133 + populations, suggesting that heterogeneity exists within the putative CSC populations of Brca1 tumors. This heterogeneity may potentially result from different cells of origin and/or different mutation profiles in these. Thus, distinct subset of CSCs with different selfrenewal potential may co-exist and it is essential to accelerate research aimed at identifying them. This should facilitate the identification of suitable targets for the development of strategies aimed at cancer prevention and therapy.

32 CANCER STEM CELLS MAY HAVE A METASTATIC HIERARCHY Metastasis is the most deadly feature of cancer, accounting for greater than 90% of cancer-related mortality. The invasion-metastatic cascade is a complex, multistep process involving the escape of neoplastic cells from a primary tumor (local invasion), intravasation into the systemic circulation, survival during transit through the vasculature, extravasation into the parenchyma of distant tissues, the establishment of micrometastases, and ultimately the outgrowth of macroscopic secondary tumors (colonization) (Fidler, 2003). Since it is thought that CSC may be uniquely endowed with enhanced metastatic potential, a better understanding of CSCs may inform our understanding of the dissemination and metastasis of solid tumors. Most of the studies to date have established the role of CSCs in initiating tumor development. However, the role of CSCs in human cancer metastasis is less well studied. A fundamental question is whether the cells that are enriched for tumorigenic activity in xeno-transplantation assays are also enriched for the capacity to metastasize. In breast cancer, marker defined populations appear to be enriched for both tumor initiating and metastatic ability. ALDH1 + CD44 + CD24 low/neg subpopulations in breast cancer lines yielded more xenograft metastasis than ALDH1 - CD44 - CD24 + (Croker et al., 2008), but metastatic potential was not exclusive to the very low % ALDH1 + population. Furthermore, marker defined subpopulations that reliably show increased metastasis have not been previously defined. CSC subsets within a cancer may vary not only in their self-renewal potential, but also in their ability to successfully engage different metastatic niches (Dalerba et al., 2007). That subsets of CSC may differ in their potential to generate metastasis is

33 17 supported by the observation in pancreatic cancer, in which both the CD133 + CXCR4 - and CD33 + CXCR4 + fractions were capable of sustaining tumor growth, but only CD133 + pancreatic CSC expressing CXCR4 could generate lung metastasis. Those lacking CXCR4 did not (Hermann et al., 2007). Another example of a metastatic hierarchy in CSC was provided by Pang and colleagues, who showed that within colon cancer CSC, the CD26 + subset of CD133 + CD44 + cells showed a high rate of liver metastasis from orthotopic cecal implants, while CD26 negative xenografts were confined to the cecum and failed to establish metastasis (Pang et al., 2010). Similarly, both CD90 + CD44 - cells and CD90 + CD44 + in hepatocellular carcinoma cell lines displayed tumorigenic capacity while only the CD90 + CD44 + cells demonstrated a more aggressive phenotype and formed lung metastasis (Yang et al., 2008). From the above, it can be seen that a growing body of evidence supports the existence of cancer stem cell subsets with differing metastatic ability, but the identification and characterization of CSC subsets that consistently metastasize presents a challenge. The work of my thesis was undertaken in an effort to characterize phenotypically related CSC subsets in triple negative breast cancer models. My work has yielded new evidence to suggest that a metastatic hierarchy may be present in CSC from this type of tumor also (see Chapter 3). 1.7 RESISTANCE OF CANCER STEM CELLS TO STANDARD CHEMOTHERAPY AND RADIATION Most traditional cytotoxic chemotherapeutic agents act by killing bulk replicating cancer cells. This traditional approach may be inadequate for eradication of the

34 18 population of quiescent, non-cycling cells in the tumor. The resistance of CSCs to chemotherapeutic drugs has been demonstrated in many different types of tumors including breast CSCs (Yu et al., 2007; Li et al., 2008; Calcagno et al., 2010; Tanei et al., 2009; Levina et al., 2008). Following neoadjuvant chemotherapy, the proportion of CD44 + CD24 neg/low was significantly higher in breast tumors than untreated ones, suggesting that the CSC component of these tumors was resistant to cytotoxic therapy (Yu et al., 2007; Li et al., 2008). The escape of CSCs from treatment induced death has been attributed to membrane expression of drug transporters and postulated to reflect greater quiescence of the CSC, permitting repair and regeneration after DNA damage (Frank et al., 2010; O'Brien et al., 2009). Because of these mechanisms, CSCs may not only take up fewer drugs, but also show less cell death due to increased repair systems and therefore resist most traditional chemotherapies. There is evidence that the CSC survive to re-populate and generate disease recurrence. From a clinical perspective, the CSC concept has significant implications, as these cells need to be eradicated to achieve long-term diseasefree survival. 1.8 SIGNALING PATHWAYS IN CANCER STEM CELL BIOLOGY Because both normal tissue and cancer stem cells must undergo self-renewal, it has been postulated that they may share some molecular mechanisms that regulate this critical stem cell function. Multiple crucial pathways have been elucidated that govern self-renewal in both cancer stem cells and their normal counterparts (Table 1.1).

35 19 In particular, developmental pathways which regulate normal stem cell selfrenewal, including Notch, Wnt and Sonic hedgehog (Shh) pathways are increased in many cancer stem cell populations and in some cases, have been shown to be required for self-renewal. Table 1.1 Pathways involved in CSC self-renewal Pathway Cancer Reference Notch Hedgehog WNT BMI1 Breast Cancer Glioblastoma Breast Cancer Pancreatic Cancer Glioblastoma Breast Cancer Colon Cancer Breast Cancer AML (Sansone et al., 2007) (Gilbert et al., 2010) (Liu et al., 2006) (Li et al., 2007) (Clement et al., 2007) (Korkaya et al., 2008) (Chiba et al., 2006) (Lui et al. 2006) (Lessard and Sauvageau, 2003) PTEN Breast Cancer (Zhou et al., 2007) BMP Glioblastoma (Piccirillo et al., 2006) TGF-β Breast Cancer (Shipitsin et al., 2007) Ras/MAPK Breast Cancer (Lui et al. 2006) In addition, developmental pathways and cell survival pathways, such as the NFκB and PI3K pathways, have been reported to be preferentially activated in breast cancer stem cells (Zhou et al., 2007). The mechanisms that activate survival pathways in cancer stem cells are still largely unknown and further studies are needed to confirm these finding and to determine the functional consequences of preferential pathway activation in CSCs compared to the remaining population within a tumor or cell line.

36 Notch Signaling Pathway Different Notch family members have been implicated in stem cell self-renewal (Wang et al., 2009) and play critical roles in embryogenesis and in fate determination in mammogenesis (Bouras et al., 2008; Raouf et al., 2008). Four Notch receptors have been identified to date in mammals (Notch-1 to -4). Five Notch ligands have been found in mammals: Dll-1 (Delta-like 1), Dll-3 (Delta-like 3), Dll-4 (Delta-like 4), Jagged-1 and Jagged-2 (Wang et al. 2009). An overview of the Notch signaling pathway is shown in Figure 1.5. Notch signaling is initiated by binding of the Notch transmembrane receptor on one cell to its specific ligand located on a neighboring cell. Upon activation, Notch is cleaved, releasing the Notch intracellular domain (NICD) through a cascade of proteolytic cleavages by the metalloprotease tumor necrosis factor-a-converting enzyme (TACE) and ϒ-secretase complex. The NICD can subsequently translocate into the nucleus for transcriptional activation of Notch target genes1. Inhibiting ϒ-secretase function using DAPT, for example, prevent the cleavage of the Notch receptor, resulting in blocking the Notch signal transduction signaling (Wang et al. 2010). Notch 1 and 4 are pro-viral integration sites in mammary tumors (Pannuti et al., 2010) and Notch 4 upregulation was observed in mammary CSC in primary ER+ cancers (Harrison et al., 2010). Notch1 overexpression in breast cancer is correlated with worse prognosis (Stylianou et al., 2006; Reedijk et al., 2005). Moreover, constitutive Notch signaling in the mouse mammary gland was found to specifically target luminal-restricted progenitor cells for expansion and self-renewal, leading to hyperplasia and eventual tumorigenesis. These data implicate the luminal progenitor as a potential cell of origin of

37 21 Figure 1.5: The Notch signaling pathway (Adapted from Wang et al. 2010). Notch activation involves the proteolytic cleavage of the Notch ligand/receptor complex by ϒ-secretase to release the Notch intracellular domain fragment (NICD) that translocates to the nucleus and upregulates expression of Hey, Hes, and other genes. tumors in which the Notch pathway has been activated inappropriately (Bouras et al., 2008). These observations have led to the generation and testing of ϒ-secretase inhibitors such as MK-0752 (Merck) and RO (Roche) for potential use as CSC targeted therapies for cancer. Indeed, several of these agents are entering Phases I-II clinical trials for breast cancer.

38 ROLE OF EMBRYONIC TRANCRIPTION FACTORS IN CANCER STEM CELL Several embryonic stem (ES) cell transcription factors known to drive ES selfrenewal and induce pluripotency, including Nanog, Oct3/4, Klf4 and Sox2, are overexpressed in poorly differentiated ER negative breast cancers (Ben-Porath et al., 2008) and it has been postulated that these also may drive CSC (Li, 2010). Bioinformatic studies that compared the transcriptional programs in ES cells with adult tissue stem cells and human cancers demonstrate the activation of ES-like transcriptional programs in diverse human epithelial cancers which was a predictor of metastasis and death (Wong et al., 2008). The oncogene c-myc, but not other oncogenes, appeared to be sufficient to activate this ES-like program and could increase the fraction of CSCs (Wong et al. 2008), It is noteworthy that while aggressive ER negative cancers showed an ES-cell like expression profile, they did not observe preferential expression of an ES gene profile in CD44 + CD24 neg/low populations. While these pathways are putative targets for CSC-directed therapies, therapeutic development requires further refinement of tumor subsets driven by these effectors. The work in this thesis refined this population into distinct subsets and showed preferential activation of ES gene profile in the CD24 low+ cells (~10%) over CD24 negative cells (>80%) (See Chapter 3).

