Lentinan inhibits tumor angiogenesis via interferon γ and in a T cell independent manner
|
|
- Trevor Albert Lang
- 5 years ago
- Views:
Transcription
1 Deng et l. Journl of Experimentl & Clinicl Cncer Reserch (2018) 37:260 RESEARCH Open Access Lentinn inhiits tumor ngiogenesis vi interferon γ nd in T cell independent mnner Shengming Deng 1, Guoxi Zhng 2, Jijie Kui 1, Peng Fn 1, Xuexing Wng 1, Pei Zhou 1, Dn Yng 3, Xichen Zheng 1, Xiomei Liu 1, Qunli Wu 3* nd Yuhui Hung 1* Astrct Bckground: Antingiogenic gents re commonly used in lung nd colon cncer tretments, however, rpid development of drug resistnce limits their efficcy. Methods: Lentinn (LNT) is iologiclly ctive compound extrcted from Lentinus edodes. The effects of LNT on tumor ngiogenesis were evluted y immunohistochemistry in murine LAP0297 lung nd CT26 colorectl tumor models. The impcts of LNT on immune cells nd gene expression in tumor tissues were determined y flow cytometry, qpcr, nd ELISA. Nude mice nd IFNγ lockde were used to investigte the mechnism of LNT ffecting on tumor ngiogenesis. The dt sets were compred using two-tiled student s t tests or ANOVA. Results: We found tht LNT inhiited tumor ngiogenesis nd the growth of lung nd colon cncers. LNT tretments elevted the expression of ngiosttic fctors such s IFNγ nd lso incresed tumor infiltrtion of IFNγ-expressing T cells nd myeloid cells. Interestingly, IFNγ lockde, ut not T cell deficiency, reversed the effects of LNT tretments on tumor lood vessels. Moreover, long-lsting LNT dministrtion persistently suppressed tumor ngiogenesis nd inhiited tumor growth. Conclusions: LNT inhiits tumor ngiogenesis y incresing IFNγ production nd in T cell-independent mnner. Our findings suggest tht LNT could e developed s new ntingiogenic gent for long-term tretment of lung nd colon cncers. Keywords: Lentinn, Interferon γ, Antingiogenic therpy, Drug resistnce, Lung cncer Bckground New lood vessels must e developed to nourish tumors tht grow igger thn 2 mm 3 in volume, nd the tumor vsculture is lso necessity for tumor s ility to metstsis; ngiogenesis is thus hllmrk of cncer [1, 2]. Importnt prongiogenic fctors tht re known to e involved in tumor ngiogenesis include proteins of the vsculr endothelil growth fctor (VEGF) fmily, the * Correspondence: chinlie@163.com; hungyh@sud.edu.cn Shengming Deng nd Guoxi Zhng contriuted eqully to this work. 3 Deprtment of Trditionl Chinese Medicine, Peking Union Medicl College Hospitl, Peking Union Medicl College nd Chinese Acdemy of Medicl Sciences, No. 1 Shuifuyun, Dongcheng District, Beijing , Chin 1 Cyrus Tng Hemtology Center, Collortive Innovtion Center of Hemtology, Stte Key Lortory of Rdition Medicine nd Prevention, Soochow University, 199 Ren-Ai Rod, Suzhou , Jingsu, Chin Full list of uthor informtion is ville t the end of the rticle pltelet-derived growth fctor (PDGF) fmily, the firolst growth fctor (FGF) fmily, nd plcentl growth fctor (PlGF) [1, 3]. Therefore, the lockde of prongiogenic signling pthwys hs een investigted nd developed s n ntingiogenic therpy iming to strve tumor cells to deth [3 6]. Antingiogenic therpies re currently in wide use ginst non-smll cell lung cncer (NSCLC), colorectl cncer, nd severl other types of solid tumors [1, 3]. The first ntingiogenic gent pproved for NSCLC ws evcizum, monoclonl ntiody to VEGF-A. The comintion of evcizum nd chemotherpeutic gents, such s cropltin nd pclitxel, improved oth progression-free survivl nd overll survivl in dvnced NSCLC ptients, compred with chemotherpy lone [4]. However, the clinicl enefits from VEGF inhiitors re modest nd trnsient, The Author(s) Open Access This rticle is distriuted under the terms of the Cretive Commons Attriution 4.0 Interntionl License ( which permits unrestricted use, distriution, nd reproduction in ny medium, provided you give pproprite credit to the originl uthor(s) nd the source, provide link to the Cretive Commons license, nd indicte if chnges were mde. The Cretive Commons Pulic Domin Dediction wiver ( pplies to the dt mde ville in this rticle, unless otherwise stted.
2 Deng et l. Journl of Experimentl & Clinicl Cncer Reserch (2018) 37:260 Pge 2 of 12 ndreusullyfollowedytherpidemergenceofdrug resistnce [1, 3, 6]. As compenstory prongiogenic fctors, such s PDGF nd FGF, ply key roles in mediting the resistnce to VEGF signling lockde therpy, multiple trgeted kinse inhiitors (TKIs) could circumvent the common prolem of rpid drug resistnce onset ecuse they simultneously lock severl signling pthwys [1, 3]. The development of multitrgeted TKIs is expected to comt this resistnce, however, there hve een few convincingly studies in the clinic to dte [1, 7]. Moreover, mrginl survivl enefits nd significnt toxicities ssocited with TKIs hve limited enthusism for this therpeutic pproch. Therefore, new strtegy to etter control tumor ngiogenesis remins much nticipted. Severl recent reports suggest tht immune stimultion cn lso restrict tumor ngiogenesis. Activted T cells hve een shown to decrese tumor vessel density, inhiit tumor endothelil cell prolifertion, nd/or rrest tumor lood flow [8 12], suggesting immune stimultors might hve the cpility to inhiit tumor ngiogenesis. Lentinn (LNT), iologiclly ctive compound extrcted from Lentinus edodes (L. edodes), is n immunopotentitor [13 15], nd exhiits multiple iologicl ctivities, including immunomodultory, nticteril, ntivirus, ntitumor effects, nd nti-inflmmtory [14, 16 19]. Although the comintion of LNT with TNP-470 (TNP), n ngiogenic inhiitor, displyed ntingiogenic effects nd promoted tumor cell poptosis [20], whether LNT ffects tumor ngiogenesis remins uncler. In this study, we evluted the effects of LNT on the tumor vsculture in LAP0297 lung crcinom nd CT26 colorectl crcinom. LNT tretments significntly reduced tumor vsculr function nd inhiited tumor growth. Moreover, long-term LNT tretments continuously suppressed tumor ngiogenesis nd exhiited ntitumor effects. Mechniclly, LNT inhiited tumor ngiogenesis vi IFNγ up-regultion, which ws ssocited with the ccumultion of tumorinfiltrting myeloid cells. Thus, this study demonstrtes the potentil of LNT to e served s novel ntingiogenic gent for long-term cncer tretments. Methods Mterils nd regents The Lentinn (LNT, 1 mg, ), gift from Nnjing Luye phrmceuticl Co., Ltd. (Nnjing, Chin), is provided s powder in penicillin ottle. LNT ws dissolved in sline (0.9% NCl) right efore in vivo dministrtion. Tumor models Femle FVB mice (6 8 weeks old) were red nd mintined in the gnotoiotic lortory niml center in Soochow University. Femle BALB/c nd nude mice (6 8 weeks old) were purchsed from the Shnghi Lortory Animl Center (Shnghi, Chin) nd the Vitl River Lortories (Beijing, Chin), respectively. All of the mice were housed in the specific pthogen-free (SPF) condition. FVB nd Bl/c mice were sucutneous (s.c.) inoculted with cells of LAP0297 or CT26 on the right flnks, respectively. When tumors reched 4 5 mm in dimeter, mice ering tumors were rndomly divided into pproprite groups nd sujected to Lentinn or sline (0.9% NCl) tretments. In the long-term tretment experiments, mice ering tumors were euthnized when tumor volume exceeded 1000 mm 3. Tumor volume (mm 3 ) ws estimted y using the following formul: tumor volume = (long xis) (short xis) 2 π/6. Cell lines The LAP0297 lung crcinom cell line ws generted y Dr. Peigen Hung t Msschusetts Generl Hospitl (Boston, USA) [21]. The CT26 tumor cell line ws purchsed from the Americn Type Culture Collection. Tumor cells were cultured in Dulecco s modified Egle s medium (DMEM) (GIBCO) supplemented with 10% het-inctivted fetl ovine serum (FBS) (GIBCO) nd 1% penicillin nd streptomycin (GIBCO) t 37 C in humid incutor contining 5% CO 2. Cell cultures were frequently monitored for mycoplsm contmintion, nd only mycoplsm-negtive cells were used for experiments. Tumor vsculr function nlysis The function of