Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
|
|
|
- Alexis Potter
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent mean ± s.d. (n=3). (b) MCF-7 cells or ALDH-positive cell population were treated with 5-fluorouracil (5-FU; 100 M) or doxorubicin (10 M). After 3 days, cell viability were analyzed by MTS assay. Data represent mean ± s.d. (n=3). (c) Tumorigenicity of MCF-7 cells or ALDH-positive cell population. Balb/c nude mice were subcutaneously injected with MCF-7 cells or ALDH-positive MCF-7 cells. Tumor incidence was indicated by tumors/injections at 6 week after injection.
2 Supplementary Figure 2. Expression of S1PRs in MCF-7 cells. Each expression of S1PRs was analyzed by RT-PCR using MCF-7 cdna. HUVECs, which express all S1PRs, were used as a positive control.
3 Supplementary Figure 3. Effect of dihydro-s1p on ALDH-positive cell population in MCF-7cells. Dose-dependent effects of dihydro-s1p in the proportion of ALDH-positive cell population. Data represent mean ± s.d. (n=3).
4 Supplementary Figure 4. Effect of S1PR3 knockdown on mammosphere formation in MCF-7cells. (a) Expression level of S1PR3 in shrna-transduced MCF-7 cells. Data represent mean ± s.d. (n=3). (b) Mammosphere-forming efficiency of shrna-transduced MCF-7 cells after stimulation with S1P (100 nm, 72 h). The mammospheres were counted and the percentage of mammosphere-forming cells was determined as mammosphere-forming efficiency (%).Data represent mean ± s.d. (n=3).
5 Supplementary Figure 5. S1P-induced increase in ALDH-positive cell population in MDA-MB-231 cells. (a) Representative flow data with ALDH substrate in the presence or absence with S1P (100 nm, 3 days) in MDA-MB-231 cells. (b) After treatment with S1PR3 antagonists TY52156 (TY; 1 M), CAY10444 (CAY; 10 M) or a S1PR2 antagonist JTE013 (JTE; 10 M), MDA-MB-231 cells were stimulated with S1P and ALDH-positive cell population were then analyzed. Data represent mean ± s.d. (n=3). (c) After MDA-MB-231 cells were treated with S1P (100 nm) for 24 h, expression levels of Hes1, Gli1 and Dkk1 were analyzed by qpcr. Data represent mean ± s.d. (n=3). (d) After treatment with DAPT (5 M), MDA-MB-231 cells were stimulated with S1P and ALDH assay were then performed. Data represent mean ± s.d. (n=3).
6
7 Supplementary Figure 6. S1P-induced increase in ALDH-positive cell population in human lung cancer A549 cells, human prostate cancer LNCaP cells, human glioma U251 cells and human ovarian cancer OVCAR-5 cells. (a) Representative flow data with ALDH substrate in the presence or absence with S1P (100 nm, 3 days) in A549 cells, LNCaP cells, U251 cells or OVCAR-5 cells. (b) After pretreatment with 1 M TY52156 (TY) or 5 M DAPT, the cells were stimulated with S1P (100 nm) and ALDH assay were then performed. Data represent mean ± s.d. (n=3).
8 Supplementary Figure 7. Effect of S1P on Hes1 expression and ADAM17 activity in ALDH-positive cell population. (a) Stimulation with S1P (100 nm, 24 h) induced Hes1 expression in ALDH-positive MCF-7 cells. Data represent mean ± s.d. (n=3). (b) Stimulation with S1P (100 nm, 24 h) induced Hes1 expression in ALDH-positive A549, LNCaP, U251 and OVCAR-5 cells. Data represent mean ± s.d. (n=3). (c) Stimulation with S1P (100 nm, 4 h) induced ADAM17 activity in ALDH-positive MCF-7 cells. Data represent mean ± s.d. (n=3).
9 Supplementary Figure 8. Effects of Hedgehog and Wnt inhibitor on each target gene expression in MCF-7 cells. (a) After MCF-7 cells were treated with of 200 ng ml -1 Sonic hedgehog with or without cyclopamine (10 M), expression of Gli1 were analyzed by qpcr. (b) After MCF-7 cells were treated with of 50 ng ml -1 Wnt3a with or without PNU74654 (10 M), expression of Dkk1 were analyzed by qpcr. Data represent mean ± s.d. (n=3).
