Yu Cao 1, Yonghui Feng 2, Yanjun Zhang 3, Xiaotong Zhu 4 and Feng Jin 1*

Transcription

1 Co et l. BMC Cncer (216) 16:343 DOI /s RESEARCH ARTICLE Open Access inine supplementtion inhiits the growth of rest cncer y enhncing innte nd dptive immune responses medited y suppression of MDSCs in vivo Yu Co 1, Yonghui Feng 2, Ynjun Zhng 3, Xiotong Zhu 4 nd Feng Jin 1 Astrct Bckground: is involved in mny iologicl ctivities, including the ctivtion of T cells. In rest cncer ptients, is depleted y nitric oxide synthse 2 (NOS2) nd rginse 1 (ARG-1) produced y myeloid-derived suppressor cells (MDSCs). Our im ws to test whether supplementtion could enhnce ntitumor immune response nd improve survivorship in rodent model of mmmry tumor. Methods: Tumor volumes in control nd treted 4 T1 tumor ering (TB) BALB/c mice were mesured nd survivl rtes were recorded. The percentges of MDSCs, dendritic cells (DCs), regultory T cells (Tregs), mcrophges, CD4 + T cells, nd CD8 + T cells were exmined y flow cytometry. Additionlly, levels of IL-1, TNF-α, nd IFN-γ were mesured y enzyme-linked immunosorent ssy (ELISA) nd nitric oxide (NO) levels were mesured y the Griess rection. IFN-γ, T-et, Grnzyme B, ARG-1 nd inos mrna levels were exmined y rel-time RT-PCR. Results: tretment inhiited tumor growth nd prolonged the survivl time of 4 T1 TB mice. The frequency of MDSCs ws significntly suppressed in treted TB mice. In contrst, the numers nd function of mcrophges, CD4 + T cells, nd CD8 + T cells were significntly enhnced. The IFN-γ, TNF-α, NO levels in splenocytes superntnt, s well s inos, IFN-γ, Grnzyme B mrna levels in splenocytes nd tumor locks were significntly incresed. The ARG-1 mrna level in tumor locks, the frequency of Tregs, nd IL-1 level were not ffected. Conclusion: supplementtion significntly inhiited tumor growth nd prolonged the survivl time of 4 T1 TB mice, which ws ssocited with the reduction of MDSCs, nd enhnced innte nd dptive immune responses. Keywords: inine, Brest cncer, Tumor immunity, MDSCs Bckground Despite dvnces in multimodl therpies, rest cncer remins significnt prolem tht cuses deths in women worldwide. Although the incidence nd mortlity vry y geogrphicl region, the overll incidence of rest cncer is incresing [1]. Brest cncer is often ssocited with immune suppression in humns nd L- Correspondence: jinfeng66cn@hotmil.com 1 Deprtment of Surgicl Oncology nd Brest Surgery, The First Affilited Hospitl of Chin Medicl University, Shenyng, Lioning 111, Chin Full list of uthor informtion is ville t the end of the rticle rginine () depletion, n occurrence which cn e effectively modeled in tumor-ering (TB) mice. Therefore, it is necessry to identify new therpeutic trgets for the rest cncer, especilly for the regultion of immune responses. is n essentil mino cid for infnts nd young children ut conditionlly essentil mino cid for dults. It cn e metolized into nitric oxide (NO) nd L-citrulline y inducile nitric oxide synthse (inos) or into ure nd L-ornithine y ARG-1 [2]. NO modultes different cncer-relted events. However, severl lines of 216 The Author(s). Open Access This rticle is distriuted under the terms of the Cretive Commons Attriution 4. Interntionl License ( which permits unrestricted use, distriution, nd reproduction in ny medium, provided you give pproprite credit to the originl uthor(s) nd the source, provide link to the Cretive Commons license, nd indicte if chnges were mde. The Cretive Commons Pulic Domin Dediction wiver ( pplies to the dt mde ville in this rticle, unless otherwise stted.

2 Co et l. BMC Cncer (216) 16:343 Pge 2 of 11 reserch hve indicted tht NO my hve dul effects in cncer [3]. plys centrl role in severl iologic systems, including the ctivtion of T cell function [4]. depletion y myeloid-derived suppressor cells (MDSCs), which produce rginse 1 (ARG-1) nd NO synthse 2 (NOS2), is oserved in cncer ptients [2, 5 7]. This suset of myelomonocytic cells promotes tumor growth nd metstsis, which re highly efficient t suppressing ctivted T cells, leding to the impirment of generl nd tumor-specific dptive immune responses [2, 8]. Activted T cells cultured in medium without, or cocultured with ARG-1 producing MDSCs isolted from tumors, proliferte t decresed rte, express lower levels of the T cell receptor CD3 chin, nd produce reduced levels of cytokines [6, 9, 1]. Such impired T cell functions cn e reversed y the enterl or prenterl supplementtion of [11]. Considering tht (1) level is decresed in tumor ering ptients nd mice [12], (2) nti-tumor T cell immunity is usully suppressed, wheres MDSCs which medite tumor escpe re lwys enhnced in the tumor erers, nd (3) depletion y MDSCs leds to the depression of T cells [7, 13], we hypothesized tht supplementtion would inhiit tumor growth nd improve survivl. Murine models hve een estlished to study rest cncer focusing on the specific clinicl questions. In order to test this hypothesis, we supplemented the rest cncer-ering BALB/c mice with L- Arg nd monitored the host s nti-tumor immune responses. Results showed tht supplementtion with L- Arg prolonged survivl time of the host nd inhiited tumor growth. This effect is ssocited with enhnced innte nd dptive immune responses. The results suggest tht supplementtion my e vile preventtive nd/or djunctive tretment for the inhiition of rest cncer development. Methods Cell line nd tumor implnttion The 4 T1 mouse mmmry crcinom cell line lcks the expression of estrogen receptor (ER) nd metstsizes to other orgns in wy similr to wht is oserved in nturlly occurring rest cncer in humns [14], thus we selected 4 T1 mouse mmmry crcinom cell line to estlish the rest cncer model. 