# of Normal brain # of controls Upregulated Downregulated Normalizer # of mirnas in Platform profile
|
|
|
- Briana Atkins
- 6 years ago
- Views:
Transcription
1 Profiling studies comparing mirna expression in glioblastoma or glioblastoma cell lines to normal brain. MiRNAs were only included if fold change was greater than or equal to twofold Author Year Type of study Tissue type Tissue # of Normal brain # of controls Upregulated Downregulated Normalizer # of mirnas in Platform Accession preparation glioblastoma profile number Chan et al 2005 Oligonucleotide Patitent Fresh frozen 5 Nonneoplastic fetal 3 mir-21 mir-202 U6 180 Oligonucleotide array prepared array brain at own lab Northern blot Short term NA 4 Nonneoplastic adult 2 mir-138 cultures cortex Commercial NA 6 Nonneoplastic adult 2 mir-347 cell lines white matter mir-135 mir Ciafre et al 2005 Profiling Patient Fresh frozen 9 Normal adjacent (9) mir-10b mir-128a U6 245 MiRNA microarray chip (KCC/TJU version 1.0) mir-130a mir-181c mir-221 mir-181a mir-125b-1 mir-181b mir-125b-2 mir-9-2 mir-21 mir-25 mir Profiling Cell lines NA 10 Commercial RNA (Clontech) 1 mir-221 mir-125b-1 U6 245 MiRNA microarray chip (KCC/TJU version 1.0) Adult brain 1 mir-23a mir-197 Fetal brain 2 mir-23b mir-181b mir-222-prec mir-181a mir-125b-2 mir-181c Gaur et al* 2007 Profiling Cell lines (NCI- Frozen NA Human total RNA 60 panel) (Ambion) NA mir-10a mir-124b 18s rrna 241 TaqMan (Applied Biosystems) mir-196a mir-124a B2M mir-196b mir-7n GAPDH mir-10b mir-153 B-actin mir-21 mir-7 mir-219 mir-383 mir-129 mir-128b mir-323 mir-128a mir-346 mir-330 mir-340 mir-34an mir-137 mir-138 mir-321
2 Silber et al 2008 Profiling Patient Fresh frozen 4 Non-neoplastic brain (gliosisepilepsy) mir-187 mir-338 mir-34a mir-203 mir-328 mir-425 mir-135a mir-154* mir-370 mir-98 mir-382 mir-107 mir-361 let-7g mir-134 mir-331 mir-17-3p mir-181c mir-30c mir-212 let-7d mir-103 mir-213 mir-148b mir-194 mir-26b mir-181a mir-192 mir-191 mir-324-3p mir-324-5p let-7in mir-30bn mir-32 mir-30b mir-30d mir-181b mir-345 mir-197 mir-20n 4 mir-155 mir-128a let-7a 192 TaqMan mirna assays panel early access kit (Applied Biosystems) mir-21 mir-330 mir-16 mir-210 mir-133a mir-323 mir-133b mir-153 mir-328 mir
3 mir-154* mir-29b mir-185 mir-101 Godlewski et al** 2008 Profiling Patient NA NA Normal adjacent NA mir-21 mir-124 NA 248 Oligonucleotide array prepared at own lab mir-486 mir-137 mir-519d mir-323 mir p mir-139 mir-10b mir-218 mir-26a mir mir-383 mir-483 mir-451 mir mir-299 mir mir-190 Lukiw et al 2009 Profiling Patient Fresh (within 4 hours after biopsy) or archived (formalin?). Some samples pooled 8 Nonneoplastic post mortem brain (fetal, adult and Alzheimer) NA mir-221 NA 411 MiRNA array panels (LC Sciences, Houston, TX) Sasayama et 2009 Profiling Patient Fresh frozen 3 Normal adjacent (3) mir-10b mir-302c* RNU6B Genopal-MICH07 DNA chips or Genopal-MICH DNA chips (Mitsubishi Rayon, Tokyo, Japan) mir-21 mir-379 mir-183 mir-329 mir-92b mir-134 mir-369-3p Lavon et al 2010 Profiling Patient Fresh frozen 2 Human total RNA (Ambion) NA mir-17-5p mir-137 RNU6B 180 TaqMan mirna assays panel early access kit (Applied Biosystems) mir-208 mir-128b mir-372 mir-153 mir-206 mir-218 mir-10b mir-128a mir-321 mir-132 mir-371 mir-95 mir-205 mir-33 mir-302b* mir-190 mir-183 mir-139 mir-147 mir-133a mir-10a mir-129 mir-182* mir-124a mir-182 mir-335 mir-210 mir-217 mir-133b mir-302a mir