tumor lood vessels ws determined y nlyzing the intensity of Hoechst (Sigm), s descried previously [22]. Briefly, 5 min fter intrvenous injection of Hoechst (10 mg/kg), mice were systemiclly perfused with PBS, nd the tumors were removed nd fixed with 4% prformldehyde. This procedure leled functionl vessels with fluorescence of nucleus-ound Hoechst Mosic imges of tumors were tken using n Olympus FV1000 confocl lser-scnning microscope. A 20 ojective cquired μm tiles, nd n utomted stge scnned through the entire cross section of tumor tissue. The imged tiles were stitched into finl mosic imge using n Olympus softwre. Nonspecific nucler stining (Sytox green from Moleculr Proes) ws used to counter-stin the slides. In ech field, the intensities of CD31 nd Hoechst positive res were clculted using n Imge-Pro plus softwre (version 6.0). Immunohistochemistry Tumor tissue smples were fixed for 2 3 h in 4% prformldehyde, nd then incuted with 30% sucrose in PBS overnight t 4 C. The tissue smples were then emedded in opticl coherence tomogrphy (OCT) compound nd stored t 80 C. Frozen sections (20 μm) were incuted with primry rt nti-mouse CD31 ntiody (endothelil cell mrker, 1:100, Clone MEC13.3, Ct#: , BD
3 Deng et l. Journl of Experimentl & Clinicl Cncer Reserch (2018) 37:260 Pge 3 of 12 Biosciences) nd secondry Alex Fluor 647 donkey nti-rt IgG ntiody (1:200, Jckson ImmunoReserch) to stin endothelil cells. The slides were counter-stined for cell nuclei y Sytox Green (Moleculr Proes). Fluorescent imges were tken using n Olympus FV1000 confocl lser scnning microscopy. Four to six photogrphic res, excluding the tumor periphery, were rndomly tken from ech tumor tissue ( μm 2 ech). Men fluorescence intensity (MFI) of CD31 positive nd Hoechst stined res were clculted using n Imge-Pro plus softwre (version 6.0). Tue formtion ssys Tue formtion ssy ws used to evlute the effect of LNT on endothelil cells s descried previously with minor modifictions [23, 24]. Briefly, humn umilicl vein endothelil cells (HUVECs) were cultured in DMEM medium contining 10% FBS. Growth fctor reduced mtrigel mtrix (CORNING) ws plced in refrigertor (4 C) overnight to thw the mtrigel. Pltes (24-well) were coted with 100 μl/well of mtrigel mtrix nd were incuted t 37 C for 30 min to llow the gel to solidify. HUVECs (30,000 cells/well) were seeded onto the top of the gel nd were treted with different concentrtions of LNT for 12 h in triplicte t 37 C with 5% CO 2.The process of tue formtion ws monitored every 3 h nd the pictures were tken y using Box-Type Fluorescence Imging Device (OLYMPUS). The numers of the tues nd rnches in ech well were counted. Quntittive rel-time PCR Totl RNA from tumor tissues ws isolted y MicroElute Totl RNA kit (Omeg), followed y cdna synthesis with RevertAid First Strnd cdna Synthesis Kit (Thermo Scientific). The levels of relted mrna were determined y using high-throughput fluorescence quntittive PCR meter (LightCycler480 II) (Roche). The primers (Tle 1) were specificlly designed to void nonspecific mplifiction y one hlf hyridizing to the 3 end of oneexonndtheotherhlfhyridizingtothe5 end of the djcent exon. Bet-ctin ws used s reference gene to clculte the differences in gene expression (fold chnge). Flow cytometry nlysis Mice ering tumors were intrcrdilly perfused with PBS. Tumor tissues were isolted nd single cell suspensions were prepred y using the digesting DMEM medium contining collgense type 1A (1500 U/ml), hyluronidse (1000 U/ml) nd DNse (20 U/ml). Rt nti-mouse CD16/CD32 monoclonl ntiody ws dded into the single-cell suspensions efore other ntiody stining. After stining, cells were wshed with cold flow uffer (1% BSA, 0.1% NN 3 in PBS), nd 7AAD regent (ebioscience) ws dded (5 ul/tue) prior to running the Tle 1 Primers used for qpcr nlysis Gene Primer Sequence (5-3 ) β-ctin Forwrd ATCGTGCGTGACATCAAAGA ACAGGATTCCATACCCAAGAAG Cxcl9 Ifnγ Tnfα Ang1 Tsp1 Timp1 Forwrd Forwrd Forwrd Forwrd Forwrd Forwrd AGTGTGGAGTTCGAGGAACC GAGTCCGGATCTAGGCAGG CCAAGTTTGAGGTCAACAACCC GGGACAATCTCTTCCCCACC CCGATGGGTTGTACCTTGTC CGGACTCCGCAAAGTCTAAG ATGGAAAATTATACTCAGTGGCTGC ATTTAGTACCTGGGTCTCAACATC TGTCACTGCCAGAACTCGGTTA GGAGACCAGCCATCGTCAG GAGACACACCAGAGCAGATACC GCTGGTATAAGGTGGTCTCGT flow nlysis. For intrcellulr cytokine stining, 2 million cells were cultured in 12-well plte for 4 h with Brefeldin A(10 μg/ml, ebiosciences), nd then stined with the surfce ntiody mixture. After wshed, intrcellulr stining ws performed ccording to the mnufcturer s instructions of Fixtion/Permeiliztion Solution Kit (BD Bioscience). Flow cytometry dt were cquired on Gllios flow cytometer (Beckmn) nd nlyzed with Kluz softwre (version 1.3). The following fluorescence-leled or isotype-mtched nti-mouse ntiodies were used: Ly-6G-FITC, CD8-FITC, CD4-PE, NK1.1-APC-Cy7, Ly- 6C-PE, Gr1-APC-Cy7, IFNγ-PE-Cy7, nd IFNγ-APC (BD Biosciences); F4/80-APC, CD45-BV421, nd CD11-BV 510 (BioLegend). In vivo IFNγ neutrliztion When LAP0297 lung tumors reched 4 5 mm in dimeter, mice ering tumors were rndomly divided into four groups, which were treted with n isotype-mtched control rt IgG1 (clone HRPN, Bio-X Cell), 1 mg/kg LNT, 250 μg nti-ifnγ ntiody (clone XMG1.2, Bio-X Cell), or LNT plus n nti-ifnγ ntiody. LNT ws dministered into mice vi i.p. injection every 3 dys, while rt IgG1 or nti-ifnγ ntiody were given every 3 dys. The tretment durtion ws 10 dys. Enzyme-linked immunosorent ssy (ELISA) The concentrtions of ngiosttic fctors IFNγ, TNFα, CXCL9, Ang1, TSP1, nd TIMP1 in the tumor tissue lyste were mesured ccording to the mnufcturer s protocols y using the following mouse ELISA Kits: IFNγ (Ct#: DKW , Dkewe, Shnghi, Chin), TNFα (Ct#: DKW , Dkewe, Shnghi, Chin), CXCL9 (Ct#: 70-EK21432/2, MultiSciences, Hngzhou, Chin), Ang1 (Ct#: DL-ngpt1-mu-96 t), TIMP1 (Ct#: DL-timp1-mu-96 t), nd TSP1 (Ct#: DL-ths1-mu-96 t) from DLDEVELOP (Wuxi, Chin). Although different kits
4 Deng et l. Journl of Experimentl & Clinicl Cncer Reserch (2018) 37:260 Pge 4 of 12 hve different mesure protocols, the mjor procedure is similr. Here, we used IFNγ mesurement s n exmple of the ELISA method. Briefly, IFNγ stndrds, lnk control nd tested smples (100 μl/well) were dded into 96-well pltes. Then Biotinylted ntiody (50 μl/well) ws dded to ech well nd incuted t 37 C for 90 mins. After wshing wy unound Biotinylted ntiody, Streptvidin- HRP (100 μl/well) ws dded to ech well nd incuted for 30 mins. After wshing, TMB(100 μl/well) ws dded nd incuted t 37 C for 10 mins in the drk. The rection ws discontinued y the Stop solution nd the opticl density (OD) vlues were determined t the wvelength of 450 nm y microplte reder. The concentrtions of ngiosttic fctors were clculted using the stndrd curve s regression eqution derived from stndrd sornce vlues. Sttisticl nlysis Sttisticl nlyses were performed using Prism sttisticl softwre (version 6, GrphPd Softwre, Inc.). Unpired 2-tiled Student s t tests were used to determine the sttisticl differences etween two groups. One-wy nlysis of vrince (ANOVA) ws used to ssess the differences when more thn two groups were compred. Dt were presented s men ± stndrd error of the men (SEM). The results were considered s sttisticlly significnt t P < 0.05 (*). P vlues lower thn 0.01 or were indicted s ** or ***, respectively. Results LNT tretments exhiit etter tumor growth inhiition t reltively low dosge Tumor immune evsion nd tumor ngiogenesis re two hllmrks of cncer [2, 22, 25]. LNT hs een shown to suppress the growth of severl types of cncer nd the effects hve een lrgely ttriuted to immune stimultion [13, 14, 16, 18, 26, 27]. Whether LNT intervention influences tumor ngiogenesis remins uncler. To determine the impct of LNT on tumor ngiogenesis, we initilly evluted the dose effects of LNT tretments on LAP0297 lung crcinom. We treted tumor-ering mice with 0.25, 0.5, 1.0, 2.0, or 5.0 mg/kg LNT for 10 dys (Fig. 1). All tested dosges