Title page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in

Transcription

1 Title page Title: MicroRNA- Controls Synthesis and Promotes Gemcitabine Resistance in Pancreatic Ductal Adenocarcinoma Authors Manabu Mikamori, Daisaku Yamada, Hidetoshi Eguchi, Shinichiro Hasegawa, Tomoya Kishimoto, Yoshito Tomimaru, Tadafumi Asaoka, Takehiro Noda, Hiroshi Wada, Koichi Kawamoto, Kunihito Gotoh, Yutaka Takeda,, Masahiro Tanemura,, Masaki Mori, Yuichiro Doki, Affiliation. Department of Gastroenterological Surgery, Graduate School of Medicine, Osaka University, Yamadaoka -, Suita, Osaka, Japan, Department of Surgery, Kansai Rosai Hospital, Inabasou --69, Amagasaki, Hyogo, Japan, Department of Surgery, Osaka Police Hospital, Tennoji-ku Kitayamacho -, Osaka, Japan, - Corresponding Author: Hidetoshi Eguchi MD, PhD Address: - Yamadaoka, Suita, Osaka, Japan, 6-87 Tel: , Fax: heguchi@gesurg.med.osaka-u.ac.jp

2 Supplementary Figure A Fold-change vs. baseline 7 6 Pt GR 8hr GR GR 8hrs Culture time (hrs) Pt GR 7hr GR GR 7hrs B Apoptosis ratio (%) PT -GR -GR -GR GEM Pt GR GR GR Supplementary Figure. (A) Cellular viability after cell seeding is expressed as the fold-change relative to baseline and was calculated using the MTT assay in parental (-Pt) cells and in GEM-resistant cells (-GR). (B) Alterations in apoptosis in -Pt and -GRs cells after treatment with GEM for 7 hours. The ratio of apoptotic cells was determined using the Annexin V assay. Columns in A and B show values that are the average of triplicate measurements; bars show SD values. Data are representative of three experiments., P<..

3 Supplementary Figure A Normalized mir- level (mir-/rnu6b) Mean value High Low Case number B Overall survival ratio Low expression (n=6) High expression (n=7) P=. Disease-free survival ratio Low expression (n=6) High expression (n=7) P= Analysis time (years) # # Low expr. 7 - High expr. 6 8 Analysis time (years) Low expr. 7 - High expr. Supplementary Figure. (A) Laser capture microdissection (LCM) was performed to collect material from tissue resected from patients. Real-time qrt-pcr was used to assess the mir- expression level in each sample. The relative mirna expression was quantified using the comparative CT method (-ΔCT). The mean value of the mir- expression level in these samples was used as a cut-off value to divide the patients into two groups (high or low mir- expression). (B) Kaplan-Meier plots of overall survival (left) and disease-free survival (right) of patients according to the expression of mir- in their plasma exosomes (P value, log-rank test).

4 Supplementary Figure A MiaPaCa PSN Normalized mir- level (mir-/rnu8) 7 6 NC mir- NC mir- NC mir- Normalized mir- level (mir-/rnu8) 8 6 NC mir- NC mir- NC mir- Normalized mir- level (mir-/rnu8) 6 NC mir- NC mir- NC mir- day day day day day day day day day hr 8hrs 7hrs hr 8hrs 7hrs hr 8hrs 7hrs B mir level, fold-change relative to control mir- MiaPaCa PSN GR GR GR GR GR GR C Fold-change vs. baseline hrs 7hrs 8hrs 7hrs 8hrs 7hrs MiaPaCa PSN Supplementary Figure. (A) The expression of mir- in PDAC cells transfected with pre-mir- or negative control oligonucleotides (NC) was detected by qrt-pcr. Concentrations of transfected pre-mir-:, nm; MiaPaCa, nm; and PSN, nm. (B) qrt-pcr was used to detect the expression of mature mir- in each PDAC cell line and in -GR cells. (C) The viability of each PDAC cell line transfected with pre-mir- or NC after seeding, as calculated by the MTT assay; viability is expressed as the fold-change compared to baseline. Columns in A C show the averages of triplicate measurements; bars show SD values. Data are representative of three experiments., P<..

5 Supplementary Figure MiaPaCa PSN TPINP β-actin kda kda 7kDa kda kda GEM pre mir Supplementary Figure. Original images of immune blots on PVDF membrane. A membrane were cut to 6 parts at kda, and each part of membrane were separately treated from the procedure of incubation with primary antibody (TPINP: 7kDa, β-actin: kda). Modified image to show each band more clearly were depicted in figure E.