4 mir-325 mir-141 mir-216 mir-155 mir-93 mir-367 mir-320 mir-200b mir-220 mir-96 mir-302d mir-200c mir-22 mir-130b mir-302c* mir-302b mir-198 mir-138 mir-200a mir-373 mir-122a mir-25 mir-302c mir-144 mir-188 mir-21 mir-92 mir-296 mir-185 mir-373* mir-146 mir-148a mir-368 mir-193 mir-345 mir-17-3p mir-152 mir-211 mir-9* mir-130an mir-125b mir-224 mir-184 mir-214 mir-100 mir-186 mir-106b mir-328 mir-340 mir-299 mir-154* mir-369 mir-26b mir-107 mir-370 mir-29b let-7d let-7e mir-9 mir-32 mir-140 mir-125a mir-7n mir-143 mir-126 mir-222 mir-30e mir-103 let-7a mir-342 mir-221 mir-98 mir-331 mir-330 mir-145 mir-26a mir-154 let-7g mir-29a mir-374 mir-199s mir-136 Lages et 2011 Profiling Patient Fresh frozen 12 NA 4 let-7f mir-139-5p Ratio of 282 Oligonucleotide array prepared average amount of each mirna at own lab mir-210 mir-7
5 mir-155 mir-21 mir-16 mir-15b let-7a mir-134 mir-9 mir-124 mir-330-3p mir-128 mir-132 Studies using selected assays comparing mirna expression in glioblastoma or glioblastoma cell lines to normal brain. MiRNAs were only included if fold change was greater than or equal to twofold Kefas et al 2008 Specific assay Patient NA 5 Normal adjacent 5 mir-7 18S rrna TaqMan (Applied Biosystems) Shi et al 2008 Specific assay Patient Fresh frozen 3 Traumatic brain injury Conti et al 2009 Specific assay Patient Fresh frozen 10 Nonneoplastic brain 2 mir-181a RNU6B TaqMan (Applied Biosystems) mir-181b 4 mir-21 mir-181b U6 TaqMan (Applied Biosystems) mir-221 Li et al 2009 Specific assay Patient NA 11 NA 6 mir-34a 18S rrna TaqMan (Applied Biosystems) Sasayama et 2009 Specific assay Cell lines NA 6 Nonneoplastic brain Patient Fresh frozen 17 Nonneoplastic brain 5 mir-10b RNU6B TaqMan (Applied Biosystems) mir-10b RNU6B Fowler et al 2010 Specific assay Cell lines NA 5 Commercial RNA 4 mir-124a RNU48 TaqMan (Applied Biosystems) (Ambion) Patient FFPE 119 Normal adjacent 3 Post-mortem 1 Guan et al 2010 Specific assay Patient Fresh frozen 74 Ambion 1 mir-196b RNU48 TaqMan (Applied Biosystems) FirstChoice Human Brain Epileptic 1 mir-196a RNU44 Nonneoplastic autopsy brain 1 mir-21 mir-15b Rao et al 2010 Specific assay Patient RNA later, then flash frozen 51 Epileptic brain 7 mir-21 mir-219 TaqMan (Applied Biosystems) mir-23a mir-16 mir-155 mir-25 mir-93 mir-106b mir-218
6 Zhi et al 2010 Specific assay Patient Fresh frozen 124 Normal adjacent 60 mir-21 mir-124 mir-16 TaqMan (Applied Biosystems) mir-24 Gaur et al 2011 Specific assay Cell lines NA 4 NA NA mir-21 18S rrna TaqMan (Applied Biosystems) Patient NA NA B2M GAPDH B-actin Lages et 2011 Specific assay Patient Fresh frozen 12 NA 4 mir-21 mir-124 RNU24 TaqMan (Applied Biosystems) mir-155 let-7f let-7a mir-17 mir-16 mir-26b mir-374a mir-126 let-7d mir-20a mir-15b let-7b mir-210 mir-9 mir-127-3p mir-339-5p mir-139-5p mir-330-3p mir-7 mir-128 mir-134 mir-132 mir-409-5p Lakomy et al 2011 Specific assay Patient FFPE 38 Commercial RNA 4 mir-21 mir-128a RNU6B TaqMan (Applied Biosystems) Areas surrounding ateriovenous malformations 6 mir-196a mir-181c mir-196b mir-195 mir-221 mir-222 Li et al 2011 Specific assay Patient NA 10 NA 10 mir-34a U6 Promega Li et al 2011 Specific assay Patient Fresh frozen 15 Internal decompression surgery following brain trauma 6 mir-107 U6 miscript primer assays (Qiagen) mir-124 mir Chen et al 2012 Specific assay Patient FFPE 60 Traumatic brain injury Lang et al 2012 Specific assay Patient NA 9 Nonneoplastic brain 5 mir-137 U6 TaqMan (Applied Biosystems) mir-10b mir-124 U18 TaqMan (Applied Biosystems) mir-10a mir-874