39 Sox2 In my thesis work, I identified a role of embryonic transcription factors including Sox2 in the self-renewal of CSC. Thus, the following provides a brief review of the known functions of Sox2:. Sox2 (Sex determining region Y-box2) genes encode a family of high-mobility group embryonic transcription factors that have critical roles in organogenesis. They are essential for mammalian development, they help regulate the transcription of other genes that are essential for development. Recently, Sox2 was found to dysregulated in human malignancies, including lung carcinoma and glioma (Bass et al., 2009; Annovazzi et al., 2011) and was shown to be critical for growth and/or metastasis in lung and breast cancer models (Xiang et al., 2011; Leis et al., 2011). Furthermore, Sox2 over-expression has been observed in 43% of basal cell-like breast carcinomas, suggesting a role in conferring a less differentiated phenotype (Rodriguez-Pinilla et al., 2007). During the course of my thesis work, it was shown that over-expression of Sox2 increased mammosphere formation and Sox2 knockdown prevented mammosphere formation and delayed tumor formation in xenograft tumour initiation models (Leis et al., 2011). These findings suggest that Sox2 plays an important role in regulating breast cancer stem cells and support the findings I have made in my thesis work (see Chapter 3) CLINICAL IMPLICATIONS OF CANCER STEM CELLS The promise of understanding cancer stem cell biology lies in the potential to provide new therapeutic approaches for cancer treatment. Clinical treatment regimens

40 24 operate under the assumption that all cancer cells have equal malignant potential. These treatments suffer from their lack of specificity for only tumorigenic cells. Relatively successful cancer treatments shrink the bulk of tumor cells but often fail to eliminate the cancer stem cells, resulting in the recurrence of tumors. The question of whether a stem cell or a progenitor cell initiates cancer will be crucial for future clinical therapy. If a progenitor acquires the ability to self-renew, this mutation could be therapeutically targeted. Signaling pathways and cell surface markers uniquely utilized by CSCs could be targeted to block cancer progression at each stage by killing these cells or changing their phenotype. However it is important to note that CSCs may share features in common with normal stem cells, so great care must be taken when targeting the cancer cells not to kill the normal ones. Thus, the further isolation and characterization of stem cells subpopulations in normal and malignant tissues at the molecular and functional levels may help to develop more effective cancer treatments SUMMARY There is increasing evidence for the existence of cancer stem cells in solid tumors and the presence of a hierarchy within normal and malignant stem cell subpopulations. Cancer stem cells may give rise to metastasis and have increased resistance to cancer drugs thereby, leading to tumor recurrence. They may share some of the signaling pathways and self-renewal pathways that have been shown to play crucial roles in embryonic stem cell self-renewal, specifically, expression of embryonic transcription factors including Sox2 may govern cancer stem cell self-renewal. My thesis work provides further evidence for a functional and molecular hierarchy within breast CSC subpopulations that may limit responses to targeted Gamma Secretase

41 25 therapies. My findings also suggest that CSC subsets may differ in metastatic potential and contribute importantly to breast cancer progression.

42 CHAPTER 2 MATERIALS AND METHODS This chapter describes the materials and experimental approaches that were utilized throughout the remainder of this thesis. Section 2.1 consists of an outline listing all of the relevant materials: Table 2.1 lists the cell lines used in this work, Table 2.2 lists the various reagents (antibodies, inhibitors, etc.). Section 2.2 contains detailed descriptions of the various experimental methods that were utilized. 2.1 MATERIALS Table 2.1: Cell Lines Name Media Description Source MDA-MB-231luc MCF7 DMEM, 10% FBS, 1% Glutamine, 1% Sodium Pyruvate, 1% Pen/Strep IMEM, 5% FBS 50 ng/ml Insulin, 1% Pen/Strep Human breast cancer cell line, derived from malignant pleural effusion, luciferase-tagged Human breast cancer cell line, derived from pleural effusion Andy Minn, UPenn ATCC BT-474 DMEM, 10% FBS, 1% Glutamine, 1% Sodium Pyruvate, 1% Pen/Strep MDA-MB-361 DMEM, 10% FBS, 1% Glutamine, 1% Sodium Pyruvate, 1% Pen/Strep HCC-1395 RPM1 1640, 10% FBS, 25 μg/ml glucose, 1mM Sodium Pyruvate, 1 mm HEPES, 1% pen/strep SUM1315MO2 Hams F12, 5% FBS, 1% pen/strep Human breast cancer cell line, derived from primary tumor Human breast cancer cell line, derived from brain metastasis Human breast ductal carcinoma cell line Human invasive ductal carcinoma cell line ATCC ATCC ATCC Steve Ethier, UMichigan 26

43 27 Table 2.2: Primary Dissociated Tumors (Bayliss et al., 2007) Name Media Description Source DT-16 IMEM, 10% FBS Human breast primary dissociated culture, derived from triple negative primary tumor DT-21 IMEM, 10% FBS Human breast primary dissociated culture, derived from ER-/PR-/H2N+ primary tumor DT-22 IMEM, 10% FBS Human breast primary dissociated culture, derived from triple negative primary tumor DT-23 IMEM, 10% FBS Human breast primary dissociated culture, derived from triple negative primary tumor DT-25 IMEM, 10% FBS Human breast primary dissociated culture, derived from ER-/PR-/H2N+ primary tumor Dorraya El Ashry UMiami Dorraya El Ashry UMiami Dorraya El Ashry UMiami Dorraya El Ashry UMiami Dorraya El Ashry UMiami

44 28 Table 2.3: Reagents Reagent Source Notes ANTIBODIES PE-anti human CD24 BD Biosciences Flow Cytometry APC-anti human CD44 BD Biosciences Flow Cytometry FITC-anti human ESA Biomeda Flow Cytometry Sox2 Cell Signaling Western Cleaved Notch1 (Val1744) Cell Signaling Western Nanog Cell Signaling Western β-actin Sigma Western phospho-akt (Ser437) Cell Signaling Western AKT total Cell Signaling Western phospho-src (Tyr416) Cell Signaling Western Src total Cell Signaling Western phospho-mapk (p44/42) Cell Signaling Western MAPK total Cell Signaling Western phospho-p90rsk (Ser380) Cell Signaling Western p90 RSK total Cell Signaling Western Anti-mouse secondary Promega Western Anti-rabbit secondary Promega Western INHIBITORS RO Selleck Chemicals Gamma Secretase Inhibitor DAPT Sigma Gamma Secretase Inhibitor Paclitaxel Pharmacy Chemotherapy drug pbabepuro-n1-icd Easy-Sep PE Magnetic Bead Kit Aldefluor Assay Lipofectamine Transfection Kit ECL (Standard) ECL (Pico) ECL (Femto) Luciferin WIT Media Bradford Dye mirnaeasy Kit PVDF Membrane sirna Sox2 PLASMIDS Anthony Capobianco OTHER Stem Cell Technologies Stem Cell Technologies Invitrogen Western Lightning Thermo Thermo Caliper Lonza Biorad Qiagen Millipore Santa Cruz

45 29 Table 2.4: Oligonucleotide Sequences Name Sequence (5-3 ) qpcr PRIMERS Human CD24 Forward CCCACGCAGATTTATTCCAG Human CD24 Reverse GACTTCCAGACGCCATTTG Human Nanog Forward GATCGGGCCCGCCACCATGAGTGTGGATCCAGCTTG Human Nanog Reverse GATCGAGCTCCATCTTCACACGTCTTCAGGTTG Human Sox2 Forward CCTCCGGGACATGATCAG Human Sox2 Reverse TTCTCCCCCCTCCAGTTC Human Jagged1 Forward ATCCTCGAGAGCACCAGCGCGAACAGCAG Human Jagged1 Reverse ATCGAATTCCCCGCGGTCTGCTATACGAT Human Hey1 Forward ATCACCCACACATCGCACACCC Human Hey1 Reverse ACTAGGGGGCGCTCGCAAGG Human GAPDH Forward ACCCAGAAGACTGTGGATGG Human GAPDH Reverse TCTAGACGGCAGGTCAGGTC Mouse Sox2 Forward TCAAGGCAGAGAAGAGAGTGTTTGC Mouse Sox2 Reverse GAAGCGGAGCTCGAGACGGG Mouse HPRT Forward CACAGGACTAGAACACCTGC Mouse HPRT Reverse GCTGGTGAAAAGGACCTC ChIP Primers Human Sox2 Forward GCCAAAGAGCTGAGTTGGAC Human Sox2 Reverse CCCAAACCTCTGTCCTCAAA Mouse Sox2 (1) Forward CTGTGGTTGCTCTTTGTAGCA Mouse Sox2 (1) Reverse TGTAGGGGCACCTTCATTTT Mouse Sox2 (2) Forward CCTAGGAAAAGGCTGGGAAZ Mouse Sox2 (2) Reverse CACTCACCCCCTCTTCTCAC 2.2 METHODS CD44 and CD24 Staining Phycoerythrin (PE)-conjugated monoclonal mouse anti-human CD24, and allophycocyanin (APC)-conjugated anti-human CD44 mab (BD Pharmingen, CA) and FITC-conjugated mab to human ESA (Biomeda) were used as in (Ginestier et al., 2007). Briefly, a minimum of 2 x 10 5 and a maximum of 1 x 10 6 cells were resuspended in 100 µl FACS buffer (PBS, 2% FBS, 0.1% Sodium Azide), and incubated for 20 minutes in the dark with 20 μl CD44-APC and CD24-PE. Cells were rinsed in 3 ml FACS buffer

46 30 and resuspended in a final volume of 500 μl FACS buffer for analysis. Unstained samples were used to calibrate the analyzer for each experiment. FACS analysis was performed on a LSRII (BD) flow cytometric analyzer at the University of Miami Sylvester Cancer Center Flow Cytometry Core Facility and CellQuest software (BD Biosciences,CA) Aldefluor Assay The ALDEFLUOR kit (StemCell Technologies, Durham, NC, USA) was used to isolate the population with a high ALDH enzymatic activity as in (Ginestier et al., 2007). Cells were suspended in ALDEFLUOR assay buffer containing ALDH substrate (BAAA, 1 mmol/l per 1x10 6 cells) and incubated during 40 min at 37ºC. As negative control, for each sample of cells an aliquot was treated with 50 mmol/l diethylaminobenzaldehyde (DEAB), a specific ALDH inhibitor. After ALDEFLUOR staining, cells were costained with anti-cd24-pe and anti-cd44-apc (BD Pharmigen) for 20 min on ice. ALDEFLUOR was excited at 488 nm, and fluorescence emission was detected using a standard fluorescein isothiocyanate (FITC) 530/30-nm band-pass filter Flow sorting of CD44 + CD24 neg and CD44 + CD24 low+ cells For sorting large numbers of CD44 + CD24 low+ from CD44 + CD24 neg cells, 150 x 10 6 unsorted cells were resuspended in 1mL of FACS buffer (2% FBS in PBS), placed in 5mL polystyrene round bottom tubes to properly fit into the EasySep Magnet and labeled with 300μl of APC anti-cd44 and 300μl of PE-anti CD24 antibodies (BD Biosciences) for 25 min at 22 0 C. For experiments that require fewer numbers of CD44 + CD24 low+ cells, 10 x 10 6 unsorted cells were resuspended in 100ul of FACS buffer, placed in 5mL

47 31 polystyrene round bottom tubes and labeled with 20μl APC and 20μl PE antibodies for 25 min at 22 0 C. Sorting was carried out with a magnet (PE-selection kit, Stem Cell Tech) according to the manufacturer s instructions. Magnetic separation was performed up to four times to obtain CD24 low+ population more than 95% pure. After separation, the CD24 neg cells were further purified by sorting on a FACSAriaII (BD Biosciences) in order to obtain >98% purity. The purity of the sorted populations was analyzed using a CellQuest software (BD Biosciences) Sphere formation assay and growth in soft agar Mammosphere assays were as in (Dontu et al., 2003). Cells (10,000 cells/6-well plates) were grown in a serum-free mammary epithelial growth medium (MEGM, BioWhittaker), supplemented with B27 (Invitrogen), 20 ng/ml EGF and 20 ng/ ml bfgf (BD Biosciences), and 4 μg/ml heparin (Sigma). The mammospheres were cultured for 7-10 days. Then the mammospheres with diameter >75 μm and < 75µm were counted and photographed at 7-10 d. For serial assays, mammospheres were collected by gentle centrifugation and were dissociated enzymatically for 10 min in TrypL (Invitrogen). The cells obtained were analyzed microscopically for single cellularity, counted and replated as above or for CD44, CD24 staining. For colony formation assays, cells were suspended in soft agar and growth medium in 6-well plates at a density of 10,000 cells per well. After 4 weeks, colonies were stained with 0.1% crystal violet and those that were >75 μm in diameter were counted.