4 T1 cell line ws otined from the Cell Bnk of the Chinese Acdemy of Sciences (Shnghi, Chin). All niml experimentl protocols were pproved y the Animl Cre nd Use Committee of Chin Medicl University. Cells were cultured in RPMI 164 medium supplemented with 1 % fetl ovine serum (FBS) nd 1 % penicillin-streptomycin, t 37 C nd 5 % CO 2 in 95 % humidified incutor. ws purchsed from Sigm-Aldrich (St. Louis, MO, USA) nd diluted to 15 mg/ml with phosphte-uffered sline (), ph 7.. Femle, 6 8-week-old BABL/c mice were purchsed from Acdemi Sinic Shnghi Experimentl Animl Center (Shnghi, Chin). Mice were housed under controlled light nd temperture conditions nd rndomly ssigned to experimentl nd control groups of ten mice ech. 4 T1 mouse mmmry crcinom cells (1 1 5 ) were injected sucutneously into the shved flnks of mice. tretment ws then initited on dy 7 post-inocultion when the dimeter of the tumor ws plple. For the dose selection of used in the current study, we exmined three different doses (2.5 g/kg, 1.5 g/kg nd.5 g/kg) supplementtion on the tumor volume sed on pulished literture [15, 16], nd then 1.5 g/kg ws chosen to perform the following studies. Mice in the experimentl group were treted for 2 consecutive dys vi orl dministrtion of (1.5 g/kg), wheres the control group received equl mounts of once dy. To explore the role of NO, some mice were supplied with wter with 1 % minogunidine (AG), n NOS inhiitor. Tumor growth ws monitored every three dys y mesuring the tumor length (L) nd width (W) using clipers nd clculting the tumor size ccording to the following formul: Tumor volume (mm 3 )=1 2 long dimeter short dimeter squred. At the end of the tretment (dy 28 post inocultion), three nimls of ech group were euthnized with ether. Tumor mss, lymph nodes, nd spleens were removed for further nlysis. Flow cytometry Spleens nd lymph nodes from 4 T1 TB BALB/c mice were dissected nd homogenized to produce single cell suspension. After red lood cells were lysed, the cells were wshed with (3 g for 7 min) nd djusted to /ml with RPMI-164. Dendritic cells (DCs) were stined with FITC-nti-CD11c (clone HL3, BD Biosciences), PE-nti- CD11 (clone M1/7, BD Biosciences), PerCP-nti- CD45R B22 (clone RA3-6B2, BD Biosciences) nd APC- MHC II (clone M5/ , ebioscience). To ssess regultory T cells (Tregs), FITC-nti-CD4 (clone H129.19, BD Biosciences) nd PE-nti-CD25 ntiodies (clone PC61, BD Biosciences) were dded to spleen cells, nd resuspended in 1 μl of supplemented with 3 % FCS for surfce stining. Then, the cells were fixed nd permeilized, nd intrcytoplsmic stining ws performed using APC-nti-Foxp3 (clone FJK16s, ebioscience) ntiody. For ssessing CD4 + nd CD8 + T cells, single cell suspensions from spleens nd lymph nodes were stined with FITC-nti-CD3e (clone 145-2C11, BD Biosciences), PE-nti-CD4 (clone H129.19, BD Biosciences) nd PerCp-nti-CD8α (clone , BD Biosciences). For the stining of mcrophges nd MDSCs, PerCP cy5.5-nti-f4/8 (clone BM8, eiosciences), FITCnti-CD11 (clone M1/7, BD Biosciences), nd APC-nti- Gr-1 (clone RB6-8C5, BD Biosciences) were dded into the

3 Co et l. BMC Cncer (216) 16:343 Pge 3 of 11 1 μl single splenocyte suspension nd incuted for 3 min t 4 C. Intrcellulr cytokine stining ssys were performed s descried elsewhere [17]. Briefly, cells isolted from spleens were stimulted with PMA (5 ng/ml), ionomycin (1 μg/ml), nd refeldin (Sigm) in order to induce IFN-γ production. LPS (1 μg/ml) nd GolgiPlugô were used to induce IL-12 production. Following stimultion, the cells were incuted for 5 h in RPMI 164 medium contining 1 % FBS t 37 C. Cells were collected nd wshed twice followed y surfce stining s descried ove. The cells were then fixed nd permeilized with Cytofix/Cytoperm (BD Biosciences) ccording to the mnufcturer's instructions nd stined intrcellulrly with PE-nti-IFN-γ (clone XMG 1.2, BD Biosciences) nd PE-nti-IL-12p4/7 (clone C15.6, BD Biosciences) or with corresponding isotope control ntiodies for 3 min in permeiliztion uffer (BD Biosciences). After wshing twice in permeiliztion uffer, the cells were resuspended in. For tumor stining nd ROS mesurement, tumors were removed from ech mouse t the end of tretment nd minced into smll pieces nd digested with 5 U/ml collgense (type IV, Sigm) for 1 h t 37 C with gittion. The resultnt cells were pssed through nylon mesh to remove deris, nd vile cells were wshed with with 2 % FBS. Intrcellulr ROS genertion ws ssessed using 2,7,- dichlorofluorescein dicette (DCFH-DA, Sigm). Briefly, cells were plted on the 6-well pltes nd incuted with DCFH-DA (1 mmol/l) for 3 min t 37 C o Cnd stined with corresponding ntiodies s descried ove. After wshing twice with, the cells were resuspended in contining 5 % FCS. Dt were cquired using FACS Cliur (BD Biosciences, Sn Diego, CA, USA) nd nlyzed using FlowJo v7.6.2 (Tree Str Inc., Ashlnd, OR, USA). Cytokine ssys y ELISA nd NO ssy y Griess rection Splenocytes hrvested from ech group of mice were cultured for 48 h followed y collection of the superntnts. Levels of IFN-γ, TNF-α nd IL-1 were determined with corresponding ELISA kit (R&D Systems, Minnepolis, MN) ccording to the mnufcturer s instructions. To