10 Supplementary Figure 9. Effects of overexpression of NICD on ALDH-positive cell population in MCF-7 cells. (a) After overexpression of N2ICD, N3ICD or N4ICD, ALDH-positive cell population was analyzed in MCF-7 cells. Data represent mean ± s.d. (n=3). (b) Immunoblotting of N3ICD in MCF-7 cells treated S1P (100 nm) or LPA (100 nm). N3ICD-overexpressed cell lysates were used as a control.
11 Supplementary Figure 10. Knockdown by sirna against Notch1 in MCF-7 cells. Expression level of Notch1 mrna (left) and protein (right) in sirna-transfected MCF-7 cells was analyzed by qpcr and immunoblotting. Data represent mean ± s.d. (n=3).
12 Supplementary Figure 11. S1P-induced ALDH-positive population is independent on Notch ligands in MCF-7 cells. (a) After treatment with S1P (100 nm), expression level of Notch ligands were analyzed by qpcr. Data represent mean ± s.d. (n=3). (b) Effects of sirna against JAG1, JAG2, Dll1 and Dll4 on DFO-induced target gene expression. Data represent mean ± s.d. (n=3). (c) Effect of neutralizing antibody to JAG1 on JAG1-Fc-induced Hes1 expression. Data represent mean ± s.d. (n=3). (d) Effect of neutralizing antibody to JAG1 on S1P-induced increase in ALDH-positive cell population. Data represent mean ± s.d. (n=3).
13 Supplementary Figure 12. S1P-induced activation of -secretase via S1PR3 and G i in MCF-7 cells. (a) After stimulation with 100 nm S1P or 100 nm LPA for 4 h, -secretase activity was analyzed in MCF-7 cells. (b) After stimulation with S1P in the presence or absence of CAY10444 (10 M) or PTX (0.1 g ml -1 ), -secretase activity was analyzed in MCF-7 cells. (c) Effects of constitutively active (CA) mutants of G i or G 12 on γ-secretase activity in MCF-7 cells. Data represent mean ± s.d. (n=3).
14 Supplementary Figure 13. The p38mapk inhibitor SB inhibited the S1P-induced increase in ALDH-positive cell population via ADAM17 in MCF-7 cells. (a) MCF-7 cells were stimulated with S1P (100 nm) for the indicated times and were then immunoblotted with antibodies to phospho-p38mapk or p38mapk. Data represent mean ± s.d. (n=3). (b) Effects of SB (1 M), U0126 (1 M) or LY (20 M) on S1P-induced ADAM17 activation. Data represent mean ± s.d. (n=3). (c) Effects of SB (1 M) or LY (20 M) on S1P-induced Hes1 expression. Data represent mean ± s.d. (n=3). (d) Effects of SB (1 M), U0126 (1 M) or LY (20 M) on S1P-induced increase in ALDH-positive cell population. Data represent mean ± s.d. (n=3). (e) Effect of LY (LY; 20 M) on E 2 (1 M)-induced Akt phosphorylation. (f) Effect of SB on S1P-induced association between p38mapk and ADAM17.
15 Supplementary Figure 14. Effects of SphK activity on overexpression of SphK1 or SphK2 in MCF-7 cells. (a) After transfection with Flag-SphK1, HA-SphK2 or empty vector, expression levels of SphK were determined in MCF-7 cells by immunoblotting. (b) SphK1 activity was measured in SphK1- or SphK2-overexpressed MCF-7 cells. Data represent mean ± s.d. (n=3). (c) SphK2 activity was measured in SphK1- or SphK2-overexpressed MCF-7 cells. Data represent mean ± s.d. (n=3).
16 Supplementary Figure 15. Effect of overexpression of SphK on ALDH-positive cell population in MDA-MB-231 cells. After MDA-MB-231 cells were transfected with SphK1 or SphK2, ALDH assay were performed. Data represent mean ± s.d. (n=3).