of LNT tretments inhiited LAP0297 lung tumor growth, however, reltively lower doses exhiited etter tumor control thn higher doses, suggesting tht LNT tretment inhiited tumor growth in n inverted U-shped dose-response mnner. Our dt showed tht the 1.0 mg/kg LNT tretments exhiited etter ntitumor effects, compred to the 5.0 mg/kg LNT tretments (Fig. 1-c). Bsed on these results, we chose 1.0 mg/kg s the stndrd LNT tretment dose for LAP0297 lung tumors in the rest of this study. This unique dose effect of LNT ws lso oserved in the CT26 colorectl cncer model, where 1.0 mg/kg LNT tretments inhiited tumor growth, ut 4.0 mg/kg LNT tretments did not ffect tumor growth, gin showing tht lower dose of LNT tretment hs etter ntitumor effects (Additionl file 1: Figure S1). Tken together, these dt show tht ppropritely lower doses of LNT tretments exhiit etter ntitumor effects, compred to those of higher doses. LNT tretments reduce tumor vsculr function in lung cncer We next investigted the effects of LNT tretments on tumor ngiogenesis. Vessel density is common prmeter to evlute the effects of n intervention on the tumor vsculture [22]. After 10 dys of LNT tretments in the LAP0297 lung cncer model, vessel density in ll of LNT-treted groups ws comprle to the control group, even though tumors were smller in LNT-treted groups when compred to the control group (Figs. 1 nd 2). We then nlyzed other prmeters to get more informtion out the tumor vsculture. Interestingly, we found tht LNT tretments suppressed tumor vsculr function in n inverted U-shped dose-response mnner (Fig. 2). A reltively lower tretment dose of LNT (1.0 mg/kg) exhiited stronger ntingiogenic effects, compred to reltively higher dose (5.0 mg/kg) (Fig. 2). Given tht the tumor microenvironment is highly heterogeneous nd tumor vessels re unevenly distriuted [28, 29], we next looked t the whole imges of the entire cross-sections of tumor tissues nd nlyzed the overll tumor vsculr function. Agin, the dt showed tht LNT tretments (1.0 mg/kg) decresed tumor vsculr function (Fig. 3). To evlute whether LNT tretments ffect lood vessels in norml tissues, we exmined lood vessels in colon tissues nd found tht LNT tretments didn t lter their vessel density or function (Additionl file 1: Figure S2). Consistent to the reduction in tumor vsculr function, the necrotic re in the LNT-treted group ws incresed compred to the control group (Additionl file 1: Figure S3). Tken together, our dt suggest tht LNT tretments suppress tumor ngiogenesis in the lung cncer model. LNT tretments suppress tumor vsculr function in colorectl cncer To determine whether the ntingiogenic effects of LNT tretments re tumor-type dependent, we treted mice ering CT26 colorectl cncer with LNT. Consistent with the effects seen in the LAP0297 lung cncer model, 10 dys of LNT tretments (1.0 mg/kg) inhiited CT26 tumor growth (Additionl file 1: Figure S1). We then nlyzed the effects of LNT tretments on tumor ngiogenesis. LNT tretments (1.0 mg/kg) significntly decresed the Ho33342 perfused tumor re, ut did not chnge the density of tumor lood vessels (Fig. 4). The
5 Deng et l. Journl of Experimentl & Clinicl Cncer Reserch (2018) 37:260 Pge 5 of 12 c Fig. 1 Lentinn (LNT) exhiits etter ntitumor effects t reltively lower dose compred with higher dose. Experimentl design: FVB mice were sucutneously (s.c.) inocultedwith LAP0297 lung cncer cells on the right flnk. When tumors reched 4 4 mm in dimeter, mice were rndomly divided into 6 groups nd received i.p. injection of different doses of LNT (0.25 mg/kg, 0.5 mg/kg, 1.0 mg/kg, 2.0 mg/kg, nd 5.0 mg/kg) dily for 10 dys. LAP0297 lung tumor-ering mice received different doses of LNT tretments. c Tumor weight ws mesured t the end of the tretments. NS: control group treted with sline. All dt in this report re presented s mens ± SEM. * p <0.05,**p < 0,01, *** p <0.001 c Fig. 2 LNT tretments reduce tumor vessel function in n inversed U-shped dose-response mnner. LAP0297 tumor ering mice were treted with different doses of LNT for 10 dys s descried in Fig. 1. Tumor tissues were sectioned nd stined with n nti-cd31 ntiody. Representtive figures showing tumor vessel density nd vsculr function in NS control nd LNT (1 nd 5 mg/kg) groups. The men fluorescence intensity (MFI) of CD31 (Red) nd Hoechst (Blue) stined res ws quntified. CD31 is n endothelil cell mrker. The intensity of Hoechst perfusion reflects the function of tumor vessels. ns: no significntly different, * p < 0.05, *** p <0.001
6 Deng et l. Journl of Experimentl & Clinicl Cncer Reserch (2018) 37:260 Pge 6 of 12 Fig. 3 The whole imges of tumor tissue cross-sections show reduced tumor vsculr function fter LNT tretments in LAP0297 lung cncer. LAP0297 tumor ering mice received sline or LNT tretments (1.0 mg/kg) for 10 dys s descried in Fig. 1. Tumor tissues were sectioned nd stined with n nti-cd31 ntiody. The proportions of endothelil cell re (CD31, Red) nd Hoechst (Blue) stined re over totl tumor tissue re were quntified. CD31 is n endothelil cell mrker. The intensity of Hoechst perfusion reflects the function of tumor vessels. *** p < dt show tht LTN tretments inhiit colorectl tumor vsculr function, indicting tht LNT cn e used s n ntingiogenic gent for colorectl cncer tretment. Long-term LNT tretments induce the regression of lung cncer Antingiogenic therpy is widely used in the clinic nd shows modest ntitumor efficcy in severl cncer types, such s NSCLC nd colorectl cncer. One crucil chllenge for ntingiogenic therpy is the emergence of rpid drug resistnce [1, 6, 29]. To determine the long-term ntingiogenic effect of LNT tretment, we continuously treted mice ering LAP0297 lung cncer with LNT (1.0 mg/kg) for 1 month. During the LNT tretment course, the size of LAP0297 lung cncers persistently reduced nd out 60% of tumors were completely regressed t the end of the tretment course (Fig. 5). We kept monitoring the tumor growth when LNT tretment ws terminted, nd found tht there ws no oserved LAP0297 lung tumor regrowth 2 weeks post the LNT tretment course, nd the percentge of tumor free mice reched 95% (Fig. 5). These results suggest tht long-lsting LNT tretments exhiit persistent ntitumor effects in the LAP0297 lung cncer model. LNT tretments upregulte the expression of ngiosttic fctors To understnd the mechnism of LNT inhiition ginst tumor ngiogenesis, we performed endothelil cell tue formtion ssys, nd found tht LNT tretments did not directly ffect endothelil cell tue formtion (Additionl file 1: Figure S4). We then nlyzed the trnscription of ngiogenesis-relted genes, nd found tht ngiosttic genes, including interferon γ (Ifnγ), tumor necrosis fctor α (Tnfα), chemokine (C-X-C motif) lignd 9 (Cxcl9), Timp1, nd Thromospondin 1 (Tsp1), were up-regulted in LNT-treted tumors, compred to control tumors (Additionl file 1: Figure S5). Moreover, we conducted ELISA to determine the protein levels of the ngiosttic fctors in the tumor microenvironment. The results demonstrted tht LNT tretments (1 mg/kg) elevted the protein levels of IFNγ, TNFα, CXCL9, nd TIMP1 (Additionl file 1: Figure S6). These dt collectively suggest tht LNT tretments induce the expression of ngiosttic fctors. LNT tretments increse IFNγ production in T cells nd myeloid cells Since IFNγ is often secreted y immune cell popultions upon stimultion, we next nlyzed the effects of LNT tretments on tumor-infiltrting immune cells. Flow cytometric nlysis showed tht LNT tretments fcilitted tumor infiltrtion of CD4+, CD8+, NK1.1+ cells, monocytes, nd neutrophils, while reducing tumor-ssocited mcrophges (TAMs) (Fig. 6). Intrcellulr stining further showed tht LNT tretments incresed the frctions of IFNγ-expressing T cells nd NK cells, s well s IFNγ-expressing monocytes nd neutrophils, ut not TAMs (Fig. 6). The dt suggest tht LNT tretments promote the ccumultion of IFNγ-expressing T cells nd myeloid cells.
7 Deng et l. Journl of Experimentl & Clinicl Cncer Reserch (2018) 37:260 Pge 7 of 12 c Fig. 4 LNT tretments significntly reduce tumor vsculr function in CT26 colorectl crcinom. CT26 colorectl crcinom cells ( ) were s.c. injected on the right flnk of BALB/c mice. When tumors reched 4 4 mm in dimeter, mice were rndomly divided into 2 groups nd received i.p. injection of sline or 1.0 mg/kg of LNT for 10 dys. Tumor vsculr prmeters were determined s descried in Fig. 2. Representtive figures showed tumor vessel density nd vsculr function. The quntifictions of MFI of Hoechst33342 perfused tumor res in sline (NS) or LNT treted tumors. c The MFI of tumor vessel density in sline or LNT treted tumors. ** p <0.01 IFNγ is required for LNT tretment to reduce tumor vsculr function Previous studies hve suggested tht IFNγ-expressing T cells could suppress tumor ngiogenesis [8, 12]. Together with the reports tht LNT is commonly used s n immune modultor, nd tht T cells re often mjor ntitumor immune effector cells [13, 14, 18, 28], we thus tested whether LNT exerts its ntingiogenic effects through T cells. We inoculted LAP0297 lung cncer cells in nude mice nd then treted mice with 1.0 mg/kg LNT for 10 dys s did in immune competent mice (Fig. 1). We found tht LNT tretments inhiited the growth of LAP0297 lung cncer in nude mice (Additionl file 1: Figure S7), ut the degree of inhiition ws less thn tht in immune competent mice (Fig. 1), indicting tht T cells contriute to the inhiition of tumor growth y LNT tretments. This is consistent with the immunopotentition of LNT. We lso nlyzed tumor vessels, nd found tht LNT tretments suppressed tumor vsculr function in nude mice (Fig. 7), nd tht the degree of suppression ws comprle to those of immune competent mice (Fig. 2). LNT tretments lso slightly reduced tumor vessel density (Fig. 7), which ws not oserved in immune competent mice (Fig. 2). These dt suggest tht LNT tretments inhiit tumor ngiogenesis in T cell-independent mnner. A recent study demonstrted tht elevted levels of IFNγ rrested tumor lood flow without ffecting tumor endothelil cell prolifertion nd poptosis [10]. To further explore the reltionship etween IFNγ nd LNT tretment, we tested whether IFNγ is responsile for the oserved LNT-medited suppression of vsculr function. In vivo neutrliztion of IFNγ prtilly reversed the inhiition of tumor growth y LNT tretments compred with the control group, while IFNγ neutrliztion lone hd little effect on tumor growth (Fig. 8-). Consistent with previous dt, LNT tretments lone reduced tumor vsculr function, nd IFNγ neutrliztion negted the effect of LNT tretments on tumor vsculr function, indicting tht IFNγ medites the impct of LNT tretments on tumor vsculr function (Fig. 8). Tken together, these dt suggest tht LNT tretments
8 Deng et l. Journl of Experimentl & Clinicl Cncer Reserch (2018) 37:260 Pge 8 of 12 c Fig. 5 Long-term LNT tretments induce regression of LAP0297 lung cncer. LAP0297 tumor ering mice were prepred s descried in Fig. 1. When tumors reched 4 4 mm in dimeter, mice were rndomly divided into 2 groups nd received i.p. injection of sline or LNT (1.0 mg/kg) for 1 month. Representtive photogrphs of LAP0297 lung cncer-ering mice in sline nd LNT-treted group were tken t the end of the experiment. The growth curves of LAP0297 lung cncer upon long-term therpy of sline or LNT. c The percentge of tumor free mice on dy 45 fter tumor inocultion (NS group, n = 17 mice, LNT-treted group, n = 24 mice). *** p < suppress tumor ngiogenesis vi IFNγ nd in T cell-independent mnner, which is correlted with n increse in IFNγ-expressing myeloid cells. Discussion Tumor initition nd progression relies on the formtion of new lood vessels. Thus, the disruption of tumor lood vessels hs the potentil to inhiit tumor growth. However, the clinicl enefits of ntingiogenic therpies re often in the order of weeks nd rpidly developed drug resistnce limits its long-term ppliction [1, 6, 29]. In this study, we found tht oth of T cells nd IFNγ production contriute to tumor growth inhiition induced y LNT tretments, wheres IFNγ, ut not T cells, Fig. 6 LNT tretments promote tumor infiltrtion of IFNγ-expressing T cells nd myeloid cells. LAP0297 tumor ering mice were prepred nd then treted with sline or 1.0 mg/kg LNT for 10 dys s descried in Fig. 1. Tumor tissues were isolted nd single cell suspensions were prepred for flow nlysis. Tumor infiltrtion of T cells nd myeloid cells. The proportions of IFNγ-expressing T cells nd myeloid cells in LAP0297 tumor tissues upon sline or LNT tretments. * p < 0.05, ** p < 0,01, *** p < 0.001
9 Deng et l. Journl of Experimentl & Clinicl Cncer Reserch (2018) 37:260 Pge 9 of 12 c Fig. 7 LNT tretments reduce tumor vsculr function in LAP0297 lung cncer in nude mice. Nude mice were s.c. inoculted with LAP0297 lung cncer cells on the right flnk. When tumors reched 4 4 mm in dimeter, mice were rndomly divided into 2 groups nd received i.p. injection of sline or 1.0 mg/kg of LNT for 10 dys. Tumor vsculr prmeters were determined s descried in Fig. 2. Representtive figures showing tumor vessel density nd function. The MFI of Hoechst33342 perfused tumor res nd the MFI of tumor vessel density c in sline or LNT treted tumors. ** p < 0.01, *** p <0.001 is required for the LNT-medited ntingiogenic effect. Moreover, prolonged LNT tretments persistently suppressed tumor ngiogenesis nd reduced tumor volume. These results suggest tht LNT could e served s new ntingiogenic gent nd my e suitle for long-term intervention. LNT is polyscchride from the fruit ody of L. edodes nd hs een used previously s iologicl response modifier [14, 15, 30]. In prticulr, LNT hs een pproved s n djuvnt for the tretment of gstric cncer nd rought clinicl enefits to cncer ptients [16, 31, 32]. LNT hs demonstrted its ntitumor effects in oth primry nd trnsplnted tumor models with negligile side effects [17, 33, 34]. Our dt further suggest tht LNT tretments decrese tumor vsculr function, ut do not ffect vsculr function in norml tissues. Such difference effects could e due to the fct tht LNT tretments suppress tumor ngiogenesis vi incresing IFNγ production, which is ssocited with the ccumultion of IFNγ-expressing neutrophils. Norml tissues usully contin few neutrophils nd will show miniml effects y LNT tretments. In ddition, LNT could llevite side toxicities of chemotherpeutic gents nd potentilly improve their efficcy [26, 35]. The sfety profiles of LNT s well s its ility to overcome the side effects of chemotherpy is superior to currently used trditionl ntingiogenic drugs, providing new rtionles for developing LNT s n ntingiogenic gent. Blood vessel formtion is tightly regulted y pro- nd nti-ngiogenic fctors. The relentless production of pro-ngiogenic fctors promotes tumor vessel formtion [3, 29]. Thus ntingiogenic therpy is usully designed to suppress pro-ngiogenic fctors nd inhiit tumor progression [1, 3]. Currently, ntingiogenic gents re used in the tretments of vrious types of solid cncers, such s NSCLC nd colorectl cncer [1, 3]. Therefore, we chose LAP0297 lung crcinom nd CT26 colorectl cncer s tumor models to evlute the effects of LNT tretments on tumor ngiogenesis. Although ntingiogenic therpy improves chemotherpy in severl cncer types, the clinicl enefits re mrginl. One of the criticl resons is the development of drug resistnce. Some tumors re intrinsic resistnce to ntingiogenic therpy [3, 29]. Some tumors respond to ntingiogenic therpy
10 Deng et l. Journl of Experimentl & Clinicl Cncer Reserch (2018) 37:260 Pge 10 of 12 c d Fig. 8 Anti-IFN-γ ntiody tretments reverse the effects of LNT tretments on tumor vessels in LAP0297 lung cncer. LAP0297 tumor ering mice were prepred s descried in Fig. 1. When tumors reched 4 4 mm in dimeter, mice were rndomly divided into 4 groups nd received i.p. injection of HRPN, LNT (1.0 mg/kg), nti-ifn-γ ntiody (250 μg/mouse) or LNT plus nti-ifn-γ ntiody for 10 dys. Tumor vsculr prmeters were determined s descried in Fig. 2. nd The growth curves nd weight of LAP0297 tumors treted with HRPN, LNT, nti-ifn-γ ntiody, or the comintion of LNT nd nti-ifn-γ ntiody. c Representtive figures showing tumor vsculr function nd vessel density. d The quntifictions of Hoechst33342 perfused tumor res nd tumor vessel density. ns: no significntly different, * p < 0.05, ** p < 0.01, *** p < t the eginning, ut develop drug resistnce lter on [1]. With ntingiogenic tretments eing susceptile to the development of drug resistnce, it is significnt tht we treted LAP0297 lung crcinom with LNT for 1 month nd did not oserved drug resistnce. Gene trnscription nd protein expression dt showed tht LNT tretments upregulted the levels of IFNγ, TNFα, CXCL9, nd TIMP1. Among them, TIMP1 is n intrinsic ngiosttic fctor, while IFNγ, TNFα, nd CXCL9 re immune effector molecules with potent ngiosttic ctivities. Whether or not elevted endogenous ngiosttic fctors will e less likely to cuse drug resistnce is not known, ut the phenomenon is very interesting nd worth further investigtions. Therpeutic ntitumor drugs often suppress tumor growth in dose-dependent mnner. In generl, higher dosges show etter ntitumor effect thn tht of lower dosges. The optiml therpeutic dosge is usully determined y the efficcy nd toxicity of the drug. Interestingly, LNT inhiited tumor growth in n inversed U-shped dose-response mnner. Appropritely lower dose of LNT (such s 1.0 mg/kg) showed etter ntitumor efficcy thn tht of higher dose (such s 5.0 mg/kg). The exct underlying mechnism of this ction is unknown. It could e due to the nti-ngiogenic effects of LNT tretments. Our dt showed tht reltively lower dose of LNT tretments (such s 1.0 mg/kg) more potently reduced tumor vsculr function thn tht of reltively higher dose (such s 5.0 mg/kg). Furthermore, our study suggests tht LNT tretments (1.0 mg/kg) inhiit tumor vsculr function vi IFNγ production nd in T cell-independent mnner. In ddition, LNT tretments (1.0 mg/kg) up-regulted IFNγ production in severl tumor-infiltrting myeloid cell popultions. It is possile tht the optiml tretment dose of LNT could e different for different popultions of immune cells. The optiml tretment dose of LNT on specific popultion of immune cells with respect to their quntity nd function could e lso different. Indeed, the 1.0 mg/kg tretment of LNT, ut not the 5.0 mg/kg tretment of LNT, incresed tumor infiltrtion of neutrophils (Additionl file 1: Figure S8), which is the most undnt tumor-infiltrting myeloid cell popultion in LAP0297 lung crcinom (Fig. 6). Therefore, the optiml ntitumor effects of LNT tretments seem to depend on the lnce of vessel modultion nd immune stimultion upon LNT tretments. Since LNT tretment inhiits tumor growth in n inversed U-shped dose-response mnner, however, the lower or higher dose of LNT is reltive nd could e difficult to determine. This is n even igger chllenge in
11 Deng et l. Journl of Experimentl & Clinicl Cncer Reserch (2018) 37:260 Pge 11 of 12 the clinic ecuse different ptients nd different cncer types my hve different sensitivities to LNT tretments. Our previous work suggests tht monitoring vsculr function could e used to predict the efficcy of immune checkpoint therpy [36]. In this study, our findings showed tht reltively lower dose of LNT tretments ws more powerful thn higher dose in decresing tumor vessel perfusion. Given tht rdiologicl methods hve een developed to noninvsively mesure vessel perfusion during nti-ngiogenic therpy in the clinic [37, 38], it is conceivle tht vessel perfusion monitoring could e dpted to determine the optiml dosge of LNT tretment. LNT hs een pplied in some kinds of cncer tretments. Its ntitumor effects re usully considered to e the result of its immune stimultion. Severl recent studies suggested tht LNT could induce tumor cell poptosis, showing directly ntitumor effect [30, 39]. By using lung nd colorectl cncer models, we showed tht LNT tretments inhiited tumor ngiogenesis vi incresed IFNγ production in T cell-independent mnner. Tken together, LNT could ffect tumor growth vi multiple different mechnisms, including the modultion of immune system, the induction of tumor cell poptosis [13, 14, 16, 18, 30, 39], nd the suppression of tumor ngiogenesis. Conclusions LNT tretments reduced tumor vsculr perfusion nd inhiited tumor growth in n inverted U-shped dose-response mnner. Furthermore, long-term LNT tretments continuously suppressed tumor ngiogenesis nd exhiited ntitumor effects in LAP0297 lung tumor model. Mechniclly, LNT decresed tumor vsculr function y incresing IFNγ production nd in T cell-independent mnner, which ws ssocited with the ccumultion of tumor-infiltrting myeloid cells. Thus, this study suggests tht LNT could e served s new ntingiogenic gent for long-term cncer tretments. Additionl file Additionl file 1: Methods: CT26 colorectl crcinom cells (4x10 5 )or LAP0297 lung crcinom cells (2x10 5 ) were s.c. injected on the right flnk of BALB/c or FVB mice, respectively. When tumors reched 4 4 mm in dimeter, mice were rndomly divided into 2 groups nd received i.p. injection of sline (NS) or 1.0 mg/kg of LNT dily for 10 dys. At the end of the tretments, tumor tissues were isolted, sectioned, nd stined y n nti-cd31 ntiody (endothelil cells). The proportions of endothelil cell re (CD31, Red) nd Hoechst (Blue) perfused re over totl tumor tissue re were quntified. SYTOX Green (Green) ws used to lel totl cells. All dt in the Additionl file 1 re presented s mens ± SEM. * p<0.05, ** p<0.01, *** p<0.001, nd ns designtes no significnt difference. Fig. S1 LNT tretments inhiit tumor growth of CT26 colorectl crcinom. The experimentl design of CT26 colorectl tumor model. The growth curves nd weight of CT26 colon tumors treted with sline or LNT. Fig. S2 LNT tretments do not ffect the vsculture in norml colon tissues in LAP0297 tumor-ering mice. Fig. S3 LNT tretments increse necrotic re. LAP0297 tumor tissues were sectioned nd SYTOX Green (Green) ws used to lel tumor tissue cells. Necrotic cells were reltively smll, dense, nd round. Fig. S4 LNT tretments do not ffect endothelil cell tue formtion in vitro. HUVECs were seeded on the top of growth fctor reduced mtrigel in 24-well plte, nd then incuted with different concentrtions of LNT. The process of tue formtion ws monitored every 3 hrs nd pictures were tken t 12 hrs fter incution with LNT. The tues nd rnches in ech well were counted. Fig. S5 LNT tretments upregulte the trnscription of ngiosttic fctors, such s Ifnγ, Tnfα, Cxcl9, Ang1, Timp1,ndTsp1, in LAP0297 tumor tissues. Fig. S6 LNT tretments increse the expression of ngiosttic fctors, such s IFNγ,TNFα,CXCL9,Ang1,TIMP1, nd TSP1, in LAP0297 tumor tissues. Fig. S7 LNT tretments inhiit tumor growth of LAP0297 lung cncer in nude mice. Nude mice were s.c. injected with LAP0297 lung cncer cells on the right flnk nd tretments were performed s descried in the ove methods. Tumor sizes were mesured every three dys. Fig. S8 Reltively lower dose of LNT tretments (1 mg/kg), ut not higher dosge (5 mg/kg), promotes the tumorl ccumultion of neutrophils. LAP0297 tumor tissues were isolted nd single cell suspensions were prepred. The tumor infiltrtion of leukocytes (CD45), neutrophils (Gr1 hi ), nd TAMs were determined y flow nlysis. (ZIP 7212 k) Arevitions CXCL9: Chemokine (C-X-C motif) lignd 9; FGF: Firolst growth fctor; IFNγ: Interferon gmm; LNT: Lentinn; NSCLC: Non-smll cell lung cncer; PDGF: Pltelet-derived growth fctor; PlGF: Plcentl growth fctor; TIMP1: TIMP metllopeptidse inhiitor 1; TKI: Multiple trgeted kinse inhiitors; TNFα: Tumor necrosis fctor lph; TSP1: Thromospondin 1; VEGF: Vsculr endothelil growth fctor Acknowledgments The uthors thnk Dr. Wen Jing of MD Anderson Cncer Center for criticl reding nd comments. Funding This work ws supported in prt y grnts from the Ntionl Nturl Science Foundtion of Chin ( , ), the fund of the Distinguished Professors of Jingsu Province (SR ), the Collortive Innovtion Center of Hemtology, nd the Priority Acdemic Progrm Development of Jingsu Higher Eduction Institutions. Avilility of dt nd mterils All dt generted or nlyzed during this study re included in this pulished rticle. Authors contriutions YH, QW, nd GZ designed experiments, nlyzed dt nd wrote the mnuscript; SD, JK, PF, XW, ZP, DY, XZ, nd XL performed experiments nd nlyzed dt. QW nd YH supervised the study. All uthors red nd pproved the finl mnuscript. Ethics pprovl All niml works were pproved y the Institutionl Lortory Animl Cre nd Use Committee of Soochow University. All of the procedures were performed in complince with the Animl Cre nd Use Regultions of Chin. Consent for puliction Not pplicle. Competing interests The uthors declre tht they hve no competing interests. Pulisher s Note Springer Nture remins neutrl with regrd to jurisdictionl clims in pulished mps nd institutionl ffilitions. Author detils 1 Cyrus Tng Hemtology Center, Collortive Innovtion Center of Hemtology, Stte Key Lortory of Rdition Medicine nd Prevention, Soochow University, 199 Ren-Ai Rod, Suzhou , Jingsu, Chin. 2 Nnjing Luye Phrmceuticl Co., Ltd, Nnjing , Jingsu, Chin.