7 Wang et al 2012 Specific assay Patient Fresh frozen 10 Traumatic brain injury 10 mir-181d NA TaqMan (Applied Biosystems) Wang et al 2012 Specific assay Cell lines NA 3 mir-483-5p U6 TaqMan (Applied Biosystems) Patient Fresh frozen 3 Normal adjacent 3 mir-7 * reported upregulation is above 17.7 fold and reported downregulation is below 2.5 fold ** all mirna alterations are above 4 fold *** study reported both profiling and selected assay data Abbreviations: NA, info not available; NCI, National Cancer Institute; FFPE, formalin-fixed and paraffin-embedded Relevant studies were identified using the PubMed database and the following search terms ("micrornas"[mesh Terms] OR "micrornas"[all Fields] OR "mirna"[all Fields]) AND (("glioblastoma"[mesh Terms] OR "glioblastoma"[all Fields]) OR ("astrocytoma"[mesh Terms] OR "astrocytoma"[all Fields]) OR ("glioma"[mesh Terms] OR "glioma"[all Fields]) OR ("brain tumour"[all Fields] OR "brain neoplasms"[mesh Terms] OR ("brain"[all Fields] AND "neoplasms"[all Fields]) OR "brain neoplasms"[all Fields] OR ("brain"[all Fields] AND "tumor"[all Fields]) OR "brain tumor"[all Fields])) AND ((normal[all Fields] AND ("brain"[mesh Terms] OR "brain"[all Fields])) OR nonneoplastic[all Fields] OR deregulation[all Fields] OR (altered[all Fields] AND ("gene expression"[mesh Terms] OR ("gene"[all Fields] AND "expression"[all Fields]) OR "gene expression"[all Fields] OR "expression"[all Fields])) OR over-expression[all Fields] OR under-expression[all Fields] OR ("up-regulation"[mesh Terms] OR "upregulation"[all Fields] OR ("up"[all Fields] AND "regulation"[all Fields]) OR "up regulation"[all Fields] OR "transcriptional activation"[mesh Terms] OR ("transcriptional"[all Fields] AND "activation"[all Fields]) OR "transcriptional activation"[all Fields] OR ("up"[all Fields] AND "regulation"[all Fields])) OR ("downregulation"[mesh Terms] OR "down-regulation"[all Fields] OR ("down"[all Fields] AND "regulation"[all Fields]) OR "down regulation"[all Fields]) OR ("prognosis"[mesh Terms] OR "prognosis"[all Fields]) OR prediction[all Fields] OR microarray[all Fields] OR profiling[all Fields] OR profile[all Fields] OR (("genome"[mesh Terms] OR "genome"[all Fields]) AND wide[all Fields]) OR ("cluster analysis"[mesh Terms] OR ("cluster"[all Fields] AND "analysis"[all Fields]) OR "cluster analysis"[all Fields])) NOT Review[Publication Type] AND ("humans"[mesh Terms] AND English[lang] AND medline[sb])
A novel and universal method for microrna RT-qPCR data normalization
A novel and universal method for microrna RT-qPCR data normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle 4 th International qpcr Symposium Weihenstephan, March 1,
Patnaik SK, et al. MicroRNAs to accurately histotype NSCLC biopsies