48 32 In experiments examining the effect of Gamma Secretase Inhibitor (GSI) N-[N- (3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) on sphere and colony formation, established mammospheres and colonies were treated with 5 and 10 µm DAPT or DMSO as a control. Effect on sphere and colony formation was evaluated after 10 days and 4 weeks respectively with GSI renewal every 2 days and quantitated by counting spherical cell clusters (>75 μm, in general) Drug effects on Proliferation In vitro cellular proliferation was assessed by plating equal cell counts (n=100,000) in a 100mm culture dish at time = 0. Triplicate samples were plated in parallel and cells were harvested and viable cells counted using trypan blue staining at different time-points. Average cell counts were calculated and plotted +/- SEM Western analysis Westerns were as described (Chu et al., 2007). A comprehensive list of antibodies used during western blotting (along with the company from which they were purchased) is included in Section 2.1. All western blots were prepared utilizing Millipore PVDF membrane and blocked for forty-five minutes in 5% non-fat milk solution. Primary antibody concentration and duration of exposure varied based on individual optimization to each antibody. Secondary incubation at a dilution of 1:3,000 was carried out for one hour. Chemiluminescent imaging was carried out with a variety of ECL reagents, listed above.

49 Chromatin Immunoprecipitation Assay (ChIP) ChIP assays were as described (Assou et al., 2007). Cells were treated with 2% formaldehyde for 10 min at 22 0 C for ChIP assay with anti-cleaved Notch1 antibody (Cell Signaling) or control IgG. Immunoprecipitated DNA corresponding to 770 to 616 from the transcriptional start site of human Sox 2 promoter was amplified by PCR using the primer pair: For human and mouse PCR primers, see Table In Vivo Tumorigenicity Sorted cells from MDA-MB-231-luc (500,000, 100,000, 10,000, 1000 or 100) in 0.05 ml matrigel were injected into one inguinal mammary fat pad of 4-6 wk old Balb/C nude mice (Charles River) and tumors measured weekly. Tumors from the 500,000 cell group were excised at 1 cm diameter and followed for metastasis. All others were excised per Animal Care and Use Committee or at 100 days if no tumor arose. DT-22 xenografts were formed from 100,000 sorted cells injected into nude mice as above. Palpable tumors (60-100mm3) were treated with vehicle or RO (Selleck Chemicals) 30 mg/kg/day for 14 days as in Luistro et al (n=6/group) and measured twice weekly In Vivo Imaging Bioluminescence images were acquired using the in vivo imaging system (IVIS) (Xenogen) and analyzed as in (Minn et al., 2005) with Living Image 3.0 software (Xenogen Caliper Life Sciences). Mice were anaesthetized and injected intraperitoneally with 1.5 mg of d-luciferin (15 mg ml 1 in PBS) and imaged with the Xenogen IVIS system. Representative individual mice were selected for each experiment and presented along with a

50 34 standardized scale. Average normalized photon flux for each group is plotted over time +/- SEM Microarray Data Acquisition and Analysis RNA was isolated with mirneasy kit (Qiagen) and quantified by Nanodrop 8000 Spectrophotometer (Thermo Scientific, Wilmington) and quality verified by RNA 6000 Nano kit (Agilent, Santa Clara, CA) on a Bioanalyzer 2100 and expressionanalysis used the Illumina platform. Biotinylated crna was prepared using Illumina TotalPrep RNA Amplification Kit (Ambion, Inc., Austin, TX) per manufacturer from 400ng total RNA. Samples were added to the Beadchip after randomization using a randomized block design to reduce batch effects. Hybridization to the Sentrix Human-HT12 Expression BeadChip (Illumina, Inc., San Diego, CA), washing and scanning were per Illumina BeadStation 500 manual (revision C). Microarray data analysis used Illumina GenomeStudio software Microarray Data Processing and Normalization Microarray data processing and analysis was as described (Minn et al., 2005) used R language and environment for statistical computing version 2.13 and Bioconductor version 2.8. Bead-summary expression data for the Illumina HumanHT-12 v4 BeadChip were normalized to correct for differences in expression within and between chips using the variance stabilization and normalization (vsn) method as implemented in the bead array R package version Data for MDA-MB-231 and DT22 cell lines were separately normalized. The illuminahumanv4.db package version was used to obtain probe mappings to official gene symbols. If multiple probes correspond to the

51 35 same gene, the probe with the highest variance was used. In this way, the expression matrix was reduced so that each expression value corresponds to a single gene annotated by the official gene symbol Gene Set Enrichment Analysis Gene sets comprised of a previously described lung, bone, and brain metastasis gene signatures and gene signatures for embryonic stem cell transcriptional programs were obtained from the original publications (Minn et al., 2005; Kang et al., 2003; Bos et al., 2009; Ben-Porath et al., 2008). For the lung and brain metastasis gene signatures, the 18-gene and 17-gene versions used in clinical outcome analysis were used, respectively. Probe identifiers provided were mapped to the official gene symbol. For the metastasis gene signatures, only genes in each signature that showed upregulation compared to parental MDA-MB-231 were included. A NOTCH targets gene set was defined by GSI washout of a metastatic MDA- MB-231 variant treated with 10μM DAPT for 48 hrs, washed X 3, and cultured four more hrs in 10 mg/ml of cyclohexamide. Trizole extracted RNA was reverse transcribed and used with a custom TaqMan RT-PCR array cards for the candidate NOTCH target genes. Genes showing an upregulation of at least 1.5 fold in response to GSI washout were considered target genes. The collection of gene sets was used in Gene Set Analysis (GSA) per GSA package version For GSA, a two-class paired comparison between CD24 negative and CD24 low cells using the maxmean method and restandardization based on all genes in the microarray data set was used. Gene sets showing positive or negative enrichment

52 36 were deemed significant if the false discovery rate and nominal p-value were less than 0.05 using 1000 permutations N1-ICD Overexpression and sirna Transfection pbabepuro-n1-icd retrovirus was used to stably transform HC-11 or MDA- MB-231 with respective packaging lines. For Sox2 knockdown, scrambled control sirna or sirnas against Sox2 (Santa Cruz) were transfected into MDA-MB-231 with Lipofectamine 2000 per manufacturer s instructions. Infected cells were selected with puromycin 0.5μg/ml for 3 days and maintained as a pool thereafter Quantitative Real-Time PCR (qpcr) RNA was isolated using the Trizol reagent and RNeasy Microkit according to the manufacturer s protocol (Qiagen). Total RNA from cells was converted to cdna and amplified using the Maxima cdna synthesis kit according to the manufacturer s instructions (Fermentes). PCR was performed on Roche Light Cycler (Roche) and list of primers used are listed in Table 2.4. For data analysis, the ΔΔCt method was used with the aid of a Microsoft excel spreadsheet containing algorithms provided by the manufacturer mirna profiling RNA from sorted cells was harvested for mirna profiling. RNA quality was verified by Nanodrop 8000 Spectrophotometer (Thermo Scientific, Wilmington) and RNA integrity and the small RNA fraction assayed by a Bioanalyzer 2100 (Agilent, Santa

53 37 Clara). 20ng of total RNA per panel was reverse transcribed using mircury LNA Universal RT microrna PCR, Polyadenylation and cdna synthesis kit (Exiqon, Woburn, MA) per manufacturer s instructions. cdna was diluted, combined with SYBR Green Master Mix (Exiqon) and added to the Ready-to-Use PCR Panels. Human microrna Ready-to-Use PCR Panels I and II hold 742 different mirna targets and 6 reference gene assays (mirbase 13). The real-time PCR reactions were run according to the manufacturer s instructions on an Applied Biosystems 7900HT real-time PCR instrument. The data was analyzed using RealTime Statminer (Integromics, Philadelphia, PA) and normalized using the global mean method Statistical analyses Data presented as mean ± SE from at least 3 experiments used two-tailed Student s t tests to differences. Comparative analysis of growth curves was applied to tumor growth curves over a series of multiple timepoints using the statmod software package ( P values < 0.05 were considered statistically significant. Microarray analysis are described above and in Supplemental Methods and used MIAME standard

54 CHAPTER 3 EVIDENCE FOR A FUNCTIONAL AND MOLECULAR HIERARCHY WITHIN BREAST CANCER STEM CELLS IN TRIPLE NEGATIVE BREAST CANCERS 3.1 SUMMARY The existence of developmental hierarchies within cancer stem cells (CSCs) may underlie heterogeneity in metastatic potential and drug responses. Here, we show CSCenriched CD44 + CD24 neg/low breast cancer cells comprise a functional hierarchy: a minor CD44 + CD24 low+ subpopulation generates CD44 + CD24 neg progeny with reduced selfrenewal and tumorigenicity. In both triple negative breast cancer (TNBC) lines and primary dissociated tumor (DT) cultures, CD44 + CD24 low+ generate more spheres, while CD44 + CD24 neg -generated spheres decline with serial passage. CSCs were more frequent in CD44 + CD24 low+ : fewer cells yielded orthotopic tumors with reduced latency. Metastasis arose exclusively from CD44 + CD24 low+ which preferentially express ES gene profiles and metastatic signatures. CD44 + CD24 low+ but not CD44 + CD24 neg express N1- ICD and a Notch-activated gene profile. N1-ICD transactivates SOX2 mediating Sox2- dependent increases in % ALDH1+, % CD44+CD24 low+ and sphere formation. GSI notably reduced serial sphere formation and xenograft growth from CD44 + CD24 low+ cells while CD44 + CD24 neg showed no response. While Notch family members are implicated in stem cell self-renewal many cancers, stem cell hierarchies such as that observed herein could limit potential GSI efficacy. 38