determine NO production, concentrtions of NO 2 in cell superntnts were mesured y the Griess rection [18]. Briefly, 1 μl of the superntnt ws incuted with 1 μl of Griess regent [equl volumes of 1 % (w/v) sulfnilmide (Wko, Osk, Jpn) nd.1 % (w/v) N-1-nphtyl ethylenedimine dihydrochloride (Wko) in 2.5 % (w/v) H 3 PO 4 ] for 1 min t room temperture, nd NO 2 concentrtion ws determined y mesuring the opticl density t 55 nm (A55) in reference to the A55 of stndrd NNO 2 solution. RNA isoltion nd rel-time RT-PCR Totl RNA of spleen cells (5 1 6 ) nd Tumor tissue (nerly 1 mg) ws extrcted y using Trizol (Invitrogen, Crlsd, CA) ccording to the mnufcturer s instructions nd quntified y OD t 26 nm using UV- VIS spectrophotometer (PYE-UNICAM, USA). To remove genomic DNA contmintion, RNA ws treted with DNseI nd reverse-trnscried using primescript regent kit (Tkr Biotechnology, Chin). cdna ws synthesized using PrimeScript TM RT regent kit with gdna Erser (Tkr). Reverse trnscription ws performed in 1 μl rection mixture contining Prime- Script TM uffer, PrimeScript TM RT enzyme mix, oligo dt primer (5 μm), rndom 6 mers (1 μm) nd 5 ng of totl RNA. PCR ws performed with the resulting cdna s templte nd specific oligonucleotide primers. Primers used for the sequence-specific PCR were shown in Tle 1. Quntittive PCR ws crried out using SYBR Premix Ex Tq regent kit (Tkr) on ABI 75 (ABI, USA). After denturtion t 95 C for 3 s, 4 cycles of PCR (95 C for 5 s nd 6 C for 3 s) were performed. Amplifiction of the β-ctin sequence served s n internl control. Ech experiment ws performed three times independently. The verge cycle threshold (CT) of the duplicte mesurements ws clculted. After verifying tht mplifiction efficiencies of the trget genes nd β-ctin were pproximtely equl, the 2 -ΔΔ CT method ws used to quntify the reltive gene expression in the group nd experiment groups. Sttistics nlysis Survivl nlysis ws tested y the Kpln Meyer method. Results were expressed s the men vlue ± SD nd interpreted y Student s t-test. Differences were considered sttisticlly significnt when P<.5. Tle 1 Primer sequences for RT-PCR Primer Nme Sequence (5 3 ) β-ctin_f GATTACTGCTCTGGCTCCTAGC β-ctin_r GACTCATCGTACTCCTGCTTGC IFN-γ_F GTTACTGCCACGGCACAGTCATTG IFN-γ_R ACCATCCTTTTGCCAGTTCCTCCAG Grnzyme B_F CCTGAAGGAGGCTGTGAAAGAATC Grnzyme B_R CCCTGCACAAATCATGTTTAGTCC T-et_F TCAACCAGCACCAGACAGAG T-et_R AAACATCCTGTAATGGCTTGTG inos_f TCCTCACTGGGACAGCACAGAATG inos_r GTGTCATGCAAAATCTCTCCACTGCC ARG-1_F ATGGAAGAGACCTTCAGCTAC ARG-1_R GCTGTCTTCCCAAGAGTTGGG

4 Co et l. BMC Cncer (216) 16:343 Pge 4 of 11 Results supplementtion slows the growth of 4 T1 rest crcinom cells nd prolongs survivl To determine whether supplementtion in 4 T1 TB mice could improve the survivl of mice upon tumor development, 4 T1 TB mice were orlly dministered with for 2 consecutive dys eginning when the tumor ws plple. We found tht supplementtion could inhiit tumor growth in 4 T1 TB mice, nd tumor volume in the supplementtion group ws significntly smller thn the control group from dy 28 on (P<.5, t-test) (Fig. 1). Similrly, the tumor size nd weight from the tretment group ws significntly reduced (P<.5, t-test) compred with tht of the control group (Fig. 1 nd c). In ddition, there ws significnt difference in the survivl curve etween tretment nd control groups (P<.1, Kpln-Meier nlysis). All mice in the group died etween dy 32 nd 47 post 4 T1 cell inocultion. In contrst, tretment significntly prolonged the survivl of 4 T1 inoculted mice, with deth eginning t 48 dys post 4 T1 inocultion (Fig. 1d). suppresses the MDSCs from spleen nd tumor In TB mice, heterogeneous mixture of myeloid cells expnds t vrious stges of development. These cells my not only inhiit nti-tumor immunity ut lso directly stimulte tumorigenesis s well s tumor growth nd expnsion. This popultion efficiently suppresses T cell immune functions nd is chrcterized primrily y expression of CD11 nd Gr-1 [4]. Here, we compred the frequencies of MDSCs (CD11 + Gr-1 + ) from the spleens nd tumors in oth nd control groups. As shown in Fig. 2 nd, orl dministrtion of significntly reduced the percentge of MDSCs from oth splenic cells (P<.5, t-test) nd tumor cells (P<.5, t-test) s well s the numer of MDSCs in the spleen in 4 T1 TB mice. Menwhile, tretment significntly decresed the ROS levels in MDSCs in the tumor tissues (P<.5, t-test) (Fig. 2c). These results indicted tht supplementtion my led to enhnced nti-tumor immune responses. supplementtion promotes Gr-1 + CD11 F4/8 + mcrophges ut suppresses Gr-1 + CD11 + F4/8 + mcrophges To nlyze whether tretment influenced the frequency nd functionl stte of mcrophges, we first compred the percentges of two different popultions of mcrophges (CD11 + F4/8 + nd CD11 F4/8 + gted in Gr-1) in the spleen. As shown in Fig. 3, treted TB mice produced lower percentge of Gr-1 + CD11 + F4/8 + mcrophges (P<.5, t-test), ut higher percentge of Gr-1 + CD11 F4/8 + mcrophges (P<.5, t-test) compred to control mice. Rel-time RT-PCR nlysis of the trnscript levels of inos nd ARG-1 showed tht tretment significntly elevted the expression of inos (P<.5, t-test), compred with nd + AG groups in tumor (Fig. 3). ARG-1 mrna level ws lso elevted y or + AG tretment, ut no sttisticlly significnce ws detected etween nd experiment groups (Fig. 3). tretment Tumor volume (mm 3 ) Dys post 4T1 chllenge c 3 d 1 Tumor weight (g) 2 1 Percent surviv l Dys post 4T1 inocultion Fig. 1 tretment improved the survivl of mice nd inhiited the growth of 4 T1 mmmry crcinom in mice. () Growth curve of 4 T1 tumors etween nd groups. Tumor locks () nd weights (c) removed from the two groups t the end of tretment were compred. The survivl (d) of 4 T1 TB mice (n = 7) ws checked every dy. P<.5 nd P<.1 compred to group