Patnaik SK, et al. MicroRNAs to accurately histotype NSCLC biopsies. 2014. Supplemental Digital Content 1. Appendix 1. External data-sets used for associating microrna expression with lung squamous cell
mirna Whole Transcriptome Assay
mirna Whole Transcriptome Assay HTG EdgeSeq mirna Whole Transciptome Assay The HTG EdgeSeq mirna Whole Transcriptome Assay (WTA) is a next generation sequencing (NGS) application that measures the expression
Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note
Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer Application Note Odile Sismeiro, Jean-Yves Coppée, Christophe Antoniewski, and Hélène Thomassin
Comparison of the mirna profiles in HPV-positive and HPV-negative tonsillar tumors and a model system of human keratinocyte clones
Vojtechova et al. BMC Cancer (2016) 16:382 DOI 10.1186/s12885-016-2430-y RESEARCH ARTICLE Open Access Comparison of the mirna profiles in HPV-positive and HPV-negative tonsillar tumors and a model system
Simple, rapid, and reliable RNA sequencing
Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the
microrna Presented for: Presented by: Date:
microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions
Paternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale
Paternal exposure and effects on microrna and mrna expression in developing embryo Department of Chemical and Radiation Nur Duale Our research question Can paternal preconceptional exposure to environmental
developing new tools for diagnostics Join forces with IMGM Laboratories to make your mirna project a success
micrornas developing new tools for diagnostics Join forces with IMGM Laboratories to make your mirna project a success Dr. Carola Wagner IMGM Laboratories GmbH Martinsried, Germany qpcr 2009 Symposium
Circulating Microrna Expression As A Biomarker For Early Diagnosis Of Severity In Spinal Cord Injury
Circulating Microrna Expression As A Biomarker For Early Diagnosis Of Severity In Spinal Cord Injury Susumu Hachisuka 1, Naosuke Kamei, MD, PhD 2, Satoshi Ujigo 3, Shigeru Miyaki 3, Mitsuo Ochi 3. 1 Hiroshima
Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
From reference genes to global mean normalization
From reference genes to global mean normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle qpcr Symposium USA November 9, 2009 Millbrae, CA outline what is normalization
Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
ExpressArt FFPE Clear RNAready kit
Features and Example Results General problems with FFPE samples Formalin-fixation of tissues results in severe RNA fragmentation, as well as in RNA RNA, RNA-DNA and RNA protein cross-linking, which impairs
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Synthetic microrna Reference Standards Genomics Research Group ABRF 2015
Synthetic microrna Reference Standards Genomics Research Group ABRF 2015 Don A. Baldwin, Ph.D. support@signalbiology.com Reference samples for Platform evaluation Protocol development Assay service improvement
Non-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing
Non-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing April 11, 2014 By Tony Fong Non-profit diagnostics outfit Paradigm last month joined a growing list of entrants in the clinical
Supplementary materials and methods.