55 BACKGROUND Many cancers appear to be driven by stem-like cells that self-renew, differentiate to yield heterogenous, less proliferative progeny, and survive adverse microenvironments (Dalerba et al., 2007). That these may also initiate metastasis has driven efforts to identify and characterize them. Cancer stem cell (CSC)-enriched populations have been identified in various cancers by discrete surface markers, and their ability to generate tumorspheres and xenograft tumors with high frequency (Frank et al., 2010; O'Brien et al., 2009). In breast cancer, CD44 + CD24 low/neg ESA + cells were enriched for xenografts formation compared to bulk tumor cells (Al Hajj et al., 2003). Aldehyde dehydrogenase 1 (ALDH1) activity marks breast cancer cells enriched for stem cell properties and those with both ALDH1 + and CD44 + CD24 low/neg are most tumorigenic (Ginestier et al., 2007), but infrequent (<1%). For cancers of breast, pancreas, prostate, head and neck, and colon, the CSC phenotype consistently includes surface CD44 + expression (Al Hajj et al., 2003; Prince et al., 2007; Li et al., 2007; Hurt et al., 2008; O'Brien et al., 2007). CD44 is associated with poor prognosis and metastasis, supporting the idea that stem-like cells generate metastases (Yang et al., 2008; Shipitsin et al., 2007; Liu et al., 2010). In contrast, the relationship between CD24 surface and stemness differs between solid tumors. Overexpression of this glycosylated surface protein increases cancer cell proliferation and migration (Aigner et al., 1998). While surface CD24 is observed in subsets of CSC from liver (Lee et al., 2011), colon (Yeung et al., 2010) and pancreas (Li et al., 2007), the CSC phenotype of primary breast cancers is depleted for CD24 (CD44 + CD24 low/neg ) (Al Hajj et al., 2003). This contrasts with normal mammary progenitors cells, which express CD24

56 40 (Pece et al., 2010; Spike et al., 2012). It is noteworthy that CD24+ cells are increased in metastatic compared to primary breast cancers (Shipitsin et al., 2007). Populations surviving chemotherapy and radiation appear to be enriched for CSC (Calcagno et al., 2010; Tanei et al., 2009; Levina et al., 2008), possibly due to membrane transporters, greater quiescence and enhanced DNA repair, permitting CSC regeneration (Frank et al., 2010; O'Brien et al., 2009). Thus, identification and interdiction of CSC specific pathways may permit greater anti-cancer treatment efficacy. To date, the difficulty of isolating viable CSC from solid tumors in sufficient quantity to permit their molecular characterization has limited development of CSC-directed therapies that abrogate resistance or induce differentiation. Breast cancer cell lines contain CSC analogous to those in primary breast cancers, permitting isolation of greater CSC numbers for functional characterization (Fillmore and Kuperwasser, 2008; Charafe- Jauffret et al., 2009). CSC subsets within a cancer may vary not only in their self-renewal potential, but also in their ability to successfully engage different metastatic niches. While CSC or a sub-population thereof have been broadly posited as giving rise to metastasis, few experimental models have addressed this directly. ALDH1 + CD44 + CD24 low/neg subpopulations in breast cancer lines yielded more xenograft metastasis than ALDH1 - CD44 - CD24 + (Croker et al., 2008), but metastatic potential was not exclusive to the very low % ALDH1+ population. Identification and characterization of mammary CSC subsets that consistently metastasize presents a challenge. That CSC subsets may differ in metastatic potential was first shown by the observation that while both could initiate

57 41 primary tumors, CD133 + CXCR4 + pancreatic CSC could generate experimental lung metastasis while CD133 + CXCR4 - CSC could not (Hermann et al., 2007). The present thesis work was undertaken to identify discrete subsets among CSC of the most deadly form of breast cancer: that lacking estrogen and progesterone receptors and HER2 amplification (so called triple negative hereafter TNBC). We postulated that, as for normal stem cells, primary TNBC-derived cultures and immortal lines would have a CSC hierarchy with precursor/progeny populations that differ in molecular pathways conferring self-renewal, tumorigenicity and metastatic potential. Here, we demonstrate a functional hierarchy within CD44 + CD24 low/neg subpopulations from a TNBC line and primary TNBC dissociated tumors (DTs). The minor CD44 + CD24 low+ population shows greater self-renewal and gives rise to CD44 + CD24 neg. In contrast, CD44 + CD24 neg progeny are exclusively CD44 + CD24 neg both in 2D culture and in spheres, and show more limited self-renewal. CD44 + CD24 low+ are enriched in ES-cell and metastatic gene signatures and are more tumorigenic than CD44 + CD24 neg. Moreover, <1/100 CD44 + CD24 low+ generate xenografts that metastasize, while no metastasis arose from up to 500,000 CD44 + CD24 neg cells. In CD44 + CD24 low+ cells, Notch1 was shown to directly transactivate Sox2 to drive self renewal. Although Notch has been implicated in breast cancer stem cell self-renewal, the CD44 + CD24 neg CSC sub-population was unaffected by its inhibition in 2D culture, sphere and xenograft assays, revealing a heretofore unappreciated heterogeneity in GSI responsiveness in CSC

58 RESULTS Identification of two distinct stem cell subpopulations in TNBC lines and primary dissociated tumors While CD44 + CD24 neg/low breast cancer cells are enriched for cancer initiating cell (Al Hajj et al. 2003), we wished to investigate the potential existence within this phenotype of subsets with differing self-renewal and tumor initiating abilities. Surface CD44/CD24 were assayed in established breast cancer lines (most derived from metastatic tissues) and in five primary TNBC dissociated tumor cultures (DTs). DTs were assayed at early passage to minimize culture artifact. Notably, all estrogen receptor (ER) negative lines and DTs show a high % CD44 + CD24 neg/low cells, while ER positive lines vary in CD44 staining and have consistently higher CD24 than in ER negative, as described (Fillmore and Kuperwasser, 2008; Charafe-Jauffret et al., 2009) (Figure 3.1 and Figure 3.2C). MDA-MB-231 and DT-22 (Figure 3.2A & B) were representative of all TNBC cultures (Figure 3.2) with >90% CD44+ and contained largely CD44 + CD24 neg (>80%) and a minor population with low level surface CD24 positivity or CD44 + CD24 low+ (<20%) cells. CD24 negativity was defined by the gate set from unstained controls (see Figure 3.2A & B). Potential differences in stem cell characteristics of CD44 + CD24 neg and CD44 + CD24 low+ TNBC subpopulations were further investigated. Since both surface epithelial specific antigen + (ESA, also known as EpCAM) and ALDH1+ populations are enriched for CSCs, cells gated for aldefluor activity or for ESA expression were analyzed for CD44/CD24 status. In DT-22, DT-23 and MDA-MB-231,

59 43 the percent of ALDH1 + and ESA + population was low (1-5%). Interestingly, over 95% of ALDH1 + cells and >80% of ESA + cells were also CD44 + CD24 low+ (Figure 3.2D & E ). A B C ER-negative lines ER-negative DTs ER-positive lines MDA-MB-231 DT-21 MCF7 HCC-1395 DT-22 BT-474 SUM1315 DT-23 MDA-MB-361 DT-16 DT-25 CD44 CD24 Figure 3.1: Representative CD44/CD24 profiles for ER positive and ER negative breast cancer cell lines and TNBC-derived dissociated tumor cultures

60 44 Figure 3.2: CD44 + CD24 low+ and CD44+CD24 neg population characteristics. CD44 and CD24 in MDA- MB-231 (A) DT-22 (B) and MCF7 (C). Unstained controls are shown. D & E, Cells were gated for ALDH1 + (left) or ESA + (right) and CD44/CD24 assayed in MDA-MB-231 (D) and in DT-22 (E). A property of stem cells is their ability to generate spheres. Sphere formation of CD44 + CD24 neg and CD44 + CD24 low+ subpopulations was assayed after isolation by flow sorting. While both formed mammospheres, significantly more spheres were generated from equal numbers of CD44 + CD24 low+ cells than CD44 + CD24 neg from MDA-MB-231, DT-22, DT-23 and DT-25 (Figure 3.3B & D; for DT-23, DT25 see Figure 3.4). Upon serial passage, CD44 + CD24 low+ cells maintained higher sphere forming ability than CD44 + CD24 neg, with no attenuation upon plating of secondary and tertiary mammospheres. In contrast, the proportion of sphere forming CD44 + CD24 neg cells decreased progressively on serial mammosphere plating in two different DT cultures and

61 45 in MDA-MB-231 (Figure 3.3A & C, see also Figure 3.4). Thus CD44 + CD24 low+ cells exhibit enhanced self-renewal in these assays compared to CD44 + CD24 neg. Notably, clonogenicity in soft agar, a hallmark of cancer forming cells was also enhanced in CD44 + CD24 low+ cells compared to CD44 + CD24 neg (Figure 3.3B & D and Figure 3.4). Figure 3.3: Enhanced self-renewal potential of CD44 + CD24 low+ than CD44+CD24 neg. A & C, Serial mammospheres formed from sorted CD44 + CD24 low+ and CD44 + CD24 neg of MDA- MB-231 (A) and DT-22 (C), (mean +/- SEM, student s T test, (* p<0.05). B & D, Mean soft agar colonies from MDA-MB-231 (B) and DT-22 (D), (mean ± SEM, two-tailed t test ** p< 0.01).