5 Co et l. BMC Cncer (216) 16:343 Pge 5 of 11 5 % of MDSCs Spleen Tumor 1 5 MDSCs in spleens ( 1 6 )15 c ROS of MDSC in tumor Fig. 2 suppressed MDSCs from spleens nd tumors of 4 T1 TB mice. The frequencies nd solute numers of MDSCs in the spleens nd tumors ( nd ) were ssyed y FACS. Men fluorescence intensity (MFI) (c) of ROS in MDSC otined from tumor in 4 T1 TB mice. P<.5 compred to group stimulted the mcrophges to produce significntly higher level of NO (P<.5, t-test) in the superntnt of cultured splenic cells thn tht in nd + AG groups (Fig. 3c). No sttisticlly significnce etween nd + AG groups ws detected in this experiment (Fig. 3 nd c). These results demonstrted tht could decrese the numers of immture mcrophges, leding to elevted levels of inosmrnandnoin4t1tbmice. promotes the differentition nd ctivtion the of DCs in 4 T1 TB mice Our next step ws to determine whether the oserved reduction in tumor mss ws ssocited with enhnced immune responses elicited y through the suppression of MDSCs. We first exmined the medited regultion of the susets nd mturtion of DCs lte in rest cncer development. As shown in Fig. 4, there were higher percentges nd numers of myeloid DCs (mdcs, CD11c + CD11 + )(P<.5, t-test) nd plsmtocytoid DCs (pdcs, CD11c + B22 + )(P<.5, t-test) in the supplement group thn the control group. In ddition, elevted mturtion of CD11c + DCs ws oserved, evidenced y the incresed expression of MHC II (CD11c + MHC II + ) following tretment (P<.5, t-test). Finlly, incresed frequency nd numer of CD11c + DCs secreting IL-12 (CD11c + IL-12 + ) t the end of tretment ws oserved (P<.5, t-test). These results indicted tht tretment could initite the expnsion nd ctivtion of DCs. promotes Th1 immune responses leding to inhiition of cncer development In order to determine whether tretment promoted Th1 immune response, the percentges of CD4 + nd CD8 + T cells from lymph nodes nd spleen were mesured (Fig. 5 nd ). The results showed tht incresed the percentge of CD8 + cytotoxic T lymphocytes (CTLs) (P<.5, t-test) (Fig. 5f nd g). We lso found tht hd no effect on the numer of IFN-γ producing CD4 + T cells (CD4 + IFN-γ + ) in the spleens of TB mice (Fig. 5d). However, the level of Th1 trnscriptionl fctor T-et significntly incresed upon tretment (Fig. 5c). Furthermore, s shown in Fig. 5e, TNF-α nd IFN-γ levels in splenocyte superntnts were significntly incresed in treted TB mice compred to control mice (P<.5, t-test). Finlly, we determined tht the frequency of CTLs, mrna levels of

6 Co et l. BMC Cncer (216) 16:343 Pge 6 of 11 1 % CD11 + F4/ % CD11 - F4/ c mrna Reltive Expression in tum or ## inos +AG ARG-1 Fig. 3 ffected two different popultions of mcrophges in the spleens of 4 T1 TB mice. Two popultions of mcrophges (CD11 + F4/8 + nd CD11 F4/8 + gted in Gr-1) were shown (). Totl RNA ws purified from tumor lock nd ARG-1 nd inos mrna were quntified y rel-time RT-PCR (). NO levels from the superntnt of cultured splenic cells were evluted y the Griess rection (c). P<.5 nd P<.1 compred to group. ## P<.1 compred to + AG group (um ) Splenic NO L-A r g ## L -A rg+ag Grnzyme B nd IFN-γ in the tumor (Fig. 5h), nd results showed tretment significntly enhnced frequency nd CTLs, nd mrna level of Grnzyme B ( 1-fold increse compred with ) nd IFN-γ (4-fold compred with ) significntly elevted. These results indicted tht supplementtion promoted the development of dptive immune response in TB mice. hs no effect on the Tregs in 4 T1 TB mice As n importnt group of immune-suppressive cells, Tregs re considered to ply key role in the escpe of tumor cells from host protective immune responses [19]. We next ssessed whether tretment could ffect the numer of Tregs (CD4 + CD25 + Foxp3 + ) in TB mice. The results from FACS nlysis showed tht tretment hd no effect on Tregs in TB mice (Fig. 6 nd ). In ddition, IL-1 levels produced y splenic cells were similr etween the nd groups, result tht ws consistent with unltered Treg levels (Fig. 6c). These dt reveled tht supplementtion with tretment hd no ovious effect on Tregs in 4 T1 TB mice. Discussion Mouse models re importnt tools to investigte the immune response nd immunotherpeutic outcomes in cncer. In some experimentl tumor models, increses the ltency period nd survivl rte, reduces tumor size nd incidence, shortens the time of tumor regression, nd inhiits tumor growth compred with other dietry interference or no dietry supplementtion [2 22]. Dietry supplementtion with in ptients with rest cncer significntly enhnces host defenses [23, 24], nd therefore my hve eneficil therpeutic role. In relted study, supplement of significntly reduced the incidence of colorectl cncer due to nonspecific stimultion of the host immune system [25]. In the present study, we supplemented 4 T1 TB mice with nd monitored nti-tumor immune responses. The results reveled tht prolonged survivl time y inhiiting tumor growth. This ws ssocited with the suppression of MDSCs nd enhnced innte nd dptive immune responses. This suggests tht might e used s n djuvnt for rest cncer tretment.