17 Supplementary Figure 16. Role of SphK1 in ALDH-positive cell population. (a) Effects of ABCC1 sirna and Spns2 sirna on the SphK1-induced ADAM17 activity, Hes1 expression and ALDH-positive cell population. Data represent mean ± s.d. (n=3). (b) Effect of ABCC1 inhibitor MK571 (5 M) on the SphK1-induced ADAM17 activation, Hes1 expression and ALDH-positive cell population. Data represent mean ± s.d. (n=3).
18 Supplementary Figure 17. Gating strategy for flow cytometry analysis of ALDH-stained samples in MCF-7 cells. Cells derived from disintegrated xenograft tumor samples were stained ALDH assay and APC-conjugated human TRA-1-85-specific antibodies. All samples were stained with 7-AAD just before flow cytometry. All samples were analyzed by sequential gating including main population (G1), single cells (G2, G3), viable (7-AAD-negative) cells (G4), human (TRA-1-85-positive) cells (G5). Negative controls with DEAB were used to establish a gate G6 (ALDH-positive) and G7 (ALDH-negative).
19 Supplementary Figure 18. Co-expression of S1PR3 and ALDH1 in tissue section from xenograft tumor. (a) Representative immunohistochemical images of S1PR3 (green) and ALDH1 (red) in sections of tumor xenografts derived from vector-, SphK1-, and SphK2-overexpressing ALDH-positive cells. Nuclei were counterstained by DAPI (blue). Bar = 30 m. (b) The number of S1PR3 and ALDH1-positive cells in xenografts derived from vector-, SphK1-, and SphK2-overexpressing ALDH-positive cells. The number of double-positive cells were counted in 5 fields per sample. Data represent mean ± s.d. (n=5).
20 Supplementary Figure 19. Original immunoblot data. Boxes indicate cropped images used in the figures.
21 Supplementary Figure 19. Continued
22 Supplementary Figure 19. Continued
23 Patients Age ER Her2 EGFR Supplementary Table 1. Characteristics of the patients
24 application forward reverse GAPDH qpcr GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA S1PR2 qpcr GCAAGTTCCACTCGGCAATGT AGCCAGAGAGCAAGGTATTGGC S1PR3 qpcr ATCCTGCCCCTCTACTCCAAGA GTGCGTAGAGGATCACGATGGT Oct3/4 qpcr ACATCAAAGCTCTGCAGAAAGAA CTGAATACCTTCCCAAATAGAACCC Nanog qpcr CAGAAGGCCTCAGCACCTAC ATTGTTCCAGGTCTGGTTGC c-myc qpcr CACGAAACTTTGCCCATAGC GCAAGGAGAGCCTTTCAGAG Gli1 qpcr GTGCAAGTCAAGCCAGAACA ATAGGGGCCTGACTGGAGAT Hes1 qpcr AGCGGGCGCAGATGAC CGTTCATGCACTCGCTGAA Dkk1 qpcr GGGCGGGAATAAGTACCAG CATAGCGTGACGCATGCAG Jagged1 qpcr CGGGATTTGGTTAATGGTTATC ATAGTCACTGGCACGGTTGTAGCAC Jagged2 qpcr GGTCGTACTTGCACTCACAATACC GTAGCAAGGCAGAGGGTTGC Dll1 qpcr CCAAGCCCTGCAAGAATGGA GGTGGGCAGGTACAGGAGTA Dll3 qpcr GAGACACCCAGGTCCTTTGA CAGTGGCAGATGTAGGCAGA Dll4 qpcr GTGGGTCAGAACTGGTTATGGA TGCAGATGACCCGGTAAGAGT Notch1 qpcr CACTGTGGGCGGGTCC GTTGTATTGGTTCGGCACCAT ABCC1 qpcr ATGTCACGTGGAATACCAGC GAAGACTGAACTCCCTTCCT Spns2 qpcr TTACTGGCTCCAGCGTGA TGATCATGCCCAGGACAG S1PR1 RT-PCR GACTCTGCTGGCAAATTCAAGCGAC ACCCTTCCCAGTGCATTGTTCACAG S1PR2 RT-PCR GTCATCCTCTGTTGCGCCATTGTG AGGCTGAAGACAGAGGCCGAGAGC S1PR3 RT-PCR GCCCCATCCTCTTCAAGGCTCAGT GTGGGGCAGGTCTTCCTTGACCTT S1PR4 RT-PCR TCCAGCCTTCTGCCCCTCTACTCC CAGGAAGGCCAGCAGGATCATCAG S1PR5 RT-PCR ACAACTACACCGGCAAGCTC GCCCCGACAGTAGGATGTT GAPDH RT-PCR CGGAGTCAACGGATTGGTCGTAT AGCCTTCTCCATGGTGGTGAAGAC Supplementary Table 2. List of primer sequences for PCR
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of
SUPPLEMENTAL DATA Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of cancer stem cells and interleukin-8 Neil E. Bhola 1, Justin M. Balko 1, Teresa C.
Supplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Supplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC
A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive
SUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer
SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer Supplementary Material Supplementary Methods Supplementary References Supplementary Figure
Supplemental Figure S1A Notch1
Supplemental Figure S1A Notch1 erage) epth of Cove ormalized De Log1(No Notch exons Figure S1: A) Relative coverage of Notch1 and Notch 2 exons in HCC2218, HCC1187, MB157, MDA-MB157 cell lines. Blue color
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table File Name: Peer Review File Description: Supplementary Table 1 Primers and taqman probes used were the following:
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance
Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance Tanaka H, Kono E, Tran CP, Miyazaki H, Yamashiro J, Shimomura T, Ladan F, Wada R, Huang
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
Supplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
Supplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Supplementary Materials
Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Supplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
Supplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/3/e1400244/dc1 Supplementary Materials for PlGF-induced VEGFR1-dependent vascular remodeling determines opposing antitumor effects and drug resistance to
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
Supplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes
Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014 Outline I. Introduction II. Research route & Results III. Summary Diabetes the Epidemic of the 21st Century
mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions
Supplementary Information mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Shyuichiro Matsubara 1, Qiang Ding 1, Yumi Miyazaki 1, Taisaku Kuwahata
SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
s u p p l e m e n ta ry i n f o r m at i o n
Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Tbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),
Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells
Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
The mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines
Supplementary information Supplementary Figure -9 Supplementary Table -4 The mir-99a/brm/egr axis is a determinant of anchorage-independent growth in epithelial tumor cell lines Kazuyoshi Kobayashi, Kouhei
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
Supplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
SUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high
Targeting Notch, a key pathway for ovarian cancer stem cells, sensitizes tumors to platinum therapy
Targeting Notch, a key pathway for ovarian cancer stem cells, sensitizes tumors to platinum therapy Shannon M. McAuliffe a,1, Stefanie L. Morgan a,1, Gregory A. Wyant a,2, Lieu T. Tran a,2, Katherine W.
Numb Regulates Glioma Stem Cell Fate and Growth by Altering Epidermal Growth Factor Receptor and Skp1-Cullin-F-Box Ubiquitin Ligase Activity
CANCER STEM CELLS Numb Regulates Glioma Stem Cell Fate and Growth by Altering Epidermal Growth Factor Receptor and Skp1-Cullin-F-Box Ubiquitin Ligase Activity XIULI JIANG, a HONGYAN XING, a TAE-MIN KIM,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt
Supplementary Information CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt Jae Hyang Lim, Hirofumi Jono, Kensei Komatsu, Chang-Hoon Woo, Jiyun Lee, Masanori Miyata,
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
Supplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
Supplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
JCB. Supplemental material. Gu et al.,
Supplemental material Gu et al., http://www.jcb.org/cgi/content/full/jcb.201010075/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. S1P directly induces actin assembly. Actin assembly at the
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
Data Sheet. Notch Pathway Reporter Kit Catalog # 60509
Data Sheet Notch Pathway Reporter Kit Catalog # 60509 6042 Cornerstone Court W, Ste B Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. NOTCH signaling
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
SUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
Supplementary Information
Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected
supplementary information
DOI: 10.1038/ncb2153 Figure S1 Ectopic expression of HAUSP up-regulates REST protein. (a) Immunoblotting showed that ectopic expression of HAUSP increased REST protein levels in ENStemA NPCs. (b) Immunofluorescent
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya