MicroRNA-217 Regulates WASF3 Expression and Suppresses Tumor Growth and Metastasis in Osteosarcoma

Size: px
Start display at page:

Download "MicroRNA-217 Regulates WASF3 Expression and Suppresses Tumor Growth and Metastasis in Osteosarcoma"

Transcription

1 MicroRNA-217 Regulates WASF3 Expression and Suppresses Tumor Growth and Metastasis in Osteosarcoma Lei Shen 1", Peng Wang 2", Jili Yang 3", Xiaotao Li 4 * 1 Department of Anatomy, Qiqihar Medical School, Qiqihar, Heilongjiang, China, 2 Department of Orthopedics, The Fourth Hospital of Harbin Medical University, Harbin, Heilongjiang, China, 3 Department of TCM, Jilin Province Tumor Hospital, Changchun, Jilin Province, China, 4 Department of Orthopedics, The First Affiliated Hospital of Jiamusi University, Jiamusi, Heilongjiang, China Abstract Osteosarcoma is the most common type of primary tumor of bone which mainly affects adolescents and young adults. Osteosarcoma causes large number of deaths because of its complex pathogenesis and resistance to conventional treatment. MicroRNAs are a class of small noncoding RNAs that function as critical gene regulators through targeting mrnas, causing translational repression or degradation. In this study, we showed that mir-217 was down-regulated in osteosarcoma cell lines and tissues in comparison to that in normal bone cells or tissues. Meanwhile, the lower level of mir- 217 was associated with metastasis in clinical osteosarcoma patients. Furthermore, we found that overexpession of mir-217 markedly suppressed cell proliferation, migration, and invasion of osteosarcoma cells. Conversely, the inhibition of mir-217 expression significantly accelerated the cell proliferation, migration, and invasion. Moreover, we identified WASF3 as a novel functional downstream target of mir-217. The ectopic expression of WASF3 can partially reverse the inhibition of cell proliferation and invasion caused by mir-217. Take together, our results demonstrate that mir-217 functions as a tumorsuppressive mirna and inhibits the osteosarcoma tumorigenesis through targeting WASF3. Citation: Shen L, Wang P, Yang J, Li X (2014) MicroRNA-217 Regulates WASF3 Expression and Suppresses Tumor Growth and Metastasis in Osteosarcoma. PLoS ONE 9(10): e doi: /journal.pone Editor: Gary Stein, University of Vermont, United States of America Received February 24, 2014; Accepted September 5, 2014; Published October 7, 2014 Copyright: ß 2014 Shen et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This study is supported by Natural Science Foundation of Heilongjiang Province of China (Grant No. H201359). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * hljjmsxt@126.com " LS, PW, and JY are co-first authors on this work. Introduction Osteosarcoma is the most common type of primary sarcoma of the bone and a leading cause of cancer death in adolescents due to its rapid proliferation [1,2]. Despite the rapid development in therapeutic strategies, such as wide tumor excision, adjuvant chemotherapy and radiotherapy, the cure rate of patients of osteosarcoma is still very low [3]. Although recent advances in molecular biology have provided some clues to the molecular pathogenesis of osteosarcoma, the exact molecular mechanisms underlying the histological heterogeneity, drug resistance, and development of metastasis remain unclear [4]. Therefore, it is urgent to develop novel targets for the diagnosis, treatment, and prognosis of osteosarcoma. MicroRNAs (mirnas) are a class endogenous small non-coding RNAs that regulate gene expression by the inhibition of the translation and/or decreasing of the stability of target mrnas [5]. MiRNAs are differentially expressed in various tissues and cells, suggesting their potential applications as biomarkers and therapeutic targets [6]. MiRNAs are deregulated in several diseases including cancers, where they play important roles by regulating the expression of various tumor oncogenes and suppressors [7,8]. MiRNAs also can act as oncogenes or tumor suppressors and involve in numerous cellular processes, playing roles in tumorigenesi by regulating cell differentiation, cell proliferation and cell cycle [9 13]. However, the role of mirnas in osteosarcoma tumor development and metastasis has only recently been investigated and remains largely unknown. Previous studies have showed that mir-217 was a novel tumor biomarker of clear cell renal cell carcinoma [14]. It could target oncogenes or tumor suppressor genes in different cell type. For example, mir-217 could target KRAS, previously shown to function as a tumor suppressor by inhibiting tumor cell growth and anchorage-independent colony formation [15]. MiR-217 could also act as oncogene by targeting the tumor suppressor gene PTEN in kidney disorders [16]. In addition, mir-217 could target silent information regulator 1 (SirT1), and function as an oncogene [17]. However, no specific study has been showed to investigate the role of mir-217 in osteosarcoma. In this report, we investigated the role of mir-217 in human osteosarcoma. First, we investigated the expression of mir-217 in human osteosarcoma cell lines and tissues, and paired adjacent non-tumor bone tissue. Second, we examined the cell growth, migration, and invasion following overexpression or downregulation of mir-217 in osteosarcoma cell lines. Finally, we determined the target gene of mir-217 using the luciferase reporter assay and western blot. PLOS ONE 1 October 2014 Volume 9 Issue 10 e109138