7 Co et l. BMC Cncer (216) 16:343 Pge 7 of 11 %ofspleencells Asolute DC numers in spleens ( 1 6 ) mdcs pdcs MHC II IL-12 mdcs pdcs MHC II IL-12 Fig. 4 Effect of tretment on DCs in 4 T1 TB mice. The frequencies () nd solute numers () of mdcs, pdcs, CD11c + MHC II + DCs, nd CD11c + DCs secreting IL-12 were determined in 4 T1 TB mice. Results re representtives of three independent experiments. P<.5 nd P<.1 compred to group MDSCs, typiclly positive for oth CD11 nd Gr1 in mice, re popultion of immture myeloid cells defined y their suppressive ctions on T cells, DCs, nd nturl killer cells. MDSCs cn suppress T cell immune function vi constitutive production of ARG-1, n enzyme responsile for significnt depletion [1, 26]. In ddition to inhiiting T cells ctivtion, MDSCs lso impct nti-tumor immunity y perturing innte immunity through their interctions with mcrophges, NK cells, nd NK T cells [27, 28]. Both MDSCs nd T cells require for protein synthesis. MDSCs produce high levels of intrcellulr rginse requiring them to import excess rginine through their CAT-2B trnsporter [29, 3]. As result, they deplete nd limit vilility to T cells in the tumor microenvironment. Without, nïve T cells in TB individuls cnnot efficiently trffic to lymph nodes or tumor sites. MDSCs were found to infiltrte into tumors nd promote tumor ngiogenesis y producing high levels of MMP9 nd y directly incorporting into tumor endothelium [31]. Hence, s therpeutic trget, downregultion of MDSCs frequencies nd/or rogtion of their immunosuppressive functions dely the tumor growth nd prolong the survivl oth in niml models nd in cncer ptients [32 34]. Regultion of MDSCs includes the prevention of genertion from one mrrow precursor cells nd the stimultion of MDSCs differentition towrds mture DCs nd mcrophges. Therpeutic interventions trgeting MDSCs my not only enhnce the host immune system ut lso inhiit tumor invsion nd metstsis [35]. In the present study, the frequencies of MDSCs were significntly suppressed in the 4 T1 TB mice fter supplementtion with, nd consistently, nti-tumor immunity ws enhnced. Our results showed tht supplementtion enhnced the nti-tumor immunity y suppressing the numer of MDSCs in 4 T1 TB mice. This is in greement with the recent report tht depletion lunted ntitumor T-cell responses y inducing MDSCs [7]. Although the mechnism remins uncler, such inverse correltion etween nd MDSCs my e medited y the kinse GCN2, key meditor of the effects induced y mino cid strvtion [7]. In ddition, severl possile fctors regulting MDSCs including VEGF, S1A8/A9, GM-CSF, nd G-CSF my e involved in the downregultion of MDSCs y supplementtion. Dietry ws reported to decrese plsm VEGF [36]. More experiments re required to identify the key molecules to ridge the MDSCs nd L- Arg in the rest cncer model in the future. Mcrophges, which re pivotl regultors in homeosttic tissue nd tumor microenvironments, ply dul roles during the progression of cncer. In one role, they ctivte nd present tumor ntigens to T cells, which re

8 Co et l. BMC Cncer (216) 16:343 Pge 8 of 11 c d e f g h Fig. 5 promoted dptive immune responses nd inhiited cncer development. Flow cytometry nlysis of CD4 + T cells, CD8 + T cells, nd CD4 + IFN-γ + T cells ws shown (,, d, f nd g). Totl RNA ws purified from spleen cells nd T-et mrna were quntified y rel-time RT-PCR (c). ELISA ws used to determine the levels of TNF-α nd IFN-γ (e). Totl RNA ws purified from tumor tissue nd Grnzyme B nd INF-γ mrna were quntified y rel-time RT-PCR (h). P<.5 compred to group then ctivted to kill tumor cells [37]. At the sme time, they relese high levels of NO nd ROS to kill tumor cells [38, 39]. On the other hnd, s the immune surveillnce is not sufficient nymore to prevent the occurrence of cncer, tumor-ssocited mcrophges (TAM) contriutes to tumor progression [4, 41]. Mny oservtions indicte tht TAM (Gr-1 + CD11 + F4/8 + ) promote tumor progression nd metstsis [42, 43]. In our study, flow cytometric nlysis of splenic F4/8 + mcrophges reveled tht more thn 9 % of the Gr-1 + cells hd CD11 + F4/8 + mcrophge phenotype, which lso ws considered s suset of MDSCs [42]. tretment significntly decresed this popultion ut elevted the frequency of CD11 F4/8 + mcrophges. In our study, significntly elevted the mrna level of inos, ut not ARG-1, which ws consistent with the higher level of NO. An erlier study showed tht could lock the formtion nd development of colorectl tumors, nd this effect might e relted to the incresed serum NO concentrtion nd decresed ornithine decroxylse ctivity [44]. Our results lso indicted tht supplementtion could significntly elevte the NO level in 4 T1 TB mice which ws consistent with the incresed level of CD11 F4/8 + mcrophges. However, NO ws reported to hve oth deleterious nd protective effects in the rest cncer [38, 45, 46]. Therefore, we further evluted the role of NO in rest cncer y supplementtion of n NOS inhiitor, minogunidine (AG) into the 4 T1 TB mice with supplementtion ( + AG). The results showed tht nd + AG tretment hd comprle suppressive effect on tumor tissue weight (dt not shown), which reflects the complexity of NO in rest cncer. Considering the divergent cell sources of NO including mcrophges [47], T cells [48], MDSCs [49], tumor cells [5], we speculte tht the distinct sources nd different iovilility levels of NO my ccount for the inconsistent roles of NO in the tumor models. In ddition, NO my serve s one ut not the only one (such s IFN-γ, CTL)protective effector in the tumor ering mice supplemented with. Thus the exct role of NO in rest cncer needs to e explored in the future. DCs ply pivotl role in ridging innte nd dptive immune responses. MDSCs decrese DC mturtion, s well s the ility to tke up ntigen, migrte, nd

9 Co et l. BMC Cncer (216) 16:343 Pge 9 of %Treg 1 5 c 6 IL-1 (pg/ml) 4 2 Fig. 6 hd no effect on Tregs in 4 T1 TB mice. () nd () We ssessed the percentges of CD25 + Foxp3 + T cells gted on CD4 etween the nd group. (c) The level of IL-1 present in cultured splenic cell superntnts ws ssessed y ELISA. Results re representtive of three independent experiments induce IFN-γ production in T cells [51]. In this study, immture DCs in TB mice were incresed compred to the control group. A corroorting study showed tht dietry supplementtion with enhnced T cell medited immune function in helthy nimls nd humn eings [52, 53]. We lso found tht could promote the differentition nd ctivtion of DCs in the spleen, which ws ssocited with the initition of the nti-tumor immune responses in TB mice. Our dt showed tht tretment significntly incresed the frequencies of mdcs nd pdcs. IL-12 increses the cpilities of professionl APCs in the tumor stroml nd ctivtes CD8 + T cells to detect ntigen crosspresenttion [54, 55]. In the 4 T1 model, IL-12 stimultes MDSCs to develop into mture myeloid cells. MDSCs otined from tumors nd spleens of tumor ering mice treted with IL-12 up-regulted the surfce mrkers of mcrophges (F4/8 nd MHC II) nd DCs (CD8 nd CD86) suggesting differentition into more mture, less immunosuppressive forms. The spleens otined from tumor-ering mice lso hd up-regultion of mny dendritic cell nd mcrophge mturtion mrkers such s CD8, CD86, F4/8 nd MHCII [56]. At the sme time, high levels of IL-12 synthesized y mture DCs enhnce oth innte nd cquired immunity [57, 58]. In this experiment, we found expression of MHC II nd secretion of IL-12 y DCs were oth significntly incresed y tretment. deprivtion induces T cell hyporesponsiveness, s defined y profound reduction of T cell prolifertion nd reduced CD3ζ chin expression [6, 9]. Tumorinfiltrting CTLs hve ntitumor ctivity s judged y their fvorle effect on ptients survivl nd could potentilly e exploited in the tretment of rest cncer [59]. However, T cells show nergy s oth ntigenspecific CD4 + nd CD8 + T cells re tolernt to tumors. The mechnisms of CD8 + T cell tolernce to tumors include MDSCs [27] nd Tregs [6]. MDSCs re lso detected in tumor infiltrtes nd inhiit effector phse lytic functions of CD8 + tumor infiltrting lymphocytes [61]. A recent study showed tht tretment of TB mice with 5-fluorourcil led to mjor depletion of MDSCs in vivo ut incresed IFN-γ production y tumor-specific CD8 + T cells infiltrting the tumor nd promoted T cell dependent ntitumor responses in vivo [62]. These results indicted tht therpy trgeting MDSCs could e n effective method of cncer tretment. Our results demonstrted tht supplementtion could reverse the immunosuppresive effects of MDSCs in 4 T1 TB mice s CD8 + T cells were significntly elevted within tumors. Undoutedly, grnzyme B is involved in n importnt pthwy for CTL/NK cells-induced poptosis [63], nd significntly elevted the mrna level of grnzyme B in tumor. Though CD4 + T cells producing IFN-γ ws not incresed, supplementtion of TB mice with elevte Th1 cells trnscription fctor

10 Co et l. BMC Cncer (216) 16:343 Pge 1 of 11 T-et, nd lso improved IFN-γ production. As proinflmmtory cytokine, IFN-γ induced surfce expression of PD-L1 in rest cncer cells to induce the poptosis of cncer cells [64]. In rest cncers, the percentge of Tregs, s ssessed y Foxp3 positivity, increses in prllel with the disese stge [65, 66], indicting tht the presence of Tregs promotes tumor progression through immunosuppression. IL-1 hs een shown to modulte poptosis nd suppress ngiogenesis during tumor regression [67, 68]. Here, our results showed tht the level of Tregs trnscription fctor Foxp3 ws significntly reduced upon L- Arg tretment. In summry, is n essentil mino cid for promoting T cell function. However, the depletion of y MDSCs in rest cncer ptients or TB mice gretly reduces the nti-tumor immune responses. supplementtion in rest cncer ering mice significntly decresed MDSCs s well s the ROS expression levels. This decrese ws ssocited with enhnced innte nd dptive immune responses trgeting tumors of the 4 T1 TB mice. Conclusion Our results suggest tht supplementtion my represent n effective djunct therpy of rest cncer therpy to overcome immunosuppression medited oth y MDSCs nd tumor cells to chieve etter therpeutic effects in cncer ptients. Arevitions AG, minogunidine; ARG-1, rginse 1; CT, cycle threshold; CTLs, cytotoxic T lymphocytes; DCs, dendritic cells; ER, estrogen receptor; FBS, fetl ovine serum; inos, inducile nitric oxide synthse; L, length;, L-rginine; MDSCs, myeloid-derived suppressor cells; TB, tumor ering; NO, nitric oxide; NOS2, nitric oxide synthse 2; Tregs, regultory T cells; W, width Acknowledgements This work ws supported y grnts from the Ntionl Nturl Science Foundtion of Chin (3959) nd Lioning Province Science nd Technology Foundtion ( ). We re grteful to ll other stff in the College of Animl Science nd Technology. Avilility of dt nd mterils Dt nd mterils re included in the mnuscript. Authors contriutions YC conceived the study nd drfted the mnuscript. YF conducted the experiments of flow cytometry. YZ nd XZ performed the sttisticl nlysis. FJ prticipted in the design, coordintion of the study s well s sttisticl evlution. All uthors proofred the mnuscript criticlly, nd pproved the finl mnuscript. Competing interests The uthors declre tht they hve no competing interests. Consent for puliction Not