62 Figure 3.4: CD44 + CD24 low+ and CD44+CD24 neg population characteristics in DT-23 and DT-25 A, Representative image of mammospheres (Scale bars, 100um) formed from 10,000 sorted cells from MDA-MB-231, DT-22 and DT23. B, CD44 + CD24 low+ and CD44 + CD24 neg populations were flow sorted from DT-23 cells and seeded in mammosphere cultures. Spheres/5000 cells plated are graphed as mean ± SEM. C, Serial mammospheres formed from sorted DT25 CD44 + CD24 low+ or CD44 + CD24 neg cells are graphed as mean+/- SEM. ** indicates p value showing statistically significant difference by student s T test, (**P<0.02) 46

63 CD44 + CD24 low+ Cells Self-renew and Give Rise to CD44 + CD24 neg Progeny To investigate if the greater sphere forming capacity of CD44 + CD24 low+ cells reflects a potential lineage relationship between CD44 + CD24 low+ and CD44 + CD24 neg populations, these were sorted from MDA-MB-231, DT-22 and DT-25, cultured and surface markers were monitored over 14 days. Growth curves showed purified CD44 + CD24 neg cells proliferate exponentially but generated only CD44 + CD24 neg cells (MDA-MB-231 data in Figure 3.5; that for DT-22 and DT-25 in Figure 3.6). In contrast, a >98% pure CD44 + CD24 low+ population gave rise progressively to CD44 + CD24 neg cells, yielding a steady state population comprised largely of CD44 + CD24 neg (85%) with a minority of CD44 + CD24 low+ (15%) similar to that observed in unsorted MDA-MB-231 cells (Figure 3.5A, C, D). The cumulative increase in cell number generated from 100,000 cells of each sorted subpopulation was identical (Figure 3.5B). However, while CD44 + CD24 neg grew exponentially over at least 7 population doublings, the progeny of CD44 + CD24 low+ cells showed two patterns: CD44 + CD24 low+ cell numbers increased gradually and arithmetically but generated exponentially growing CD44 + CD24 neg progeny (Figure 3.5D). These data are compatible with a model in which CD44 + CD24 low+ undergo largely semi-conservative replication, with a modest CD44 + CD24 low+ cell expansion resulting from a minor component of symmetric division (Figure 3.5D-E). The ability of CD44 + CD24 low+ to self-renew and give rise to CD44 + CD24 neg, while CD44 + CD24 neg cells remained phenotypically homogeneous was also observed in two independent DT-22 and DT-25 cultures (Figure 3.6). That CD44 + CD24 low+ breast cancer cells gave rise to CD44 + CD24 neg, is consistent with (Meyer et al., 2009). In contrast, our CD44 + CD24 neg cells generated only CD44 + CD24 neg progeny.

64 Post-sorting 12 days later 48 A Pre-sorting CD44 99% CD44 99% CD44 CD24 CD24 99% 78% 22% CD24 CD44 CD44 CD24 CD24 B Cell # X CD24 neg progeny CD24 low+ progeny Days C % Cells Progeny of CD24 low+ CD24 neg CD24 low Days D Cell # x Progeny of CD24 low+ CD24 neg CD24 low+ E CD24 low+ CD24 neg Days Figure 3.5: CD44 + CD24 low+ give rise to both CD44 + CD24 low+ and CD44 + CD24 neg progeny while CD44 + CD24 neg yield only CD44 + CD24 neg. CD44 + CD24 low+ or CD44 + CD24 neg MDA-MB-231 were sorted and 100,000 cells cultured over 14 days. A, CD44 and CD24 analysis of sorted cells. B, Population growth from sorted CD44 + CD24 low+ and CD44 + CD24 neg. C, % CD44 + CD24 low+ or CD44 + CD24 neg cells arising from CD44 + CD24 low+ cells. D, Growth curves of progeny arising from CD44 + CD24 low+ over 14 days. E, Model depicting largely semi-conservative replication of CD44 + CD24 low+ cells generating largely CD44 + CD24 neg progeny with a modest increase in CD44 + CD24 low+ over time.

65 49 A DT-22 D DT-25 Cell # x CD24 neg progeny CD24 low+ progeny Cell # x CD24 neg progeny CD24 low+ progeny Days B Progeny of CD24 low+ CD24 neg CD24 low+ E Progeny of CD24 low+ CD24 neg CD24 low % Cells 40 C Cell # x Days Progeny of CD24 low+ CD24 neg CD24 low % Cells 40 F Cell # x Days Progeny of CD24 low+ CD24 neg CD24 low Figure 3.6: CD44 + CD24 low+ give rise to both CD44 + CD24 low+ and CD44 + CD24 neg progeny while CD44 + CD24 neg yield only CD44 + CD24 neg. CD44 + CD24 low+ or CD44 + CD24 neg from DT-22 and DT25 were sorted and 100,000 cells cultured over 14 days. A, D Population growth from sorted CD44 + CD24 low+ (A) and CD44 + CD24 neg (D). B, E % CD44 + CD24 low+ (B) or CD44 + CD24 neg (E) cells arising from CD44 + CD24 low+ cells. C, F Growth curves of progeny arising from CD44 + CD24 low+ over 14 days. As for MDA-MB-231 (Figure 3.5) CD44 + CD24 neg generated only CD44 + CD24 neg cells over 14 days (not shown here).

66 50 The progeny generated from seeding isolated CD44 + CD24 low+ or CD44 + CD24 neg cells at single cell density in mammospheres assays were analyzed from dissociated spheres. Strikingly, CD44 + CD24 neg -initiated mammospheres contained only CD44 + CD24 neg cells, while CD44 + CD24 low+ -initiated mammospheres contained both CD44 + CD24 low+ and CD44 + CD24 neg cells at a ratio similar to that seen in 2D (Figure 3.7). Similar observation was seen in vivo where CD44 + CD24 neg -initiated tumors contained only CD44 + CD24 neg cells while CD44 + CD24 low+ -initiated tumors contained both CD44 + CD24 low+ and CD44 + CD24 neg cells (data not shown). Thus, both in 3D and 2D culture, CD44 + CD24 low+ cells can self-renew and produce CD44 + CD24 neg progeny, while CD44 + CD24 neg have a restricted phenotype. Figure 3.7: CD44 + CD24 neg spheres contain only CD44 + CD24 neg cells while CD44 + CD24 low+ spheres contain both CD44 and CD24 staining of dissociated mammosheres A, CD44 + CD24 neg initiated mammospheres contained only CD44 + CD24 neg cells B, CD44 + CD24 low+ -initiated mammospheres contained both CD44 + CD24 low+ and CD44 + CD24 neg cells.

67 CD44 + CD24 low+ have a higher proportion of tumor-initiating cells than CD44 + CD24 neg While the ability to form xenograft tumors in immunocompromised hosts may underestimate CSC frequency, it is a key functional assay. The tumorigenic potential of CD44 + CD24 low+ and CD44 + CD24 neg subpopulations from luciferase tagged MDA-MB- 231 was titrated by orthotopic transplantation. Limiting dilutions of CD44 + CD24 low+ or CD44 + CD24 neg cells (n= 500,000, 100,000, 10,000, 1000 or 100 cells) were injected into BalbC nude mice. Both cell types initiated tumors from as few as 100 cells, but while all animals injected with one hundred CD44 + CD24 low+ cells developed tumors, one hundred CD44 + CD24 neg cells yielded tumors in only 60% of injected animals and had a longer latency. For each cell number injected, CD44 + CD24 low+ cells generated more tumors with shorter latency (Figure 3.8A) that grew more rapidly than those from CD44 + CD24 neg cells (Figure 3.8B). Thus, the proportion of tumorigenic precursors is higher in the CD44 + CD24 low+ population than in CD44 + CD24 neg, consistent with their greater colony and sphere forming abilities Metastasis Arose Uniquely from CD44 + CD24 low+ -Generated Tumors Having shown a greater frequency of sphere and tumor forming cells in CD44 + CD24 low+ than CD44 + CD24 neg populations, and a potential precursor-progeny relationship between the two, we next tested their metastatic potential. Orthotopic MDA- MB-231 tumors were excised at 1cm diameter, and animals monitored for subsequent metastasis by IVIS. Most CD44 + CD24 low+ tumors metastasized to lymph nodes, liver and/or spleen (10/19 animals). In contrast, none of the CD44 + CD24 neg tumors formed

68 52 metastasis (0/19 animals) (representative images, Figure 3.6D-E, P<0.01, Student t-test). Strikingly, one hundred CD44 + CD24 low+ cells not only yielded orthotopic tumors in 100% of animals, but 20% of these metastasized to liver or spleen (Figure 3.6E). CD44 + CD24 low+ orthotopic tumors also yielded extensive pulmonary micrometastasis, not detected by IVIS. Figure 3.8: CD44 + CD24 low+ generate orthotopic tumors with shorter latency than CD44 + CD24 neg Sorted or CD44 + CD24 neg (red) or CD44 + CD24 low+ (blue) MDA-MB-231 cells were injected orthotopically as described. A, Tumors latency from 10,000, 1000 and 100 sorted CD44 + CD24 neg (red) or CD44 + CD24 low+ (blue) cells is graphed (*, P < 0.05). B, Mean xenograft volume from 10,000 injected CD44 + CD24 neg (red) or CD44 + CD24 (blue) (means graphed ± SEM, *, P < 0.05).

69 53 Figure 3.9: Metastasis arose uniquely from CD44 + CD24 low+ generated tumors. Sorted or CD44 + CD24 neg (red) or CD44 + CD24 low+ (blue) MDA-MB-231 cells were injected orthotopically as described. A, Tumors excised at 1 cm diameter were followed for metastasis. Bioluminescence (photon/s) of metastatic tumor burden arising from CD44 + CD24 low+ tumors and the lack thereof from CD44 + CD24 neg is graphed. B, Representative IVIS images. C, Representative metastases in liver and spleen. Thus, CD44 + CD24 low+ cells have not only an increased proportion of tumor initiating cells, they also exhibit greater metastatic ability. No metastasis arose from CD44 + CD24 neg progenitors: while all primary tumors were excised at 1 cm, CD44 + CD24 low+ cells alone showed metastatic potential. Thus, the frequency of tumor initiating cells with metastatic potential is less than 1/100 in the CD44 + CD24 low+ population and exceeds 1/500,000, if they exist at all, in the CD44 + CD24 neg.