2 Materials and Methods Ethics Statement All of these patients or patients parents on behalf of the children agreed to participate in the study and gave written informed consent. Both this study and consent were approved by the ethical board of the institute of The First Affiliated Hospital of Jiamusi University and complied with the Declaration of Helsinki. Tissue samples Surgically resected 60 osteosarcomas specimens and their morphologically normal bone tissues (before the administration of neoadjuvant chemotherapy) were acquired from The First Affiliated Hospital of Jiamusi University between November 2007 and November Tissue samples were cut into two parts and one part was fixed with 10% formalin for histopathological diagnosis. The other was immediately snap-frozen in liquid nitrogen and then stored at 2196uC in liquid nitrogen until it was needed for RNA was extracted. The use of tissue samples for all of these experiments was approved by the patients and by the Ethics Committee of the institution. These patient characteristics were described in Table S1. Cell lines and Cell culture The following human osteosarcoma cell lines were used in this study: MG-63 (14 years old, male), U2OS (15 years old, female), SOSP-9607(17 years old, male), and SAOS-2 (11 years old, female), one normal bone cell lines hfob and 293T cells. These cell lines were purchased from the American Type Culture Collection (ATCC, Rockville, MD, USA) and were propagated in Dulbecco s modified Eagle medium (Gibco; Invitrogen; Life Technologies, Germany) that was supplemented with 10% fetal bovine serum (GIBCO, NY, USA) and streptomycin (100 mg/ml), penicillin (100 U/ml). Cell transfection The mir-217 mimics, inhibitor and the scramble mimics, which were non-homologous to the human genome and were synthesized by GenePharma (Shanghai, China) and were transfected into the cells to a final oligonucleotide concentration of 20 nmol/l. All of these cell transfections were performed by DharmaFECT1 Reagent (Dharmacon, TX, USA) according to the manufacturer s instructions. TaqMan RT-PCR for mirna expression Total RNA was isolated from cultured cells or tissues samples with Trizol reagent (Invitrogen, Carlsbad, CA, USA). MiRNAs were quantitated by real-time PCR using the TaqMan MicroRNA Assays (Invitrogen, USA) [18]. First-strand complementary DNA (cdna) synthesis was carried out using 1 mg of total RNA in a 12 ml final volume containing 2 M stem-loop primer and 10 mmdntp Mix (Invitrogen, USA). The mix was incubated at 65uC for 5 min, and then, 5xRT buffer, 0.1 M DTT, 200 U/ml MultiScribe reverse transcriptase and 40 U/ml RNase inhibitor were added (Invitrogen, USA). Then the mix was incubated at 37uC for 55 min, followed by 70uC for 15 min, and then held at 2 20uC. Real-time PCR was performed using a standard TaqMan PCR protocol [18]. The 20 ml PCR reactions included 1 ml ofrt product, 16 Universal TaqMan Master Mix and 16 TaqMan probe/primer mix (Invitrogen, USA). All RT reactions, including the no-template controls, were run in triplicate. All mrna quantification data were normalized to U6 expression. The relative amount of transcript was calculated using the comparative Ct method (Table S2). Cell proliferation assay Cell proliferation was analyzed by using cell counting assay Kit- 8 (CCK-8) (DOJINDO, Kumamoto, Japan) according to the manufacture s protocol. Cells were incubated in 10% CCK-8 diluted in normal culture media at 37uC until the visual color conversion occurred. Proliferation rates were determined at 0, 24, 48, 72 and 96 hours after transfection. The absorbance of each well was measured with a microplate reader set at 450 nm and 630 nm. Cell migration and invasion assays MG-63 cells were grown to confluence in 12-well plastic dishes and were treated with mirna mimics, inhibitors or Scrambled. Then, 24 hours after transfection, linear scratch wounds (in triplicate) were created on the confluent cell monolayers using a 200 ml pipette tip. To remove cells from the cell cycle prior to wounding, cells were maintained in serum-free media. To visualize migrated cells and wound healing, images were taken at 0, 24 and 48 h. A total of ten areas were selected randomly from each well, and the cells in three wells from each group were quantified. For these invasion assays, 24 hours after transfection, cells in serum-free media were seeded in transwell migration chambers (8 mm pore size; Millipore, Zürich, Switzerland). The upper chamber of thesetranswell inserts was coated with Matrigel (Sigma-Aldrich, St. Louis, MO, USA). Medium containing 20% FBS was added to the lower chamber. After 24 hours, the noninvading cells were removed with cotton wool. Invasive cells located on the lower surface of the chamber were stained with May-Grunwald-Giemsa stain (Sigma-Aldrich, St. Louis, MO, USA) and then were counted using a microscope (Olympus, Tokyo, Japan). Dual luciferase assays The 39 UTRs of WASF3 containing these predicted binding sites of mir-217 were amplified using PCR from human cdna using primers, and inserted into the pmir-report luciferase reporter vectors (Ambion, Austin, TX, USA) to get the constructs containing the wild-type WASF3 39UTR (WASF3-WT). WASF3- MUT contained the sequences with mutations in the first putative binding site of WASF3 39UTR. Mutations of these predicted seed regions in these mrna sequences were created using the primers including the mutated sequences. The recombination constructs, prl-tk (Promega, WI, USA) and mir-217 or control mimic were co-transfected into 293T cells using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). The plasmid of prl-tk containing Renilla luciferase was used as the internal control. Firefly and Renilla luciferase activity were measured using Dual Luciferase Assay (Promega) according to the manufacturer s instructions at 24 h after transfection. Western blotting analysis Western blot was performed using standard methods. Total protein was isolated from tumor samples and corresponding normal tissues or cells. The concentration was measured by BCA protein assay kit (Pierce, USA). Proteins were separated by 10% SDS-PAGE, and then transferred to PVDF membranes (Amersham, Buckinghamshire, UK). Membranes were blocked with 5% non-fat dried milk and incubated overnight with anti-wasf3 antibody (Abcam, England); anti-gapdh antibody (Proteintech, Chicago, USA). After washing with TBST three times, the membranes were incubated for 2 h with goat anti-rabbit antibody (zsgb-bio, Beijing, China). PLOS ONE 2 October 2014 Volume 9 Issue 10 e109138