Supplementary materials and methods. Microarray printing and data analysis. The LNA-modified oligonucleotide probe set for all annotated mirnas from mouse (Mus musculus) and human (Homo sapiens) in the
MicroRNAs and cardiac sarcoplasmic reticulum calcium ATPase-2 in human myocardial infarction: expression and bioinformatic analysis
Boštjančič et al. BMC Genomics 2012, 13:552 RESEARCH ARTICLE Open Access MicroRNAs and cardiac sarcoplasmic reticulum calcium ATPase-2 in human myocardial infarction: expression and bioinformatic analysis
Extracellular Vesicle RNA isolation Kits
Extracellular Vesicle RNA isolation Kits Summary Section 4 Introduction 42 Exo-TotalRNA and TumorExo-TotalRNA isolation kits 43 Extracellular Vesicle RNA extraction kits Ordering information Products can
Benchmark study: Exiqon mircury LNA microrna arrays vs. Supplier A s DNA based capture probes. Includes comparison of:
Benchmark study: Exiqon mircury LNA microrna arrays vs. Supplier A s DNA based capture probes Includes comparison of: I. II. III. Signal levels Relative quantification False differences For complete experimental
Joseph Kim, Na Eun Choi, Su Jin Oh, Sang Jae Park and Hark Kyun Kim National Cancer Center, Goyang, Republic of Korea INTRODUCTION
Pathology International 2011; 61: 67 72 doi:10.1111/j.1440-1827.2010.02615.x Original Article Combined expression of mir-122a, mir-1, and mir-200b can differentiate degraded RNA samples from liver, pancreas,
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
CONTRACTING ORGANIZATION: Johns Hopkins University, Baltimore, MD
AD Award Number: W81XWH-12-1-0480 TITLE: Molecular Characterization of Indolent Prostate Cancer PRINCIPAL INVESTIGATOR: Jun Luo, Ph.D. CONTRACTING ORGANIZATION: Johns Hopkins University, Baltimore, MD
Review Article MicroRNAs in Human Malignant Gliomas
Oncology Volume 2012, Article ID 732874, 7 pages doi:10.1155/2012/732874 Review Article MicroRNAs in Human Malignant Gliomas Masahiro Mizoguchi, Yanlei Guan, Koji Yoshimoto, Nobuhiro Hata, Toshiyuki Amano,
QIAGEN's Growing Immuno-Oncology Testing Portfolio
QIAGEN's Growing Immuno-Oncology Testing Portfolio QIAGEN Your Partner in Translational Medicine Current Biomarkers of Immuno-Oncology Focus: Immuno-Oncology Testing Portfolio Tumor mutation burden (TMB)
RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
Xu et al. Molecular Cancer (2019) 18:8 https://doi.org/10.1186/s12943-018-0932-8 LETTER TO THE EDITOR RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
Duskova et al. BMC Infectious Diseases 2013, 13:250
Duskova et al. BMC Infectious Diseases 2013, 13:250 RESEARCH ARTICLE Open Access MicroRNA regulation and its effects on cellular transcriptome in Human Immunodeficiency Virus-1 (HIV-1) infected individuals
ARTICLE IN PRESS. Critical Reviews in Oncology/Hematology xxx (2010) xxx xxx
Critical Reviews in Oncology/Hematology xxx (2010) xxx xxx Circulating micrornas: Association with disease and potential use as biomarkers Glen Reid, Michaela B. Kirschner, Nico van Zandwijk Asbestos Diseases
Microarray profiling of gene expression after sleep deprivation and recovery sleep 03/05/2008
Microarray profiling of gene expression after sleep deprivation and recovery sleep 03/05/2008 1. OVERVIEW...1 2. BEHAVIORAL CONDITIONS...1 3. LASER MICRODISSECTION/MICROARRAY...2 3.1. REGIONS OF INTEREST...
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer.
AWARD NUMBER: W81XWH-14-1-0080 TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer. PRINCIPAL INVESTIGATOR: Christopher B. Umbricht, MD, PhD CONTRACTING ORGANIZATION: Johns
Identification of mirna expression profiles for diagnosis and prognosis of prostate cancer
Identification of mirna expression profiles for diagnosis and prognosis of prostate cancer To my grandfather Curt "Cula" Carlsson "Research is to see what everybody else has seen, and to think what nobody
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Micro RNA Research. Ken Kosik. Harriman Professor, Department of Molecular, Cellular & Developmental Biology and Biomolecular Sciences & Engr.