6 Supplementary Figure A GEM EC (ng/ml) Apoptosis ratio (%) 8 6 B GEM EC (ng/ml) MiaPaCa Exo(-) MiaPaCa exo Apoptosis ratio (%) MiaPaCa C D E mir level, fold-change relative to control mir- GR NC GR anti mir- transfection mir level, fold-change relative to control anti exo 添加 Pnac mir- antinc exo 添加 mrna level, fold-change relative to control... GEM TPINP Supplementary Figure. (A) The EC of GEM in Pnac-Pt cells that were treated with exosomes isolated from PDAC cells transfected with pre-mir- (-OE, MiaPaCa- OE) for 8 hours was assessed by the MTT assay (left). Apoptosis ratio was assessed in -Pt cells after GEM ( ng/ml) treatment with or without isolated exosomes for 7 hours. The ratio of apoptotic cells was determined using the Annexin V assay (right). (B) The EC of GEM in MiaPaCa-Pt cells that were treated with exosomes isolated from MiaPaCa-OE for 8 hours was assessed by the MTT assay (left). Apoptosis ratio was assessed in MiaPaCa-Pt cells after GEM ( ng/ml) treatment with or without isolated exosomes for 7 hours. The ratio of apoptotic cells was determined using the Annexin V assay (right). (C) The expression levels of mir- in cells transfected with anti-mir- ( nm) or with negative control oligonucleotides (NC) as determined by qrt-pcr. (D) qrt-pcr analysis shows the level of intracellular copies of mir- in recipient cells that were treated for 8 hours with exosomes that were isolated from cells transfected with anti-mir- (-KD). (E) TPINP expression in -Pt cells after GEM/PBS treatment with or without the addition of exosomes isolated from -NC or -OE for 7 hours. mrna expression was assessed using qrt-pcr. Columns in A E show values that are the average of triplicate measurements; bars show SD values. Data are representative of three experiments. NS, not significant., P<.;, P<..

7 Supplementary Figure 6 A CD6 (kda) C.... (μg/μl) Pt exosomal RNA B. concentration, 6 particles/ml size distribution Mean: 89±.8 nm Particle size (nm) Supplementary Figure 6 (A) Expression of CD6, an exosomal marker, in exosomes isolated from media supernatant. The lanes are arranged according to the amount of protein level. (B) The size distribution of exosomes secreted by cells as determined by the NanoSight LM system. (C) Total RNA isolated from the exosome fraction was detected using the Bioanalyzer. The data show the amount of total RNA and the size distribution of the isolated RNA. The columns in B show the averages of triplicate measurements; bars show SDs. Data are representative of three experiments.

8 Supplementary Table. Candidate mirnas that showed expression levels that were altered more than.-fold or less than.-fold in -GR cells relative to -Pt cells GR/Pt >.-fold GR/Pt <.-fold hsa-mir- 7. hsa-mir-6. hsa-mir-9b-.8 hsa-mir--p.8 hsa-mir-6-p.6 hsa-mir-66.7 hsa-mir-7-p.6 hsa-mir-.6 hsa-mir-9b-. hsa-mir-7. hsa-mir-. hsa-mir-.9 hsa-mir-.8 hsa-mir--p.7 hsa-mir-. hsa-mir-8d. hsa-mir-9a-p. hsa-mir-6.87 hsa-mir-b.8 hsa-mir-7-p.76 hsa-mir-68-p.76 hsa-mir-8.76 hsa-mir-7.66 hsa-mir hsa-mir-68.6 hsa-mir-88-p.6 hsa-mir-9.6 hsa-mir--p. hsa-mir-8.6 hsa-mir-7. hsa-mir--p. hsa-mir-8.7

9 Supplemental Table. The clinicopathological characteristics of the patients who underwent histologically curative resection without any preoperative treatment and received adjuvant chemotherapy or post recurrence chemotherapy preoperative therapy mir- (low expression) mir- (high expression) P-value n=7 n=8 Age (years) 7. ± ± Sex (male / female) / / 7.76 Histopathological type (well or moderate / poor) / 7 /.6 Tumor size (mm) 7.9 ±.8 9. ±..8 Tumor location (head / body or tail) / / 7.76 Pathological depth of invasion, pt (T / T / T) / / / / 8.6 Pathological lymph node metastasis, pn (negative / positive) 6 / /.7 Pathological stage (ІA / ІB / ІІA / ІІB) / / 9 / / / /.8 Abbreviations: poor, poorly differentiated; well, well differentiated

10 Supplementary Table. Univariate and multivariate analysis of predictive factors of overall survival in patients with pancreatic ductal adenocarcinoma Univariate Multivariate P-value Hazard ratio 9%CI P-value Age (years) ( 7 / <7: median) Sex (male / female).6 Histopathological type (well or moderate / poor).7 Tumor size (mm) ( mm / < mm: median). Tumor location (head / body or tail).69 Pathological depth of invasion pt (T or T / T). Pathological lymph node metastasis pn (negative / positive). Pathological stage (ІA or ІB / ІІA or ІІB) mir- expression (average) Abbreviations: poor, poorly differentiated; well, well differentiated

11 Supplementary Table. Primers used for qrt-pcr and antibodies used for immunoblotting and immunocytochemistry. Gene-specific primers Sequences ( to ) TPINP forward TPINP reverse RAB7B forward RAB7B reverse ACTB forward ACTB reverse GCACCCTTCAGTCTTTTCCTGTT GGAGAAAGCAGGAATCACTTGTA TGGATGAGCCAACTGCAAGC GCCGTTCATTGACTTCCCTCTCG TTAAGGAGAAGCTGTGCTACG GTTGAAGGTAGTTTCGTGGAT Antibody Source Dilution Purchased from Anti-CD6 (MX-9.9.) Anti-TPINP (H-) Anti-Rab7b (C-) Mouse monoclonal : Santa Cruz Biotechnology Rabbit polyclonal : Santa Cruz Biotechnology Goat polyclonal : Santa Cruz Biotechnology Anti-β-actin antibody Rabbit monoclonal : Sigma-Aldrich