3 Figure 1. mir-217 is downregulated in human osteosarcoma cell lines and tissues. (A) Relative expression of mir-217 in four human osteosarcoma cell lines (MG-63, U2OS, SOSP-9607, and SAOS-2) and one normal bone cell line (hfob) was determined by qrt-pcr. Quantification of mir-217 was measured by qrt-pcr with specific primers for mir-217 and snrna U6. (B) Relative expression of mir-217 in 60 primary osteosarcoma tissues compared with their pair-matched nontumor tissues. Data areshown as log10 of relative ratio change of osteosarcoma tissues relative tonormal tissues. (C) Relative mir-217expressionlevels in osteosarcoma tissues and adjacent normal regions; (D)The expression of mir-217 in the osteosarcoma tissues from the patients with metastases was lower than that in non-metastases tissues. All data uses t test and is shown as mean 6SEM. doi: /journal.pone g001 Rescue assays of WASF3 gene expression The full length WASF3 cdnas (which included theorf and 39UTR) was PCR-amplified and cloned into the pcdna3.1 vectorto generate the pcdna-wasf3 constructs that were used in the rescue assays. The MG-63 cells in 6-well plateswere first transfected with either mir-217 or a scrambled dsrnas (60 nm). After 24 h in culture, these cells were then co-transfected with mir-217(20 nm) and 2.0 mg pcdna-wasf3, mir-217 (20 nm) and 2.0 mg pcdna-empty. Cells were harvested at the indicated time points after hemin addition and were assayed as required. Statistical analysis Each experiment was repeated at least three times. Statistical analyses were performed using SPSS Data are presented as the mean 6 standard deviation. Statistical analyses were performedwith either an analysis of variance (ANOVA) or Student s t-test and the statistical significance level was set at a = 0.05 (two-side) Result MiR-217 expression was down-regulated in both osteosarcoma tissues and cell lines To evaluate the expression of mir-217 in osteosarcoma, qrt- PCR was performed. The expression levels of mir-217 were much lower in tumor cell lines than in hfob (Figure1A). The expression of mir-217 was also down-regulated in tumor tissues compared to that in non-tumor tissues (Figure 1B and C). The expression of mir-217 in metastaticosteosarcoma tissues were significantly lower than that in non-metastatic tissues. (Figure 1D, p,0.01, independent-samples t test). MiR-217 inhibited osteosarcoma cell proliferation, migration and invasion To explore the role of mir-217 indevelopment ofosteosarcoma, MG-63 cells were transfected with mir-217 mimics or inhibit with high transfection efficiency (Fig. 2A). The enforced expression of mir-217 led to a significant decrease in the proliferation of the MG-63 cells (Figure 2B). In contrast, the mir-217 inhibitor PLOS ONE 3 October 2014 Volume 9 Issue 10 e109138