pplicle. Ethics pprovl nd consent to prticipte All niml experimentl protocols were pproved y the Animl Cre nd Use Committee of Chin Medicl University. Author detils 1 Deprtment of Surgicl Oncology nd Brest Surgery, The First Affilited Hospitl of Chin Medicl University, Shenyng, Lioning 111, Chin. 2 Deprtment of Lortory Medicine, The First Affilited Hospitl of Chin Medicl University, Shenyng, Lioning 111, Chin. 3 Deprtment of Medicl Exmintion Center, The First Affilited Hospitl of Chin Medicl University, Shenyng, Lioning 111, Chin. 4 Deprtment of Immunology, College of Bsic Medicl Sciences, Chin Medicl University, Shenyng, Lioning 11122, Chin. Received: 12 Octoer 215 Accepted: 2 My 216 References 1. Brron JJ, Quimo R, Nikm PT, Amonkr MM. Assessing the economic urden of rest cncer in US mnged cre popultion. Brest Cncer Res Tret. 28;2: Bronte V, Znovello P. Regultion of immune responses y L-rginine metolism. Nt Rev Immunol. 25;8: Kudo S, Ngski Y. A novel nitric oxide-sed nticncer therpeutics y mcrophge-trgeted poly(l-rginine)-sed nnoprticles. J Control Relese. 215;217: Gd MZ. Anti-ging effects of L-rginine. J Adv Res. 21;3: Rodriguez PC, Quiceno DG, Ocho AC. L-rginine vilility regultes T-lymphocyte cell-cycle progression. Blood. 27;4: Ze AH, Rodriguez PC, Atkins MB, Hernndez C, Signoretti S, Zlet J, et l. Arginse-producing myeloid suppressor cells in renl cell crcinom ptients: mechnism of tumor evsion. Cncer Res. 25;8: Fletcher M, Rmirez ME, Sierr RA, Rer P, Thevenot P, Al-Khmi AA, et l. l-arginine depletion lunts ntitumor T-cell responses y inducing myeloid-derived suppressor cells. Cncer Res. 215;75(2): Rodriguez PC, Ocho AC. Arginine regultion y myeloid derived suppressor cells nd tolernce in cncer: mechnisms nd therpeutic perspectives. Immunol Rev. 28;222: Rodriguez PC, Ze AH, Culott KS, Zlet J, Ocho JB, Ocho AC. Regultion of T cell receptor CD3zet chin expression y L-rginine. J Biol Chem. 22;24: Rodriguez PC, Quiceno DG, Zlet J, Ortiz B, Ze AH, Pizuelo MB, et l. Arginse I production in the tumor microenvironment y mture myeloid cells inhiits T-cell receptor expression nd ntigen-specific T-cell responses. Cncer Res. 24;16: Brul A. Arginine nd immune function. Nutrition. 199;1:53 8. discussion Geng D, Sun D, Zhng L, Zhng W. The therpy of gefitini towrds rest cncer prtilly through reversing rest cncer iomrker rginine. Afr Helth Sci. 215;2: Cimen Bozkus C, Elzey BD, Crist SA, Ellies LG, Rtliff TL. Expression of Ctionic Amino Acid Trnsporter 2 Is Required for Myeloid-Derived Suppressor Cell-Medited Control of T Cell Immunity. J Immunol. 215;11: Yng X, Belosy A, Du M, Fn TM, Turner RT, Iwniec UT, et l. Estrdiol increses ER-negtive rest cncer metstsis in n experimentl model. Clin Exp Metstsis. 213;6: Breuillrd C, Drquy S, Curis E, Neveux N, Grnier JP, Cynoer L, et l. Effects of dietes-specific enterl nutrition on nutritionl nd immune sttus of dietic, oese, nd endotoxemic rts: interest of grded rginine supply. Crit Cre Med. 212;8: Zheng L, Pn Y, Feng Y, Cui L, Co Y. inine supplementtion in mice enhnces NO production in spleen cells nd inhiits Plsmodium yoelii trnsmission in mosquitoes. Prsit Vectors. 215;8: Bhrhni MS, Chiu B, N KS, Inmn RD. Activtion of invrint NKT cells confers protection ginst Chlmydi trchomtis-induced rthritis. Int Immunol. 29;7: Co Y-M, Tsuoi T, Torii M. Nitric oxide inhiits the development of Plsmodium yoelii gmetocytes into gmetes. Prsitol Int. 1998;2:

11 Co et l. BMC Cncer (216) 16:343 Pge 11 of Olkhnud PB, Dmdinsuren B, Bodogi M, Gress RE, Sen R, Wejksz K, et l. Tumor-evoked regultory B cells promote rest cncer metstsis y converting resting CD4(+) T cells to T-regultory cells. Cncer Res. 211;1: Tked Y, Toming T, Tei N, Kitmur M, Tg S. Inhiitory effect of L- rginine on growth of rt mmmry tumors induced y 7,12- dimethylenz()nthrcene. Cncer Res. 1975;9: Tchin K, Muki K, Hirok I, Moriguchi S, Tkm S, Kishino Y. Evlution of the effect of rginine-enriched mino cid solution on tumor growth. JPEN J Prenter Enterl Nutr. 1985;4: Reynolds JV, Dly JM, Shou J, Sigl R, Ziegler MM, Nji A. Immunologic effects of rginine supplementtion in tumor-ering nd non-tumorering hosts. Ann Surg. 199;2: Brittenden J, Prk KG, Heys SD, Ross C, Ashy J, Ah-See A, et l. L-rginine stimultes host defenses in ptients with rest cncer. Surgery. 1994;2: Brittenden J, Heys SD, Ross J, Prk KG, Eremin O. Nturl cytotoxicity in rest cncer ptients receiving neodjuvnt chemotherpy: effects of L-rginine supplementtion. Eur J Surg Oncol. 1994;4: M Q, Hoper M, Anderson N, Rowlnds BJ. Effect of supplementl L-rginine in chemicl-induced model of colorectl cncer. World J Surg. 1996;8: Bronte V, Serfini P, De Snto C, Mrigo I, Tosello V, Mzzoni A, et l. IL-4- induced rginse 1 suppresses llorective T cells in tumor-ering mice. J Immunol. 23;1: Ostrnd-Rosenerg S, Sinh P. Myeloid-derived suppressor cells: linking inflmmtion nd cncer. J Immunol. 29;8: Ostrnd-Rosenerg S. Myeloid-derived suppressor cells: more mechnisms for inhiiting ntitumor immunity. Cncer Immunol Immunother. 21;1: Mussi F, Egn S, Higginothm-Jones J, Perry T, Beggs A, Odintsov E, et l. Arginine dependence of cute myeloid leukemi lst prolifertion: novel therpeutic trget. Blood. 215;15: Rer P, Ocho AC, Rodriguez PC. Metolism of L-rginine y myeloidderived suppressor cells in cncer: mechnisms of T cell suppression nd therpeutic perspectives. Immunol Invest. 212;41(6-7): Yng L, DeBusk LM, Fukud K, Fingleton B, Green-Jrvis B, Shyr Y, et l. Expnsion of myeloid immune suppressor Gr + CD11 + cells in tumorering host directly promotes tumor ngiogenesis. Cncer Cell. 24;4: Filipzzi P, Huer V, Rivoltini L. Phenotype, function nd clinicl implictions of myeloid-derived suppressor cells in cncer ptients. Cncer Immunol Immunother. 