Ken Kosik Harriman Professor, Department of Molecular, Cellular & Developmental Biology and Biomolecular Sciences & Engr. Program Co-Director, Neurosciences Research Institute Micro RNA Research Neuroscience
Cell lines and tissue samples. The 18 human NSCLC cell lines used in this. study included eight adenocarcinoma cell lines (ADCs; A427, A549, LC319,
Supplementary Materials and Methods Cell lines and tissue samples. The 18 human NSCLC cell lines used in this study included eight adenocarcinoma cell lines (ADCs; A427, A549, LC319, NCI-H1373, PC-3, PC-9,
Corporate Medical Policy
Corporate Medical Policy Microarray-based Gene Expression Testing for Cancers of Unknown File Name: Origination: Last CAP Review: Next CAP Review: Last Review: microarray-based_gene_expression_testing_for_cancers_of_unknown_primary
Massachusetts General Hospital Boston, MA Approved for Public Release; Distribution Unlimited
AD Award Number: DAMDl7-01-1-0716 TITLE: Growth Mechanisms of Schwann Cell Tumors in NF2 PRINCIPAL INVESTIGATOR: Anat 0. Stemmer-Rachamimov, M.D. CONTRACTING ORGANIZATION: Massachusetts General Hospital
Supplementary webappendix
Supplementary webappendix This webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kratz JR, He J, Van Den Eeden SK, et
W J C O. World Journal of Clinical Oncology. MicroRNAs as lung cancer biomarkers. Abstract INTRODUCTION TOPIC HIGHLIGHT
W J C O World Journal of Clinical Oncology Submit a Manuscript: http://www.wjgnet.com/esps/ Help Desk: http://www.wjgnet.com/esps/helpdesk.aspx DOI: 10.5306/wjco.v5.i4.604 World J Clin Oncol 2014 October
CONTRACTING ORGANIZATION: Baylor College of Medicine Houston, TX 77030
AD Award Number: W81XWH-05-1-0428 TITLE: MicroRNA and Breast Cancer Progression PRINCIPAL INVESTIGATOR: Konstantin Galaktionov, Ph.D. CONTRACTING ORGANIZATION: Baylor College of Medicine Houston, TX 77030
XTRAKT FFPE Kit / Manual
XTRAKT FFPE Kit / Manual For manual extraction of RNA, mirna and/or DNA from Formalin Fixed Paraffin Embedded (FFPE) tissue samples Catalog No. # XTK2.0-96 For research use only. Not intended for diagnostic
Assaying micrornas in biofluids for detection of drug induced cardiac injury. HESI Annual Meeting State of the Science Session June 8, 2011
Assaying micrornas in biofluids for detection of drug induced cardiac injury HESI Annual Meeting State of the Science Session June 8, 2011 Karol Thompson, PhD Center for Drug Evaluation & Research US Food
Circulating microrna-137 is a potential biomarker for human glioblastoma
European Review for Medical and Pharmacological Sciences Circulating microrna-137 is a potential biomarker for human glioblastoma H.-Y. LI, Y.-M. LI, Y. LI, X.-W. SHI, H. CHEN 2016; 20: 3599-3604 Department
micrornas (mirna) and Biomarkers
micrornas (mirna) and Biomarkers Small RNAs Make Big Splash mirnas & Genome Function Biomarkers in Cancer Future Prospects Javed Khan M.D. National Cancer Institute EORTC-NCI-ASCO November 2007 The Human
MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer
European Review for Medical and Pharmacological Sciences 2017; 21: 4278-4282 Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer Q.-H. ZHOU 1, Y.-M. ZHAO 2, L.-L.
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
Chapter 18. mirna Expression Profiling: From Reference Genes to Global Mean Normalization
Chapter 18 mirna Expression Profiling: From Reference Genes to Global Mean Normalization Barbara D haene, Pieter Mestdagh, Jan Hellemans, and Jo Vandesompele Abstract MicroRNAs (mirnas) are an important
A two-microrna signature in urinary exosomes for diagnosis of prostate cancer
Poster # B4 A two-microrna signature in urinary exosomes for diagnosis of prostate cancer Anne Karin Ildor Rasmussen 1, Peter Mouritzen 1, Karina Dalsgaard Sørensen 3, Thorarinn Blondal 1, Jörg Krummheuer
SC-L-H shared(37) Specific (1)
A. Brain (total 2) Tissue-specific (2) Brain-heart shared (8) Specific (2) CNS-heart shared(68) Specific () Heart (total 4) Tissue-specific () B-L-H shared (37) specific () B. Brain (total 2) Tissue-specific
HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.
HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh
Inhibition of Autophagy by MiR-30A Induced by Mycobacteria tuberculosis as a Possible Mechanism of Immune Escape in Human Macrophages
Jpn. J. Infect. Dis., 68, 420 424, 2015 Short Communication Inhibition of Autophagy by MiR-30A Induced by Mycobacteria tuberculosis as a Possible Mechanism of Immune Escape in Human Macrophages Zhi Chen
medoct group, Medical University Vienna, Jack Ballantyne, PhD National Center for Forensic Science, Orlando, FL USA
medoct group, Medical University Vienna, Jack Ballantyne, PhD National Center for Forensic Science, Orlando, FL USA Association of Forensic DNA Analysts and Administrators San Antonio, TX June 2012 Perceived
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2011 Formula Grant
National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2011 Formula Grant Reporting Period July 1, 2012 June 30, 2013 Formula Grant Overview The NSABP Foundation
Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast cancer cells
Int J Clin Exp Pathol 2017;10(5):5039-5062 www.ijcep.com /ISSN:1936-2625/IJCEP0052419 Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated
Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,
genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
MicroRNA-146a Ameliorates Inflammation via TRAF6/NF-kB Pathway in Intervertebral Disc Cells
e-issn 1643-375 DOI: 1.12659/MSM.89866 Received: 216.3.22 Accepted: 216.6.22 Published: 217.2.5 MicroRNA-146a Ameliorates Inflammation via TRAF6/NF-kB Pathway in Intervertebral Disc Cells Authors Contribution:
Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples
DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples LIBRARY
Title page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in
Title page Title: MicroRNA- Controls Synthesis and Promotes Gemcitabine Resistance in Pancreatic Ductal Adenocarcinoma Authors Manabu Mikamori, Daisaku Yamada, Hidetoshi Eguchi, Shinichiro Hasegawa, Tomoya
mir-218 tissue expression level is associated with aggressive progression of gastric cancer
mir-218 tissue expression level is associated with aggressive progression of gastric cancer X.X. Wang 1, S.J. Ge 2, X.L. Wang 2, L.X. Jiang 1, M.F. Sheng 2 and J.J. Ma 2 1 Department of General Surgery,
STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells
CAMDA 2009 October 5, 2009 STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells Guohua Wang 1, Yadong Wang 1, Denan Zhang 1, Mingxiang Teng 1,2, Lang Li 2, and Yunlong Liu 2 Harbin
microrna analysis for the detection of autologous blood transfusion in doping control
microrna analysis for the detection of autologous blood transfusion in doping control Application note Doping Control Authors Francesco Donati*, Fiorella Boccia, Xavier de la Torre, Alessandra Stampella,
SUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
Cancer Validation in the 100,000 genomes project. Dr Shirley Henderson ACGS spring meeting 06/07/16
Cancer Validation in the 100,000 genomes project Dr Shirley Henderson ACGS spring meeting 06/07/16 Cancer is a lesion of the Genome Diagnosis Cancer Molecular Lesions Prognosis Disease Monitoring Why is
Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus
Supplementary Material
Supplementary Material Identification of mir-187 and mir-182 as biomarkers for early diagnosis and prognosis in prostate cancer patients treated with radical prostatectomy Irene Casanova-Salas 1, José
Clinical Utility of Diagnostic Tests
Clinical Utility of Diagnostic Tests David A. Eberhard MD, PhD Director, Pre-Clinical Genomic Pathology, Lineberger Comprehensive Cancer Center Associate Professor, Depts. of Pathology and Pharmacology
Supplementary webappendix
Supplementary webappendix This webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Ueda T, Volinia S, Okumura H, et al.
microrna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
Santosh Patnaik, MD, PhD! Assistant Member! Department of Thoracic Surgery! Roswell Park Cancer Institute!