70 CD44 + CD24 low+ cells Preferentially Express Lung and Brain Metastatic Profiles Given the difference in metastatic potential of the two populations, gene expression profiles were compared after cell sorting. MDA-MB-231 lines with discrete metastatic tissue tropisms have been used to define and validate gene expression signatures for lung, bone, or brain metastasis (Minn et al., 2005; Kang et al., 2003; Bos et al., 2009). It is noteworthy that genes positively associated with enhanced metastasis from all three signatures were enriched in CD44 + CD24 low+ cells from MDA-MB-231 compared to CD44 + CD24 neg (see Figure 3.10A). Similarly, CD44 + CD24 low+ cells from DT-22 showed enrichment of lung and brain metastasis signature genes (see Figure 3.10B). Figure 3.10: CD44 + CD24 low+ cells preferentially expressed lung and brain metastasis signatures. Gene set analysis (GSA) shows preferential expression of lung and brain metastasis signatures in A, MDA-MB- 231 and B, primary DT-22. Shown are the ordered gene scores for each gene in the line plot and the average fold change in the heatmap (orange = high expression in CD44 + CD24 low+ and blue = low); enrichment score and p- value shown in upper left CD44 + CD24 low+ Show Activated Notch1 and Higher Embryonic Stem Cell Gene Expression Signaling pathways driving self-renewal of embryonic stem cells, such as Hedgehog, Notch and Wnt/β-catenin, have been implicated in mammary cancer stem cell

71 55 maintenance (Liu et al., 2006). Notch1 pathway activation, shown by increased Notch1 intracellular domain, N1-ICD (Figure 3.11A), was seen in CD44 + CD24 low+ but not in CD44 + CD24 neg cells from both MDA-MB-231 and DT-22 and confirmed by increased JAG1 and HEY1 expression (MDA-MB-231, Figure 3.11B). Other Notch isoforms were not activated. To confirm Notch pathway activation, a profile of genes upregulated following release from gamma-secretase inhibition was characterized. CD44 + CD24 low+ cells from MDA-MB-231 showed significant overexpression of this Notch pathway activation signature compared to CD44 + CD24 neg (Figure 3.11C). Embryonic transcription factors Sox-2 and Nanog are required for embryonic stem cell (ES) self-renewal (Li, 2010). Both showed significantly higher levels in CD44 + CD24 low+ than CD44 + CD24 neg cells in MDA-MB-231 and DT22 (Figure 3.11A). It is postulated that ES transcription factors (ES-TFs) contribute to CSC self-renewal, but few studies have demonstrated ES transcriptional program changes in cancer initiating cells. The upregulation of ES-TFs in CD44 + CD24 low+ cells was further validated by gene expression profiling in both MDA-MB-231 and DT22. Expression profiles characteristic of human ES (Assou et al., 2007), and genes whose promoters are bound and activated by Nanog, Oct4 and Sox2 (NOS targets) in hes, and the subset of NOS targets encoding transcriptional factors (NOS TFs) (Boyer et al., 2005; Ben-Porath et al., 2008) were all significantly enriched in CD44 + CD24 low+ compared to CD44 + CD24 neg cells from both MDA-MB-231 and the DT-22 culture (Figure 3.11D). Thus ES transcription programs are preferentially upregulated in the CD44 + CD24 low+ subpopulation over CD44 + CD24 neg.

72 56 A MDA-MB-231 DT-22 Notch1-ICD Sox2 Nanog β-actin CD24 neg CD24 low+ CD24 neg CD24 low+ B Fold change CD24 low+ / CD24 neg C Gene score NOTCH Targets D MDA-MB-231 DT-22 Gene score NOS TF up NOS TF up Gene score NOS Targets up NOS Targets up Figure 3.11: Notch1-ICD and embryonic transcription factors are preferentially expressed in CD44 + CD24 low+. CD44 + CD24 neg (CD24 neg ) and CD44 + CD24 low+ (CD24 low+ ) subpopulations of MDA-MB- 231 and DT-22 cells were flow sorted. A, Western blots. B, Q-PCR (mean fold change in CD24 low+ vs CD24 neg +/-SEM in MDA-MB-231). C, Notch target gene expression is enriched in MDA-MB-231 CD44 + CD24 low+ cells. D, GSA shows CD44 + CD24 low+ from indicated lines preferentially express NOStargets and NOS-TFs. The ordered scores for each gene in the line plot and the average fold change in the heatmap are shown (orange indicates high in CD44 + CD24 low+ and blue, low) with enrichment scores and p- values.

73 Self-renewal in CD44 + CD24 low+ is regulated via a Notch-1 mediated Sox2 activation The link between NOTCH activation and Sox2 upregulation and their importance to CSC self-renewal was further investigated. N1-ICD transduction into immortalized HC11 mammary epithelial cells caused >20 fold increase in SOX2 expression while other Notch isoforms did not (Figure 3.12A). The SOX2 promoter in human and murine cells contains multiple Notch consensus motifs. ChIP analysis demonstrated N1-ICD binding to two different SOX2 promoter sites in HC11 (Figure 3.12B). Similarly, N1-ICD overexpression in MDA-MB-231 increased both SOX2 expression and N1-ICD-binding to the proximal SOX2 promoter region (Figure 3.12C-E). MDA-MB-231-N1-ICD cells showed an increase in the % mammosphere forming cells and in the CD44 + CD24 low+ and ALDH1+ populations. Notably all of these were reduced by knockdown of Sox2 (Figure 3.12F-H). These data suggest that Notch1 critically upregulates Sox2, to promote CD44 + CD24 low+ cell self-renewal.

74 58 C A F % CD24 low+ Fold change Sox2 sisox2 N1- ICD Sox2 β-actin H C C _ + ** Spheres/ 10 4 cells * N1-ICD ** N1-ICD _ + * ** B TGGGAA D Fold 2 change Sox2 1 ** G Region 1 No site Region % ALDH * ** 0 Input neg ** IgG H TGGGAA E N1-ICD TSS % Sox2 2 promoter binding 1 Exon 1 Intron Exon2 C N1-ICD C N1-ICD 3 0 ** ** * Figure 3.12: Notch1-mediated Sox2 activation governs stem cell-like phenotype CD44 + CD24 low+ cells. A, Sox-2 Q-PCR in HC-11 cells +/- N1-ICD overexpression, graphed as fold change vs controls, normalized to HPRT. B, ChIP analysis shows N1-ICD and control histone H3 binding to indicated CSL binding sites in murine Sox-2 promoter in HC-11. C, D, E, Western of N1-ICD and Sox2 (C) Fold increased in Sox2 by Q-PCR (D) and % N1-ICD binding to Sox2 promoter (E) graphed +/- SEM in MDA- MB-231 +/- stable N1-ICD overexpression. F, G, H, Effects of sisox2 were assayed in MDA-MB-231 +/- N1-ICD overexpression on % CD44 + CD24 low+ (F), spheres formed/ 2,000 plated (G), and % ALDH1 + cells (H). Graphs show mean +/-SEM; *, p<0.05 and **, p<0.02 by T Test.

75 Differential Sensitivity to γ-secretase Inhibitor in CSC Populations NOTCH pathway activation in CSC (Wang et al., 2009) has prompted clinical trials of γ-secretase inhibitors (GSI) in cancers. Present data suggest that only part of the TNBC CSC population may be capable of drug response. As expected from the findings above, the γ-secretase inhibitor, DAPT, not only significantly reduced N1-ICD in CD44 + CD24 low+ from both MDA-MB-231 and DT22, but notably reduced Sox2 (Figure 3.13A,C). Figure 3.13: ϒ -secretase inhibitors target CD44 + CD24 low+ but not CD44 + CD24 neg population. CD44 + CD24 low+ (CD24 low+ ) and CD44 + CD24 neg (CD24 neg ) cells sorted from MDA-MB-231 (A, B) and DT22 (C, D) were treated or not with DAPT. A & C, Effect of DAPT on cleaved Notch1 and Sox2 +/- after 24 hrs 5-10 µm DAPT in CD44 + CD24 low+ cells. B & D, Serial mammospheres of indicated cells were plated from sorted populations +/- 5µM DAPT. (**T test, P < 0.01). E, Mean soft agar colonies arising from sorted populations treated +/- 5uM DAPT (+/-SEM, **T test, P < 0.01).

76 60 DAPT consistently reduced serial mammosphere formation by CD44 + CD24 low+ cells but had no effect on CD44 + CD24 neg from sorted populations. DAPT consistently reduced sphere formation by about 50% over serial passage in CD44 + CD24 low+ cells from DT-22, DT-25 and MDA-MB-231 (Figure 3.13B,D and 3.14). This could reflect incomplete NOTCH inhibition or indicate the presence of a NOTCH-independent subpopulation within CD24low sphere-forming cells. While the % sphere forming cells was lower in CD44 + CD24 neg and declined with successive passage, DAPT did not affect sphere formation (Figure 3.13B, D). Thus, DAPT effects on spheres from MDA-MB-231 were validated in two TNBC dissociated tumor cultures, DT-22 and DT-25 (Figure 3.13 and 3.14). Notably, colony formation by CD44 + CD24 low+ cells was similarly attenuated by DAPT compared to DMSO-treated controls while that of CD44 + CD24 neg cells was unaffected (Figure 3.13E). DT Spheres/ cells 10 CD24 low+ * * * Ctrl DAPT Spheres/ cells 10 CD24 neg ** Ctrl DAPT Figure 3.14: ϒ-secretase inhibitors attenuate self-renewal of CD44 + CD24 low+ but not CD44 + CD24 neg. CD44 + CD24 low+ (CD24 low+ ) and CD44 + CD24 neg (CD24 neg ) cells sorted from DT-25 were treated with DMSO or DAPT. Mammospheres arising from sorted populations treated +/- 5uM DAPT are graphed as mean +/-SEM. Serial mammospheres from CD24 low+ DAPT-treated cells were significantly reduced compared to respective untreated controls. (*) denotes means statistically different by T test from control primary spheres, P < 0.01). Both treated and untreated tertiary mammospheres from CD24 neg cells were reduced significantly compared to primary spheres, but both with unaffected by DAPT

77 61 Differences in CSC frequency and in GSI response between CD24 low and negative cells were further investigated in vivo with DT-22. As for MDA-MB-231, CD44 + CD24 low+ DT-22 cells generated more tumors (16/16) with shorter latency and faster growth than those arising in 12/16 CD44 + CD24 neg -injected mice (Figure 3.15A,B). RO treatment significantly inhibited growth of CD44 + CD24 low+ -derived tumors but not those arising from CD44 + CD24 neg (Figure 3.15B). Figure 3.15: ϒ -secretase inhibitors target CD44 + CD24 low+ but not CD44 + CD24 neg population. CD44 + CD24 low+ (CD24 low+ ) and CD44 + CD24 neg (CD24 neg ) cells sorted from DT-22 A, Latency of orthotopic DT-22 tumors formed from 100,000 sorted CD44 + CD24 neg (red) or CD44 + CD24 low+ (blue) is presented (*, P < 0.05). B, Mean volume of DT-22 xenografts arising from CD44 + CD24 low+ or CD44 + CD24 neg +/- 14 day RO treatment as described ( ± SEM, **, P < 0.01).

78 DISCUSSION While many solid tumors appear to be driven by CSCs that give rise to diverse, less proliferatively robust progeny and survive chemo and radiation therapies, few models have characterized phenotypically distinct subsets of cells within CSC populations. Similarly, despite the widely accepted postulate that CSCs generate metastasis, few studies have demonstrated heterogeneity in the metastatic potential of CSCs experimentally. The difficulty of isolating sufficient numbers of CSCs from primary cancers to permit their molecular characterization has hampered efforts to define targetable nodes critical for CSC survival, self-renewal vs differentiation, therapy resistance and metastasis. The present study used not only TNBC lines as a models, but findings were confirmed in at least two and up to five different early passage primary human TNBC cultures. The use of primary tumor cultures--while an imperfect substitute for primary tumor analysis--has permitted molecular investigation of CSC subsets not feasible in the primary cancers. Here, we provide evidence that the CD24 low and CD24 negative cells in the CSC- enriched CD44 + CD24 neg/low population in TNBC cell lines and primary dissociated cancers comprise distinct phenotypes. The minor population with low surface CD24 positivity (CD24 low+ ) representing 11-23% of CD44+ cells, appear to be situated higher in a putative stem cell hierarchy. They have greater sphere forming potential, increased clonogenicity and give rise to CD44 + CD24 neg ; while CD44 + CD24 neg yield only CD44 + CD24 neg progeny. In contrast, fewer CD44 + CD24 neg cells form spheres and this ability was progressively attenuated with serial passage. Both cell types contain tumor initiating stem cells and generate orthotopic xenografts, but the CD44 + CD24 neg -derived

79 63 tumor latency was greater and these failed to metastasize. Notably, CD44 + CD24 low+ cells overexpress ES genes, show preferential expression of metastatic gene signatures and fewer than 1/100 cells yield tumors that metastasize from the primary site. The dominant CD24 neg subpopulation within CD44 + CD24 neg/low cells showed no NOTCH1 activation and was completely GSI insensitive highlighting the important therapeutic implications of heterogeneity within cancer stem cells. Surface CD24 expression is observed in CSC enriched populations in colon (Yeung et al., 2010) and pancreatic cancers (Li et al., 2007). Increased CD24 surface and/or cytoplasmic expression has been associated with breast and bladder cancer metastasis and poor outcome (Shipitsin et al., 2007; Bircan et al., 2006; Athanassiadou et al., 2009; Overdevest et al., 2011). CD24 expression was higher in metastatic nodes than primary bladder cancers and loss of CD24 reduced experimental lung metastasis (Overdevest et al., 2011). Recent work also showed a requirement for CD24 for metastasis for CSC generated primary orthotopic sites in a murine lung cancer model (C. Kim, personal communication). In hepatocellular carcinoma, a CD24 + population comprising >90% CD133 + cells, was enriched by cisplatinum, generated more tumor spheres and was uniquely able to generate metastasis from primary xenografts (Lee et al., 2011). CD24 + cells also gave rise to CD24 neg and STAT3-driven nanog expression was implicated in their high self-renewal. A role for CD24 in breast cancer metastasis is also supported by our findings. CD44 + CD24 low+ tumor initiating frequency was higher, orthotopic xenografts arose with shorter latency and metastases were only observed from CD44 + CD24 low+ derived cancers not CD44 + CD24 neg. CD44 + CD24 low+ primaries generated not only gross multi-organ

80 64 metastasis, but also numerous lung micrometastasis. The link between this CSC phenotype and metastasis is further supported by gene profiling. In both the MDA-MB- 231 and DT-22 models, CD44 + CD24 low+ significantly overexpress gene profiles previously shown to be more highly expressed in breast cancers that metastasized to lung (Minn et al., 2005) or to brain (Bos et al., 2009) and were over-represented by genes of the bone metastasis signature (Kang et al., 2003). These data support the notion that pre-cursor progeny relationships can exist in CSC populations, yielding subsets that differ in self-renewal and in the ability to establish metastasis (Dalerba et al., 2007). That CSC subsets may differ in metastatic potential was first supported in a human pancreatic model, in which tumors formed by CXCR4 positive CD133 + pancreatic CSC could generate experimental lung metastasis while CD133 + CXCR4 - cells did not (Hermann et al., 2007). Within colon cancer CSCs, the CD26+ subset of CD133 + CD44 + cells showed the highest rate of metastasis from orthotopic cecal implants, while CD26 negative xenografts were confined to the cecum (Pang et al., 2010). Similarly, while CD90 + CD44 - and CD90 + CD44 + fractions of hepatocellular carcinoma lines are tumorigenic, only CD90+CD44+ cells form lung metastasis (Yang et al., 2008). The present data add to our understanding of CSC populations with distinct metastatic potential in TNBC. The relationship between ALDH1 and surface marker enriched breast CSC is poorly understood. Cells expressing aldehyde dehydrogenase activity are very infrequent within the CD44 + CD24 low/neg CSC breast cancer populations (Ginestier et al., 2007; Fillmore and Kuperwasser, 2008; Charafe-Jauffret et al., 2009; Croker et al., 2008). Thus, it is noteworthy that in both MDA-MB-231 and in the DT populations assayed, over

81 65 ninety % of ALDH1 positive cells were also CD44 + CD24 low+. ESA expression is also a feature of CSC from primary breast cancers (Al Hajj et al., 2003). In the TNBC models herein, ESA+ populations were also largely CD44 + CD24 low+ (>70%+). ESA expression has also been correlated with metastatic CSC subsets in other liver cancer (Lee et al., 2011). Since this work addressed only the triple negative breast cancers, further investigation will be required to determine if this CSC is present in other forms of breast cancer, notably ER positive cancers. Sorted CD44 + CD24 low+ cells showed expression of Notch1-ICD and of embryonic transcription factors, Sox2 and Nanog, in both models. Our expression profiling showed that genes differentially expressed in CD24 low+ versus CD24 neg subpopulations were statistically overrepresented in the ES gene profile (Assou et al., 2007), in profiles of genes overlapping in Nanog, Oct4 and Sox2 ChIP arrays (NOS targets) and in a subset of these with known transcriptional function (NOS-TFs) (Boyer et al., 2005). It is noteworthy that while aggressive ER negative cancers showed an ES-cell like expression profile, prior efforts did not show preferential expression of an ES gene profile in CD44 + CD24 neg/low populations (Ben-Porath et al., 2008). This may reflect the abundance (>80%) of CD24 negative cells in CD44 + CD24 neg/low. Different Notch family members have been implicated in stem cell self-renewal (Wang et al., 2009) and play critical roles in embryogenesis and in fate determination in mammogenesis (Bouras et al., 2008; Raouf et al., 2008). Notch 1 and 4 are pro-viral integration sites in mammary tumors (Pannuti et al., 2010) and Notch 4 upregulation was observed in mammary CSCs in primary ER+ cancers (Harrison et al., 2010). Notch1 overexpression in breast cancer is correlated with worse prognosis (Stylianou et al., 2006;

82 66 Reedijk et al., 2005). The greater activation of N1-ICD and of Notch targets in the CD44 + CD24 low+ subpopulation compared to CD24 neg led us to investigate their functional significance. GSI treatment attenuated N1-ICD, and reduced Sox2, sphere formation and clonogenic growth exclusively in the CD44 + CD24 low+ population. Sox2 is a driver of ES self-renewal and deregulated Sox2 may play a role in human cancers. N1-ICD overexpression in murine mammary epithelial cells and in ER-negative breast cancer cells induced Sox2, and N1-ICD bound the Sox2 promoter in both. Moreover, N1-ICD overexpressing MDA-MB-231 showed a Sox2-dependent increase in the % of ALDH1+ and % CD44 + CD24 low+ CSCs, and in sphere formation, suggesting that Notch1 critically activates Sox2 to drive CSC self-renewal in these ER negative breast cancer models. One of the implications of a potential hierarchy within malignant stem cell populations is that more primitive progenitors may not only have a greater metastatic propensity, they may also differ from their bulk progeny and escape therapy to repopulate. While Notch inhibitors are in development to therapeutically target CSCs (Pannuti et al., 2010), the two CSCs populations characterized herein differed notably in responses to GSI. Only the CD44 + CD24 low+ CSC subpopulation showed responsiveness to GSI, with a significant loss of sphere, soft agar colony and tumor formation. These findings are compatible with reports of depletion of breast cancer stem cells by anti- Notch1 antibody (Sharma et al., 2011) and loss of experimental brain metastasis following shnotch1 (McGowan et al., 2011) in xenograft models. Notably GSI had no effect on CD44 + CD24 neg cells that comprise the majority of TNBC CSC population. The present data suggest that Notch1/Sox2 dependence may be restricted within CSC subsets and support the notion that functionally discrete CSC subpopulations may limit responses

83 67 to targeted therapies. Further efforts to define phenotypically and therapeutically distinct CSC subpopulations may open new avenues for more effective cancer therapy.

84 CHAPTER 4: SUMMARY AND FUTURE DIRECTIONS 4.1 SUMMARY Accumulating evidence over the past decade supports the existence of a CSC subpopulation within breast tumors that is responsible for tumor initiation, progression and drug resistance. However, few models have characterized phenotypically distinct subsets of cells within CSC populations that may underlie the heterogeneity that is present to drug response. Similarly, despite the widely accepted postulate that CSCs generate metastasis, few studies have demonstrated heterogeneity in the metastatic potential of CSCs experimentally. The work in this thesis provides evidence for discrete subsets among CSCs of the most deadly form of breast cancer: that lacking estrogen and progesterone receptors and HER2 amplification (so called triple negative hereafter TNBC). We postulated that, as for normal stem cells, primary TNBC-derived cultures and immortal lines would have a CSC hierarchy with precursor/progeny populations that differ in molecular pathways conferring self-renewal, tumorigenicity and metastatic potential. In Chapter 3, I demonstrate a functional hierarchy within CD44 + CD24 neg/low subpopulations from a TNBC line and primary TNBC dissociated tumors (DTs). The minor CD44 + CD24 low+ population shows greater self-renewal and gives rise to CD44 + CD24 neg. In contrast, CD44 + CD24 neg progeny are exclusively CD44 + CD24 neg both in 2D culture and in spheres, and show more limited self-renewal. CD44 + CD24 low+ are enriched in ES-cell and metastatic gene signatures and are more tumorigenic than CD44 + CD24 neg. Moreover, <1/100 CD44 + CD24 low+ generate xenografts that metastasize, while no metastasis arose from up to 500,000 CD44 + CD24 neg cells. In CD44 + CD24 low+ 68

85 69 cells, Notch1 was shown to directly bind the Sox2 promoter and Sox2 appears to drive self-renewal. Although Notch has been previously implicated in breast cancer stem cell self-renewal, the CD44 + CD24 neg CSC sub-population was unaffected by Notch inhibition in 2D culture, sphere and xenograft assays, revealing a heretofore unappreciated heterogeneity in responsiveness to gamma secretase inhibitor drugs in CSCs. Our observations in TNBC suggest a model in which two distinct subsets of CSCs may coexist in the same cancer cell population: one with the capacity to self-renew (CD44 + CD24 neg ) and one with the capacity to self-renew and form metastasis (CD44 + CD24 low+ ). We also demonstrate a potential lineage relationship between these two subsets in which the CD44 + CD24 low+ metastatic CSCs can give rise to CD44 + CD24 neg but not vice-versa suggesting that CD24 may play a facilitating role in the formation of metastasis. In the course of my thesis studies, I made a number of observations that were not included in the work described in Chapter 3. These observations warrant further investigation. To further characterize the molecular mechanisms underlying the selfrenewal, tumorigenicity and metastatic phenotype observed in the CD44 + CD24 low+ CSC subpopulation, I outline additional experiments in this chapter to: (1) explore therapeutic strategies to target signaling pathways activated in the CD44 + CD24 low+ breast CSCs, and (2) investigate the functional role of micrornas in the CD44 + CD24 low+ breast CSCs.

86 FUTURE DIRECTIONS- THERAPEUTIC STRATEGIES TO TARGET SIGNALING PATHWAYS PREFERENTIALLY ACTIVATED IN THE CD44 + CD24 LOW+ COMPARED TO CD44 + CD24 NEG BREAST CSCS Several pathways, in addition to the developmental pathways described earlier, are known to be differentially activated in CSC over bulk tumor populations. These include cell survival pathways, such as the NFκB and PI3-K pathways, which have been reported to be preferentially required in certain CSC types such as leukemia stem cells. Jordan and colleagues demonstrated a constitutive activation of NFκB pathway in primitive AML cells and showed that NFκB pathway specific inhibitors could selectively induce apoptosis in leukemia stem cells but not in normal hematopoietic stem cells (Guzman et al., 2001). Further studies in other tumor types are needed to identify mechanisms that preferentially control growth or survival in cancer stem cells. These would focus our research to target these pathways for therapeutic eradication of cancer stem cells. We were thus prompted to identify signaling pathways preferentially activated in the CD44 + CD24 low+ breast CSC subset as compared to the CD44 + CD24 neg population Preliminary Results I examined by Western blot, the levels of phosphorylated, activated pmapk, psrc, pakt and prsk in both CD44 + CD24 low+ and CD44 + CD24 neg cells sorted from MDA-MB-231 and primary DT-23 and observed that the MAPK, Src and PI3-K pathways showed greater activity in the CD44 + CD24 low+ cells compared to CD44 + CD24 neg cells sorted from both MDA-MB-231 and primary DT-23 (Figure 4.1).

87 71 Figure 4.1: Activation of MAPK, PI3-K and Src pathways in the CD44 + CD24 low+ cells. Western blot analysis of expression of phospho and total RSK, AKT, MAPK and Src in the CD44 + CD24 low+ and CD44 + CD24 neg from MDA-MB-231 and primary DT-23. β-actin was a loading control Therapeutic Relevance of Differential MEK/MAPK, Src and PI3-K/mTOR Pathway Activation Based on the above findings, we plan to explore if targeting these pathways may be a valid therapeutic approach to oppose self-renewal and metastasis of breast CSCs. Experiments to address this are outlined: A. To test the effect of MAPK/MEK inhibition on the self-renewal of sorted CD44 + CD24 low+ versus CD44 + CD24 neg cells, we will use two MEK inhibitors, AZD6244 and PD and test if these drugs preferentially inhibit the CD24 low+ population. The drug effect inhibition of the MAPK pathway will be confirmed by the downregulation of the phospho p42/44 MAPK and phospho MEK1/2 proteins by western blotting in the CD44 + CD24 low+ population sorted from MDA-MB-231, and from primary DT-22 and DT-23 cultures. Drug effects

88 72 on sphere formation and growth in soft agar will also test whether the ability of CD44 + CD24 low+ to generate CD44 + CD24 neg progeny is affected by MEK inhibitor drug exposure. The drug effects will also be tested on the viability, proliferation and cell cycle profiles of sorted CD44 + CD24 low+ and CD44 + CD24 neg cells. We expect to observe attenuation of sphere and colony formation from MEK inhibition in the CD44 + CD24 low+ cells while the CD44 + CD24 neg will be unaffected. B. To investigate the effects of the MEK inhibitor on the tumorigenicity of CD44 + CD24 low+ and CD44 + CD24 neg cells sorted from MDA-MB-231 and/or DT-22 in Balb/c nude mice. The impact of the drug will be assessed in two ways. In the first method, when measurable tumors are established, mice will be randomly distributed into groups to receive either vehicle control or PD by daily oral administration and tumor growth will be monitored. In this first set of experiments, drug effects in pre-existing tumors growth and the formation of metastasis will be examined. A second set of experiments would test the ability of drug to prevent or delay tumor onset by treating Balb/c nude mice with the PD for ten days, starting at the day the cells are injected into the mice. In both experiments above, when primary tumors reach 1.5 cm in diameter, they will be excised and animals will be followed for the development of metastasis. Tumors will be dissociated to single cell suspensions for reimplantation into secondary recipients and for analysis of CD44, CD24 and ALDH1+ expression in treated versus control groups.

89 73 We anticipate a differential response of CD44 + CD24 low+ and CD44 + CD24 neg cells to MEK inhibition. Thus, we expect the MEK inhibitor to decrease tumor latency and growth of established tumors formed from the CD44 + CD24 low+ with no effect on the tumors formed from the CD44 + CD24 neg cells. In addition, inhibition of the MAPK/MEK pathway may reduce the metastatic potential of CD44 + CD24 low+ cells. Since we also showed preferential activation of both psrc and the PI3K/mTOR pathways in CD44 + CD24 low+ and CD44 + CD24 neg cells, similar experimental plans as outlined above will carried out using the Src inhibitor (AZD6244 at 10uM) and PI3- K/mTOR inhibitor (PF at 250nM) to assess the effects of inhibition of these pathways on the self-renewal in vitro and on tumorigenicity and metastasis of these TNBC CSC subtypes. If there is a striking difference in responses of the two subtypes of cells, with the CD24 low+ population showing preferential sensitivity to these pathway inhibitor drugs, it might be useful to test the potential for synergy between chemotherapy drugs and these targeted agents in vitro and in xenograft experiments. My preliminary work indicates that the CD24 low subpopulation has a greater ability to survive exposure to cytotoxic paclitaxel drug and CD24 neg cells died rapidly through apoptosis. Thus, combined targeted therapy may preferentially hit the CD24 low cells while the chemotherapy eradicates their CD24 neg progeny. If promising, these data may support further investigation of combinations targeting one or more of these mitogenic pathways with chemotherapy in the context of clinical trials.

90 FUTURE DIRECTIONS- INVESTIGATING THE FUNCTIONAL ROLE OF MICRORNAs IN CD44 + CD24 low+ COMPARED TO CD44 + CD24 neg BREAST CSCs Introductory Remarks MicroRNAs (mirnas) are endogenous small noncoding RNAs that regulate gene expression with functional links to tumorigenesis. mirnas identify their targets by base pairing of the seed sequence of the mirna with complementary binding within the target mrna s 3 untranslated region (UTR). This targeting is carried out in synchronization with the RNA-induced silencing complex (RISC), and often results in either degradation or translational inhibition of the targets (Chang et al., 2008). mirnas have been shown to play important roles in regulating developmental, physiological and oncogenic processes. Increasing evidence has suggested that mirnas might also be involved in regulating CSC properties. Firstly, mirna expression signatures specific for CSC populations have been investigated in several cancers. In breast cancer, Yu and colleagues reported that let-7 as well as a number of other mirnas including mir-16, mir-107, mir-128 and mir-20b were significantly reduced in breast CSC when these were enriched by consecutively passaging the breast cancer cell line SKBR3 in mice treated with chemotherapy (Yu et al., 2007). M. Clarke s group identified a set of mirnas to be differentially expressed in CD44 + /CD24 neg/low+ breast CSC population, in which three clusters, mir-200c-141, mir-200b-200a-429, and mir were significantly downregulated (Shimono et al., 2009). MiRNA deregulation has also been reported in glioblastoma and other brain CSCs. For example, by comparing mirna expression in CD133 + glioblastoma stem cells with the CD133 - population, Gal et al.

91 75 showed that mir-451 as well as mir-486, mir-425, mir-16, mir-107 and mir-185 level were increased in the CD133- population (Gal et al., 2008). In hepatic CSC identified by EpCAM+ profile, researchers also discovered a unique mirna signature in which mir- 181 family and several mir cluster members were up-regulated in the CSC population (Ji et al., 2009). mirnas may also regulate metastasis by CSC. Lui et al demonstrated mir-34a was downregulated in CD44 + prostate cancer CSCs purified from xenograft and primary tumors. Enforced expression of mir-34a in bulk or purified CD44 + prostate cancer cells inhibited clonogenic expansion, tumor regeneration, and metastasis. Furthermore, systemic delivery of mir-34a in tumor bearing mice attenuated tumor progression and metastasis, leading to extended animal survival (Liu et al., 2011). Our understanding of the specific roles of micrornas within CSC subsets and how they may promote cancer metastasis and chemoresistance is limited. Thus, I performed mirna profiling to identify key mirnas that are differentially expressed between the CD44 + CD24 low+ and CD44 + CD24 neg cells in both MDA-MB-231 and primary DT-23 cells Preliminary Results The mirna expression profiling showed several mirnas that were either upregulated or downregulated in the CD44 + CD24 low+ relative to CD44 + CD24 neg cells. We found mir-181c, mir-181b, mir-148a, mir-222, mir-296-5p, mir-181a* were upregulated and mir-34c, mir-24-1, mir-30a*, mir-195, mir-663 were downregulated preferentially in the CD24 low versus CD24 neg populations. Some of these have been

92 76 previously implicated in self-renewal of embryonic stem cells such as mir-296-5p (Tay et al., 2008). Interestingly, the mirna-181 family members, including mir-181b, mir- 181c and mir-181a* were found to be commonly upregulated in the CD44 + CD24 low+ subpopulation from both the MDA-MB-231 and DT-23 cultures (Figure 4.2). This family has been previously shown to regulate hepatic EpCAM + CSCs (Ji et al., 2009). Figure 4.2: mirna expression profiling in the CD44 + CD24 low+ and CD44 + CD24 neg from MDA-MB- 231 and primary DT-23. Fold change in expression of the mirnas in the CD44 + CD24 low+ over CD44 + CD24 neg is presented Investigating the role of mirnas in mediating chemoresistance of CD44 + CD24 low+ cells Increasing data suggests that chemotherapy resistant CSCs may give rise to cancer recurrence (Frank et al., 2010), but to date, differential chemosensitivity has not been demonstrated within subsets of CSCs from the same cancer derived population. We