212;2: Wilcox RA. Myeloid-derived suppressor cells: therpeutic modultion in cncer. Front Biosci (Elite Ed). 212;4: Montero AJ, Diz-Montero CM, Kyrikopoulos CE, Bronte V, Mndruzzto S. Myeloid-derived suppressor cells in cncer ptients: clinicl perspective. J Immunother. 212;2: Yng L, Hung J, Ren X, Gorsk AE, Chytil A, Akre M, et l. Arogtion of TGF et signling in mmmry crcinoms recruits Gr-1 + CD11 + myeloid cells tht promote metstsis. Cncer Cell. 28;1: Liu XD, Wu X, Yin YL, Liu YQ, Geng MM, Yng HS, et l. Effects of dietry L-rginine or N-crmylglutmte supplementtion during lte gesttion of sows on the mir-15/16, mir-221/222, VEGFA nd enos expression in umilicl vein. Amino Acids. 212;42(6): Dunn GP, Old LJ, Schreier RD. The immunoiology of cncer immunosurveillnce nd immunoediting. Immunity. 24;2: Fukumur D, Kshiwgi S, Jin RK. The role of nitric oxide in tumour progression. Nt Rev Cncer. 26;7: Olson SY, Grn HJ. Regultion of poptosis-relted genes y nitric oxide in cncer. Nitric Oxide. 28;2: Coussens LM, Wer Z. Inflmmtion nd cncer. Nture. 22;6917: Mntovni A, Allven P, Sic A, Blkwill F. Cncer-relted inflmmtion. Nture. 28;723: Sic A, Bronte V. Altered mcrophge differentition nd immune dysfunction in tumor development. J Clin Invest. 27;5: Condeelis J, Pollrd JW. Mcrophges: oligte prtners for tumor cell migrtion, invsion, nd metstsis. Cell. 26;2: M Q, Wng Y, Go X, M Z, Song Z. L-rginine reduces cell prolifertion nd ornithine decroxylse ctivity in ptients with colorectl denom nd denocrcinom. Clin Cncer Res. 27;24: Burke AJ, Sullivn FJ, Giles FJ, Glynn SA. The yin nd yng of nitric oxide in cncer progression. Crcinogenesis. 213;3: Grndos-Principl S, Liu Y, Guevr ML, Blnco E, Choi DS, Qin W, et l. Inhiition of inos s novel effective trgeted therpy ginst triplenegtive rest cncer. Brest Cncer Res. 215;17: Klug F, Prksh H, Huer PE, Seiel T, Bender N, Hlm N, et l. Low-dose irrdition progrms mcrophge differentition to n inos(+)/m1 phenotype tht orchestrtes effective T cell immunotherpy. Cncer Cell. 213;5: Jyrmn P, Alfrno MG, Svider PF, Prikh F, Lu G, Kidwi S, et l. inos expression in CD4+ T cells limits Treg induction y repressing TGFet1: comined inos inhiition nd Treg depletion unmsk endogenous ntitumor immunity. Clin Cncer Res. 214;24: Arkw Y, Qin J, Chou HS, Bhtt S, Wng L, Stuehr D, et l. Cotrnsplnttion with myeloid-derived suppressor cells protects cell trnsplnts: crucil role of inducile nitric oxide synthse. Trnsplnttion. 214;7: Jyrmn P, Prikh F, Lopez-River E, Hilemichel Y, Clrk A, M G, et l. Tumor-expressed inducile nitric oxide synthse controls induction of functionl myeloid-derived suppressor cells through modultion of vsculr endothelil growth fctor relese. J Immunol. 212;11: Poschke I, Mo Y, Admson L, Slzr-Onfry F, Msucci G, Kiessling R. Myeloid-derived suppressor cells impir the qulity of dendritic cell vccines. Cncer Immunol Immunother. 212;6: Sx HC. Arginine stimultes wound heling nd immune function in elderly humn eings. JPEN J Prenter Enterl Nutr. 1994;6: Kirk SJ, Hurson M, Regn MC, Holt DR, Wsserkrug HL, Brul A. Arginine stimultes wound heling nd immune function in elderly humn eings. Surgery. 1993;2: discussion Kerkr SP, Goldszmid RS, Murnski P, Chinnsmy D, Yu Z, Reger RN, et l. IL-12 triggers progrmmtic chnge in dysfunctionl myeloid-derived cells within mouse tumors. J Clin Invest. 211;12: Steding CE, Wu ST, Zhng Y, Jeng MH, Elzey BD, Ko C. The role of interleukin-12 on modulting myeloid-derived suppressor cells, incresing overll survivl nd reducing metstsis. Immunology. 211;2: Mrkowitz J, Wesolowski R, Ppenfuss T, Brooks TR, Crson WE. Myeloidderived suppressor cells in rest cncer. Brest Cncer Res Tret. 213; 14(1): Bnchereu J, Steinmn RM. Dendritic cells nd the control of immunity. Nture. 1998;6673: Steinmn RM. Dendritic cells nd the control of immunity: enhncing the efficiency of ntigen presenttion. Mt Sini J Med. 21;3: Mhmoud SM, Pish EC, Powe DG, Mcmilln RD, Gringe MJ, Lee AH, et l. Tumor-infiltrting CD8+ lymphocytes predict clinicl outcome in rest cncer. J Clin Oncol. 211;15: Getnet D, Mris CH, Hipkiss EL, Grosso JF, Hrris TJ, Yen HR, et l. Tumor recognition nd self-recognition induce distinct trnscriptionl profiles in ntigen-specific CD4 T cells. J Immunol. 29;8: Rdoj S, Sio M, Scher D, Koneru M, Vukmnovic S, Frey AB. CD8(+) tumor-infiltrting T cells re deficient in perforin-medited cytolytic ctivity due to defective microtuule-orgnizing center moiliztion nd lytic grnule exocytosis. J Immunol. 21;9: Vincent J, Mignot G, Chlmin F, Ldoire S, Bruchrd M, Chevriux A, et l. 5- Fluorourcil selectively kills tumor-ssocited myeloid-derived suppressor cells resulting in enhnced T cell-dependent ntitumor immunity. Cncer Res. 21;8: Brry M, Bleckley RC. Cytotoxic T lymphocytes: ll rods led to deth. Nt Rev Immunol. 22;6: Ling M, Yng H, Fu J. Nimesulide inhiits IFN-gmm-induced progrmmed deth-1-lignd 1 surfce expression in rest cncer cells y COX-2 nd PGE2 independent mechnisms. Cncer Lett. 29;1: Btes GJ, Fox SB, Hn C, Leek RD, Grci JF, Hrris AL, et l. Quntifiction of regultory T cells enles the identifiction of high-risk rest cncer ptients nd those t risk of lte relpse. J Clin Oncol. 26;34: Merlo A, Cslini P, Crcngiu ML, Mlventno C, Triulzi T, Menrd S, et l. FOXP3 expression nd overll survivl in rest cncer. J Clin Oncol. 29; 11: Kundu N, Fulton AM. Interleukin-1 inhiits tumor metstsis, downregultes MHC clss I, nd enhnces NK lysis. Cell Immunol. 1997;1:55 61.