12 Deng et l. Journl of Experimentl & Clinicl Cncer Reserch (2018) 37:260 Pge 12 of 12 3 Deprtment of Trditionl Chinese Medicine, Peking Union Medicl College Hospitl, Peking Union Medicl College nd Chinese Acdemy of Medicl Sciences, No. 1 Shuifuyun, Dongcheng District, Beijing , Chin. Received: 1 April 2018 Accepted: 17 Octoer 2018 References 1. Hung Y, Crone DP. Mechnisms of nd strtegies for overcoming resistnce to nti-vsculr endothelil growth fctor therpy in non-smll cell lung cncer. Biochim Biophys Act. 2015;1855: Hnhn D, Weinerg RA. Hllmrks of cncer: the next genertion. Cell. 2011;144: Crmeliet P, Jin RK. Moleculr mechnisms nd clinicl pplictions of ngiogenesis. Nture. 2011;473: Sndler A, Gry R, Perry MC, Brhmer J, Schiller JH, Dowlti A, Lilenum R, Johnson DH. Pclitxel-cropltin lone or with evcizum for nonsmll-cell lung cncer. N Engl J Med. 2006;355: Folkmn J. Tumor ngiogenesis: therpeutic implictions. N Engl J Med. 1971;285: Prk JS, Kim IK, Hn S, Prk I, Kim C, Be J, Oh SJ, Lee S, Kim JH, Woo DC, He Y, Augustin HG, Kim I, Lee D, Koh GY. Normliztion of tumor vessels y Tie2 ctivtion nd Ang2 inhiition enhnces drug delivery nd produces fvorle tumor microenvironment. Cncer Cell. 2017;31: Jnne PA, Gry N, Settlemn J. Fctors underlying sensitivity of cncers to smll-molecule kinse inhiitors. Nt Rev Drug Discov. 2009;8: Betty G, Pterson Y. IFN-gmm-dependent inhiition of tumor ngiogenesis y tumor-infiltrting CD4+ T cells requires tumor responsiveness to IFN-gmm. J Immunol. 2001;166: Hykw Y, Tked K, Ygit H, Smyth MJ, Vn Ker L, Okumur K, Siki I. IFN-gmm-medited inhiition of tumor ngiogenesis y nturl killer T- cell lignd, lph-glctosylcermide. Blood. 2002;100: Kmmertoens T, Friese C, Arin A, Idel C, Briesemeister D, Rothe M, Ivnov A, Szymorsk A, Ptone G, Kunz S, Sommermeyer D, Engels B, Leisegng M, Textor A, Fehling HJ, Fruttiger M, Lohoff M, Herrmnn A, Yu H, Weichselum R, Uckert W, Hüner N, Gerhrdt H, Beule D, Schreier H, Blnkenstein T. Tumour ischemi y interferon-gmm resemles physiologicl lood vessel regression. Nture. 2017;545: Tin L, Goldstein A, Wng H, Ching Lo H, Sun Kim I, Welte T, Sheng K, Dorolecki LE, Zhng X, Putluri N, Phung TL, Mni SA, Stossi F, Sreekumr A, Mncini MA, Decker WK, Zong C, Lewis MT, Zhng XH. Mutul regultion of tumour vessel normliztion nd immunostimultory reprogrmming. Nture. 2017;544: Hung Y, Kim BYS, Chn CK, Hhn SM, Weissmn IL, Jing W. Improving immune-vsculr crosstlk for cncer immunotherpy. Nt Rev Immunol. 2018;18(3): Mtsuok H, Seo Y, Wksugi H, Sito T, Tomod H. Lentinn potentites immunity nd prolongs the survivl time of some ptients. Anticncer Res. 1997;17: In K, Ktok T, Ando T. The use of lentinn for treting gstric cncer. Anti Cncer Agents Med Chem. 2013;13: Xu X, Yn H, Tng J, Chen J, Zhng X. Polyscchrides in Lentinus edodes: isoltion, structure, immunomodulting ctivity nd future prospective. Crit Rev Food Sci Nutr. 2014;54: Ren L, Perer C, Hemr Y. Antitumor ctivity of mushroom polyscchrides: review. Food Funct. 2012;3: Sug T, Shiio T, Med YY, Chihr G. Antitumor ctivity of lentinn in murine syngeneic nd utochthonous hosts nd its suppressive effect on 3-methylcholnthrene-induced crcinogenesis. Cncer Res. 1984;44: Zhou LD, Zhng QH, Zhng Y, Liu J, Co YM. The shiitke mushroomderived immuno-stimulnt lentinn protects ginst murine mlri loodstge infection y evoking dptive immune-responses. Int Immunophrmcol. 2009;9: Isrilides C, Kletss D, Arpoglou D, Philippoussis A, Prtsinis H, Eringerov A, Hrilov V, Hrding SE. In vitro cytosttic nd immunomodultory properties of the medicinl mushroom Lentinul edodes. Phytomedicine. 2008;15: Sno B, Sugiym Y, Kunied K, Sno J, Sji S. Antitumor effects induced y the comintion of TNP-470 s n ngiogenesis inhiitor nd lentinn s iologicl response modifier in rit spontneous liver metstsis model. Surg Tody. 2002;32: Hung P, Dud DG, Jin RK, Fukumur D. Histopthologic findings nd estlishment of novel tumor lines from spontneous tumors in FVB/N mice. Comp Med. 2008;58: Hung Y, Yun J, Righi E, Kmoun WS, Ancukiewicz M, Nezivr J, Sntosuosso M, Mrtin JD, Mrtin MR, Vinello F, Vinello F, Lelnc P, Munn LL, Hung P, Dud DG, Fukumur D, Jin RK, Poznnsky MC. Vsculr normlizing doses of ntingiogenic tretment reprogrm the immunosuppressive tumor microenvironment nd enhnce immunotherpy. Proc Ntl Acd Sci U S A. 2012;109: Bodnr RJ, Ytes CC, Wells A. IP-10 locks vsculr endothelil growth fctor-induced endothelil cell motility nd tue formtion vi inhiition of clpin. Circ Res. 2006;98: Wng D, Wng H, Brown J, Dikoku T, Ning W, Shi Q, Richmond A, Strieter R, Dey SK, DuBois RN. CXCL1 induced y prostglndin E2 promotes ngiogenesis in colorectl cncer. J Exp Med. 2006;203: Hung Y, Lin L, Shnker A, Mlhotr A, Yng L, Dikov MM, Crone DP. Resuscitting cncer immunosurveillnce: selective stimultion of DLL1- notch signling in T cells rescues T-cell function nd inhiits tumor growth. Cncer Res. 2011;71: Higshi D, Seki K, Ishishi Y, Egw Y, Kog M, Sski T, Hirno K, Mikmi K, Futmi K, Mekw T, Sudo M. The effect of lentinn comintion therpy for unresectle dvnced gstric cncer. Anticncer Res. 2012;32: Yoshino S, Nishikw K, Morit S, Tkhshi T, Skt K, Ngo J, Nemoto H, Murkmi N, Mtsud T, Hsegw H, Shimizu R, Yoshikw T, Osni H, Imno M, Nitoh H, Tnk A, Tjiri T, Gochi A, Suzuki M, Skmoto J, Sji S, Ok M. Rndomised phse III study of S-1 lone versus S-1 plus lentinn for unresectle or recurrent gstric cncer (JFMC ). Eur J Cncer. 2016; 65: Hung Y, Goel S, Dud DG, Fukumur D, Jin RK. Vsculr normliztion s n emerging strtegy to enhnce cncer immunotherpy. Cncer Res. 2013; 73: Jin RK. Antingiogenesis strtegies revisited: from strving tumors to lleviting hypoxi. Cncer Cell. 2014;26: Wng J, Li W, Hung X, Liu Y, Li Q, Zheng Z, Wng K. A polyscchride from Lentinus edodes inhiits humn colon cncer cell prolifertion nd suppresses tumor growth in thymic nude mice. Oncotrget. 2017;8: O K, Koyshi M, Mtsui T, Koder Y, Skmoto J. Individul ptient sed met-nlysis of lentinn for unresectle/recurrent gstric cncer. Anticncer Res. 2009;29: Chihr G, Med Y, Hmuro J, Sski T, Fukuok F. Inhiition of mouse srcom 180 y polyscchrides from Lentinus edodes (Berk.) sing. Nture. 1969;222: Fujimoto K, Tomong M, Goto S. A cse of recurrent ovrin cncer successfully treted with doptive immunotherpy nd lentinn. Anticncer Res. 2006;26: Hmuro J. Anticncer immunotherpy with perorlly effective lentinn. Gn To Kgku Ryoho. 2005;32: Zhng L, Ji Q, Ni ZH, Sun J. Prohiitin induces poptosis in BGC823 gstric cncer cells through the mitochondril pthwy. Asin Pc J Cncer Prev. 2012;13: Zheng X, Fng Z, Liu X, Deng S, Zhou P, Wng X, Zhng C, Yin R, Hu H, Chen X,, Hn Y, Zho Y, Lin SH, Qin S, Wng X, Kim BY, Zhou P, Jing W, Wu Q, Hung Y: Incresed vessel perfusion predicts the efficcy of immune checkpoint lockde. J Clin Invest 2018, 128: Btchelor TT, Gerstner ER, Emlem KE, Dud DG, Klpthy-Crmer J, Snuderl M, Ancukiewicz M, Polskov P, Pinho MC, Jennings D, Plotkin SR, Chi AS, Eichler AF, Dietrich J, Hocherg FH, Lu-Emerson C, Ifrte AJ, Ivy SP, Rosen BR, Loeffler JS, Wen PY, Sorensen AG, Jin RK. Improved tumor oxygention nd survivl in gliolstom ptients who show incresed lood perfusion fter cedirni nd chemordition. Proc Ntl Acd Sci U S A. 2013;110: Emlem KE, Mouridsen K, Bjornerud A, Frrr CT, Jennings D, Borr RJ, Wen PY, Ivy P, Btchelor TT, Rosen BR, Jin RK, Sorensen AG. Vessel rchitecturl imging identifies cncer ptient responders to nti-ngiogenic therpy. Nt Med. 2013;19: Gu YH, Belury MA. Selective induction of poptosis in murine skin crcinom cells (CH72) y n ethnol extrct of Lentinul edodes. Cncer Lett. 2005;220:21 8.
SUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationSYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT
Finl Arevited Clinicl Study Report Nme of Sponsor/Compny: Bristol-Myers Squi Ipilimum Individul Study Tle Referring to the Dossier (For Ntionl Authority Use Only) Nme of Finished Product: Yervoy Nme of
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationCheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer
CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn
More informationPNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :
PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationDR. MARC PAGÈS Project Manager R&D Biologicals - Coccidia Projects, HIPRA
DR. MARC PAGÈS Project Mnger R&D Biologicls - Coccidi Projects, HIPRA Dr. Mrc Pgès Bosch otined Microiology nd Genetics degree t the University of Brcelon in 1998. He otined his PhD working on the synptoneml
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationInhibition of hypoxia-inducible factor via upregulation of von Hippel-Lindau protein induces angiogenic switch off in a hepatoma mouse model
Cittion: Moleculr Therpy Oncolytics (215) 2, 152; doi:1.138/mto.215.2 All rights reserved 2372-775/15 www.nture.com/mto ARTICLE Inhiition of hypoxi-inducile fctor vi upregultion of von Hippel-Lindu protein
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationEffects of Sini San used alone and in combination with fluoxetine on central and peripheral 5-HT levels in a rat model of depression
Online Sumissions:http://www.journltcm.com J Trdit Chin Med 2013 Octoer 15; 33(5): 674-681 info@journltcm.com ISSN 0255-2922 2013 JTCM. All rights reserved. EXPERIMENTAL STUDY TOPIC Effects of Sini Sn
More informationElectronic Supplementary Information for:
Electronic Supplementry Mteril (ESI) for ChemComm. This journl is The Royl Society of Chemistry 214 Electronic Supplementry Informtion for: Gold nnoprticles functionlized with cresyl violet nd porphyrin
More informationTMPYP4 exerted antitumor effects in human cervical cancer cells through activation of p38 mitogen activated protein kinase
Cheng nd Co Biol Res (27) 5:24 DOI.86/s4659-7-29-4 Biologicl Reserch RESEARCH ARTICLE Open Access TMPYP4 exerted ntitumor effects in humn cervicl cncer cells through ctivtion of p38 mitogen ctivted protein
More informationSignificance of Expression of TGF- in Pulmonary Metastasis in Non-small Cell Lung Cancer Tissues
Originl Article Significnce of Expression of in Pulmonry Metstsis in Non-smll Cell Lung Cncer Tissues Hisshi Sji, Hruhiko Nkmur, Idiris Awut, Norihito Kwski, Msru Hgiwr, Akihiko Ogt, Mkoto Hosk, Tkmoto
More informationMicrotubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationWSU Tree Fruit Research and Extension Center, Wenatchee (509) ext. 265;
FINAL REPORT WTFRC Project # AH-1-5 WSU Project # 13C-355-3 Project title: PI: Orgniztion: Coopertors: of Sunburn in Apples with RAYNOX Lrry Schrder, Horticulturist WSU Tree Fruit Reserch nd Extension
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationJournal of Hainan Medical University.
132 Journl of Hinn Medicl University 2017; 23(11): 132-136 Journl of Hinn Medicl University http://www.hnykdxxb.com Assessment of the efficcy nd sfety of bronchil rtery perfusion chemotherpy combined with
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationEffect of fungicide timing and wheat varietal resistance on Mycosphaerella graminicola and its sterol 14 α-demethylation-inhibitorresistant
Effect of fungicide timing nd whet vrietl resistnce on Mycospherell grminicol nd its sterol 14 α-demethyltion-inhiitorresistnt genotypes Didierlurent L., Roisin-Fichter C., Snssené J., Selim S. Pltform
More informationSupplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells
Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationHidenori Takahashi, *,1 Satoru Ebihara, 1 Tatsuma Okazaki, 1 Masanori Asada, 1 Hidetada Sasaki & 1 Mutsuo Yamaya. Introduction. Sendai , Japan
British Journl of Phrmcology (5) 16, 333 33 & 5 Nture Pulishing Group All rights reserved 7 1188/5 $3. www.nture.com/jp A comprison of the effects of unfrctionted heprin, dlteprin nd dnproid on vsculr
More informationEffects of blueberries on migration, invasion, proliferation, the cell cycle and apoptosis in hepatocellular carcinoma cells
BIOMEDICAL REPORTS 5: 579-584, 2016 Effects of blueberries on migrtion, invsion, prolifertion, the cell cycle nd poptosis in heptocellulr crcinom cells WEI ZHAN 1*, XIN LIAO 2*, LEI YU 3, TIAN TIAN 3,
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationEnhanced Chemopreventive Effect by Combining Quercetin and Green tea in Prostate Cancer
Enhnced Chemopreventive Effect y Comining Quercetin nd Green te in Prostte Cncer Piwen Wng, MD, PhD Assistnt Professor, Division of Cncer Reserch nd Trining Chrles R. Drew University of Medicine nd Science
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
More informationOne of the most important biological mechanisms of
Brief Report Serum Thymidine Kinse 1 Activity in the Prognosis nd Monitoring of Chemotherpy in Lung Cncer Ptients: A Brief Report Benjmin Nismn, PhD,* Hovv Nechushtn, MD, PhD,* Him Birn, MD, Hds Gntz-Sorotsky,
More informationA case of pulmonary adenocarcinoma showing rapid progression of peritoneal dissemination after immune checkpoint inhibitor therapy
Shinozki et l. BMC Cncer (2018) 18:620 https://doi.org/10.1186/s12885-018-4549-5 CASE REPORT A cse of pulmonry denocrcinom showing rpid progression of peritonel dissemintion fter immune checkpoint inhiitor
More informationMicroRNA 17 5p induces drug resistance and invasion of ovarian carcinoma cells by targeting PTEN signaling
DOI 1.1186/s479-15-35-2 RESEARCH Open Access MicroRNA 17 5p induces drug resistnce nd invsion of ovrin crcinom cells y trgeting PTEN signling Ying Fng 1,2, Chngyn Xu 3 nd Yn Fu 1* Astrct Bckground: The
More informationPolarization of tumor-associated macrophage is associated with tumor vascular normalization by endostatin
Thorcic Cncer ISSN 1759-7706 ORIGINAL ARTICLE Polriztion of tumor-ssocited mcrophge is ssocited with tumor vsculr normliztion y endosttin Qin Peng 1 *, Mei Li 1 *, Zi Wng 1, Ming Jing 1,XiYn 1, Song Lei
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationHistone H2AX is integral to hypoxia-driven neovascularization
Histone H2AX is integrl to hypoxi-driven neovsculriztion Mtin Economopoulou 1,5, Hrld F Lnger 1,5, Arkdy Celeste 1, Vleri V Orlov 1, Eun Young Choi 1, Mingcho M 2, Athnssios Vssilopoulos 3, Els Cllen 1,
More informationThe potential future of targeted radionuclide therapy: implications for occupational exposure? P. Covens
The potentil future of trgeted rdionuclide therpy: implictions for occuptionl exposure? Introduction: Trgeted Rdionuclide Therpy (TRT) Systemic tretment Molecule lbelled with rdionuclide delivers toxic
More informationTLR7 induces anergy in human CD4 + T cells
TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is
More informationMechanisms of Tanshinone II a inhibits malignant melanoma development through blocking autophagy signal transduction in A375 cell
Li et l. BMC Cncer (2017) 17:357 DOI 10.1186/s12885-017-3329-y RESEARCH ARTICLE Open Access Mechnisms of Tnshinone II inhiits mlignnt melnom development through locking utophgy signl trnsduction in A375
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationCheck your understanding 3
1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationSupporting Information. In Situ Supramolecular Assembly and Modular Modification of Hyaluronic Acid Hydrogels for 3D Cellular Engineering
Supporting Informtion In Situ Suprmoleculr Assemly nd Modulr Modifiction of Hyluronic Acid Hydrogels for 3D Cellulr Engineering Kyeng Min Prk,, Jeong-A Yng,, Hyunte Jung, c Junseok Yeom, Ji Sun Prk, d
More informationBioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM
Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
More informationEfficacy of Pembrolizumab in Patients With Advanced Melanoma With Stable Brain Metastases at Baseline: A Pooled Retrospective Analysis
Efficcy of Pembrolizumb in Ptients With Advnced Melnom With Stble Brin Metstses t Bseline: A Pooled Retrospective Anlysis Abstrct 1248PD Hmid O, Ribs A, Dud A, Butler MO, Crlino MS, Hwu WJ, Long GV, Ancell
More informationsupplementary information
DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development
More informationOvercoming EGFR T790M-based Tyrosine Kinase Inhibitor Resistance with an Allele-specific DNAzyme
Cittion: Moleculr Therpy Nucleic Acids (214) 3, e15; doi:1.138/mtn.214.3 214 The Americn Society of Gene & Cell Therpy All rights reserved 2162-2531/14 www.nture.com/mtn Overcoming T79M-sed Tyrosine Kinse
More informationAgilent G6825AA MassHunter Pathways to PCDL Software Quick Start Guide
Agilent G6825AA MssHunter Pthwys to PCDL Softwre Quick Strt Guide Wht is Agilent Pthwys to PCDL? Fetures of Pthwys to PCDL Agilent MssHunter Pthwys to PCDL converter is stnd-lone softwre designed to fcilitte
More informationINFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA
Pthology nd Hygiene INFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA Kulcsár G. 1, Fáián K. 1 *, Brn T. 1, Virág Gy.