Santosh Patnaik, MD, PhD Assistant Member Department of Thoracic Surgery Roswell Park Cancer Institute MicroRNA biology, techniques and applications History Biogenesis Nomenclature Tissue specificity Mechanisms
Supplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-10-1-1029 TITLE: PRINCIPAL INVESTIGATOR: Mu-Shui Dai, M.D., Ph.D. CONTRACTING ORGANIZATION: Oregon Health Science niversity, Portland, Oregon 97239 REPORT DATE: October 2013 TYPE
Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
APPLICATION NOTE. Highly reproducible and Comprehensive Proteome Profiling of Formalin-Fixed Paraffin-Embedded (FFPE) Tissues Slices
APPLICATION NOTE Highly reproducible and Comprehensive Proteome Profiling of Formalin-Fixed Paraffin-Embedded (FFPE) Tissues Slices INTRODUCTION Preservation of tissue biopsies is a critical step to This
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
Characterization of MicroRNA Expression Levels and Their Biological Correlates in Human Cancer Cell Lines
Research Article Characterization of MicroRNA Expression Levels and Their Biological Correlates in Human Cancer Cell Lines Arti Gaur, 1 David A. Jewell, 2 Yu Liang, 3 Dana Ridzon, 3 Jason H. Moore, 1,2
Non-Invasive Array Based Screening for Cancer. Dr. Amit Kumar President and CEO CombiMatrix Corporation
Non-Invasive Array Based Screening for Cancer Dr. Amit Kumar President and CEO CombiMatrix Corporation www.combimatrix.com May 13, 2009 This presentation contains forward-looking statements within the
MicroRNAs (mirnas) are a class of endogenous, small,
Flank Sequences of mir-145/143 and Their Aberrant Expression in Vascular Disease: Mechanism and Therapeutic Application Xiaojun Liu, PhD;* Yunhui Cheng, MD, PhD;* Jian Yang, MD; Shanshan Qin, MD; Xiuwei
SUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer
1 SUPPLEMENTAL FILE 2 3 mir-22 and mir-29a are members of the androgen receptor cistrome modulating LAMC1 and Mcl-1 in prostate cancer 4 5 6 Lorenza Pasqualini 1, Huajie Bu 1,2, Martin Puhr 1, Narisu Narisu
TITLE: High throughput sequencing of germline and tumor from men with early-onset, metastatic prostate cancer
AWARD NUMBER: W81XWH-13-1-0371 TITLE: High throughput sequencing of germline and tumor from men with early-onset, metastatic prostate cancer PRINCIPAL INVESTIGATOR: A. Cooney, M.D. CONTRACTING ORGANIZATION:
Figure S1: Heat map based on the relative expression of genes and mirnas in human
Figure S1: Heat map based on the relative expression of genes and mirnas in human prostate tissue. Columns represent genes and mirnas; rows represent prostate tissue samples (red squares: Tu samples, green
Lung cancer is by far the leading cause of cancer-related
ORIGINAL ARTICLE MicroRNA 92a-2* A Biomarker Predictive for Chemoresistance and Prognostic for Survival in Patients with Small Cell Lung Cancer Aarati R. Ranade, PhD,* David Cherba, PhD, Shravan Sridhar,*
Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
MicroRNA Signatures as Biomarkers and Therapeutic Target for CNS Embryonal Tumors: The Pros and the Cons
Int. J. Mol. Sci. 2014, 15, 21554-21586; doi:10.3390/ijms151121554 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms MicroRNA Signatures as Biomarkers
Validation of Housekeeping Genes for Gene Expression Analysis in Glioblastoma Using Quantitative Real-Time Polymerase Chain Reaction
ORIGINAL ARTICLE Brain Tumor Res Treat 2015;3(1):24-29 / pissn 2288-2405 / eissn 2288-2413 http://dx.doi.org/10.14791/btrt.2015.3.1.24 Validation of Housekeeping Genes for Gene Expression Analysis in Glioblastoma
CHAPTER 2. Cancer Res Nov 15; 65(22):
RELIABLE HIGH-THROUPHGPUT GENOTYPING AND LOSS OF HETEROZYGOSITY DETECTION IN FORMALIN- FIXED, PARAFFIN-EMBEDDED TUMORS USING SINGLE NUCLEOTIDE POLYMORPHISM ARRAYS CHAPTER 2 Reliable high-throughput genotyping
Figure S1. Analysis of endo-sirna targets in different microarray datasets. The
Supplemental Figures: Figure S1. Analysis of endo-sirna targets in different microarray datasets. The percentage of each array dataset that were predicted endo-sirna targets according to the Ambros dataset