4 Figure 2. Overexpression of mir-217 inhibits the osteosarcoma cell line MG-63 proliferation, migration, and invasion. (A) Expression levels of mir-217 were examined by qrt-pcr after transfection of 20 nmol/l of mir-217 mimics, inhibitors or sramble or no transfection in the cell line MG-63. (B) The cells treated with mir-217 mimics, inhibitors or sramble or no transfection were measured by CCK8 assay at different time periods. (C) Wound healing assays of MG-63cells after treatment with mirna mimics, inhibitors or scramble or no transfection; the relative ratio of wound closure per field is shown. (D) Transwell analysis of MG-63 cells after treatment withmirna mimics, inhibitors or scramble or no transfection; the invasive cells per field is shown below, All data uses t test and is shown as mean 6SEM. *p,0.05,** p,0.01, and ***p, doi: /journal.pone g002 significantly increased the cell proliferation of the MG-63 cells. The cells treated with mir-217 mimics were distinctively less migratory in comparison tothe scrambled control or untreated cells at 24, and 48 hours after scratching (Fig 2C). Meanwhile, the mir-217 inhibitor significantly accelerated the cell migration of the MG-63 cells. The invasiveness of cells transfected with the mir-217 mimics was significantly decreased compared to the scramble control or untreated cells. And the mir-217 inhibitor significantly increased the cell invasion of the MG-63 cells. (Fig.2D) WASF3 was the direct target of mir-217 in osteosarcoma Next, we searched for candidate target genes of mir-217 using publicly available databases; WASF3 was selected for further experimental validation, because the complementary sequence of mir-217 was identified in the 39UTR of WASF3 mrna by TargetScan analysis (Fig. 3A). The effect of mir-217 on the translation of WASF3 mrna into protein was assessed by luciferase reporter assay (Fig. 3B). Overexpression ofmir-217 remarkably reduced luciferase activity of reporter gene with wildtype, but not mutant WASF3 39UTR, indicating that mir-217 directly targeted WASF3 39UTR. Moreover, overexpression of mir-217 reduced the protein but not the mrna levels of WASF3 in osteosarcoma cells. (Fig. 3C and D). Overexpression of WASF3 impaired the mir-217-induced inhibition of proliferation and invasion in osteosarcoma cells We used rescue experiments to further validate that WASF3 targeting is involved in mir-217-indued anti-tumor properties in osteosarcoma cells. WASF3 expression vectors, pcdna3.0- WASF3 was used to restore the WASF3 expression. The protein and mrna level of WASF3 was reduced when mir-217 mimics were transfected with pcdna-wasf3 after 24 h (Fig. 4A and 4B). PLOS ONE 4 October 2014 Volume 9 Issue 10 e109138