More informationThe effect of thalidomide on non-small cell lung cancer (NSCLC) cell lines: possible involvement in the PPARg pathway
Crcinogenesis vol.25 no.10 pp.1805--1812, 2004 doi:10.1093/crcin/gh210 The effect of thlidomide on non-smll cell lung cncer (NSCLC) cell lines: possile involvement in the PPARg pthwy Kthleen L.DeCicco,
More informationConsumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationDownregulation of Notch regulated Ankyrin Repeat Protein Exerts Antitumor Activities against Growth of Thyroid Cancer
Originl Article Downregultion of Notch regulted Ankyrin Repet Protein Exerts Antitumor Activities ginst Growth of Thyroid Cncer Bing Feng Chu 1,2, Yi Yu Qin 3, Sheng Li Zhng 2, Zhi Wei Qun 2, Ming Di Zhng
More informationSupplementary Information
Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,
More informationIL-18 induction of IgE: dependence on CD4 + T cells, IL-4 and STAT6
ARTICLES IL-18 induction of IgE: dependence on CD4 + T cells, IL-4 nd STAT6 Tomohiro Yoshimoto 1,2,7, Hitoshi Mizutni 3, Hiroko Tsutsui 1, Nncy Noen-Truth 6, Kei-ichi Ymnk 3, Minoru Tnk 4, Shinzo Izumi
More information% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %
Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts
More informationType II monocytes modulate T cell-mediated central nervous system autoimmunity
Type II monocytes modulte T cell-medited centrl nervous system utoimmunity Mrtin S. Weer, Thoms Prod homme, Swsn Youssef, Shnnon E. Dunn, Cynthi D. Rundle, Lind Lee, Jun C. Ptrroyo, Olf Stüve, Rymond A.
More informationSafety and Tolerability of Subcutaneous Sarilumab and Intravenous Tocilizumab in Patients With RA
Sfety nd Tolerbility of Subcutneous Srilumb nd Intrvenous Tocilizumb in Ptients With RA Pul Emery, 1 Jun Rondon, 2 Anju Grg, 3 Hubert vn Hoogstrten, 3 Neil M.H. Grhm, 4 Ming Liu, 4 Nncy Liu, 3 Jnie Prrino,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril
More informationEffects of modified FOLFOX-6 chemotherapy on cellular immune function in patients with gastric cancer
ONCOLOGY LETTERS 15: 8635-8640, 2018 Effects of modified FOLFOX-6 chemotherpy on cellulr immune function in ptients with gstric cncer LIANG WANG 1, DONGER ZHOU 1, HAITAO REN 2 nd YAN CHEN 3 Deprtments
More informationAntiproliferative Activity of the Chinese Medicinal Compound, Delisheng, Compared With Rg3 and Gemcitabine in HepG2 Cells
Reserch Pper Antiprolifertive Activity of the Chinese Medicinl Compound, Delisheng, Compred With Rg3 nd Gemcitine in HepG2 Cells S. H. WANG*, Y. C. WANG 1, Y. L. NIE, Y. N. HAI, H. F. SUN, Z. L. YUAN AND
More informationmir-155 is dispensable in monosodium urate-induced gouty inflammation in mice
Yng et l. Arthritis Reserch & Therpy (2018) 20:144 https://doi.org/10.1186/s13075-018-1550-y RESEARCH ARTICLE mir-155 is dispensle in monosodium urte-induced gouty inflmmtion in mice Qiin Yng 1,3,4, Quno
More informationDose-dependent effect of daptomycin on the artificial prolongation of prothrombin time in coagulation abnormalities: in vitro verification
Hshimoto et l. BMC Phrmcology nd Toxicology (2017) 18:74 DOI 10.1186/s40360-017-0180-3 RESEARCH ARTICLE Open Access Dose-dependent effect of dptomycin on the rtificil prolongtion of prothrombin time in
More informationBreastDefend enhances effect of tamoxifen in estrogen receptor-positive human breast cancer in vitro and in vivo
Cheng et l. BMC Complementry nd Alterntive Medicine (217) 17:115 DOI 1.1186/s1296-17-1621-7 RESEARCH ARTICLE BrestDefend enhnces effect of tmoxifen in estrogen receptor-positive humn rest cncer in vitro
More informationA critical role for interleukin 4 in activating alloreactive CD4 T cells
A criticl role for interleukin 4 in ctivting llorective CD4 T cells Jessmyn Bgley,Tokihiko Swd*,Yin Wu nd John Icomini To generte ntigen-specific responses, T cells nd ntigen presenting cells (APCs) must
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does
More informationSingle-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
More informationSKI II reverses the chemoresistance of SGC7901/DDP gastric cancer cells
ONCOLOGY LETTERS 8: 367-373, 2014 SKI II reverses the chemoresistnce of SGC7901/DDP gstric cncer cells YING LIU 1, ZUAN ZHU 2, HONGXING CAI 3, QINGHUA LIU 1, HONGLIAN ZHOU 2 nd ZHENGQIU ZHU 4 1 Deprtment
More informationA FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM
IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More information308 nm excimer lamp in combination with topical tacrolimus: A retrospective study of its efficacy and safety in childhood vitiligo
ORIGINAL ARTICLE 308 nm excimer lmp in comintion with topicl tcrolimus: A retrospective study of its efficcy nd sfety in childhood vitiligo BS Chndrshekr, N Shoh, P Deprtment of Dermtology, Cutis, Acdemy
More informationModulatory role of regulatory T cells in a murine model of severe equine asthma
Henríquez et l. BMC Veterinry Reserch (2017) 13:117 DOI 10.1186/s12917-017-1037-0 RESEARCH ARTICLE Open Access Modultory role of regultory T cells in murine model of severe equine sthm Cludio Henríquez
More informationStudy of Stress Distribution in the Tibia During Stance Phase Running Using the Finite Element Method
Ksetsrt J. (Nt. Sci.) 48 : 729-739 (2014) Study of Stress Distriution in the Tii During Stnce Phse Running Using the Finite Element Method Thepwchr Ruchirh 1, Tumrong Puttpitukporn 1, * nd Siriporn Ssimontonkul
More informationIGF-I and IGFBP-3 augment transforming growth factor-b actions in human renal carcinoma cells
originl rticle http://www.kidney-interntionl.org & Interntionl Society of Nephrology IGF-I nd IGFBP-3 ugment trnsforming growth fctor-b ctions in humn renl crcinom cells AH Rosendhl 1, nd G Forsberg 1
More information