5 Figure 3. MiR-217 targets WASF3 in osteosarcoma cells. (A) The sequences of mir-217 binding sites within the human WASF3 39UTR and schematic reporter constructs, in this panel, WASF3-WT represent the reporter constructs containing the entire 39UTR sequences of WASF3. WASF3- MUT represent the reporter constructs containing mutated nucleotides. (B) The analysis of the relative luciferase activities of WASF3-WT, WASF3-MUT in 293T cells. The error bars are derived from triplicate expriments. (C) qrt-pcr analysis of WASF3 mrna expression in MG-63 cells after treatment with mirna mimics or scramble or no transfection. The expression of WASF3 was normalized to GAPDH. (D) Western blot analysis of WASF3 expression in MG-63 cells transfected with mir-217 mimics or scramble or no transfection. GAPDH was also detected as a loading control. All data uses t test and is shown as mean 6SEM. doi: /journal.pone g003 As expected, the ectopic expression of WASF3 resulted in a marked increase in cell proliferation, invasion and migration. (Fig. 4C, D, F and G). Inhibition in cell proliferation, invasion and migration by overexpression of mir-217 was significantly attenuated by re-introduction of WASF3 (Fig. 4C, D, F and G). To assess the regulation of mir-217 in the WASF3 expression, the protein level of WASF3 was analyzed in eight mir-217 downregulated tissues. WASF3 was up-regulated in 8 osteosarcoma tissues compared to their pair-matched adjacent non-tumor tissues. (Fig. 4F) Discussion Osteosarcoma showed complex genomic changes with a few recurrent chromosomal aberrations, which makes it difficult to identify the molecular features [19]. Recently, accumulating evidences have demonstratedthe role of mirnas in tumorigenesis and tumor progression of osteosarcoma [20]. mirnas and their targets genes have been proved to represent potential novel therapeutic biomarkers for osteosarcoma [3,21,22]. In this study, we analyzed the expression of mir-217 in 60 osteosarcoma patients and found that mirnas were much lower in osteosarcoma tissues in comparison with paired adjacent non-tumor bone tissues. Furthermore, we showed that the overexpression of mir- PLOS ONE 5 October 2014 Volume 9 Issue 10 e109138

6 Figure 4. Restore WASF3 expression impairs mir-217-induced inhibition of proliferation and invasion in osteosarcoma cells. (A) Western blot analysis of WASF3 in MG-63 cells co-transfectedwith either mir-217 mimic or scramble and 2.0 mg pcdna-wasf3 orpcdna empty vector. (B) The relative WASF3 protein was showed with different combinations. The signal in each lane was quantified using ImageJ software and the ratio of WASF3 to GAPDH was determined. (C) Cell growth curves in MG-63 cells transfected with different combinations using CCK-8 analysis. (D) The relative ratio of wound closure per field with different combinations is shown. (E) Transwell analysis of MG-63 cells treated with different combinations. The invasive cells per field is shown right. (F) Wound healing assays of MG-63 cells after treatment with different combinations. (G) Western blot analysis of WASF3 expression in 8 mir-217 down-regulated osteosarcoma tissues and their pair-matched nontumor tissues. GAPDH was also detected as a loading control. All data uses t test and is shown as mean 6SEM. *p,0.05,** p,0.01,***p, doi: /journal.pone g in the MG-63 cells reduced cell proliferation. On the other hand, metastasis is the major cause of morbidity and mortality in patients of osteosarcoma; therefore, we investigated the effects of mir-217 on cell migration and invasion. Our result showed that the introduction of mir-217 inhibited the MG-63 cells migration and suppressed cell invasion, further confirming their association with the degree of osteosarcoma malignancy. Moreover, we identified WASF3 as a direct target of mir-217. Our findings, together with those from other groups, suggested that mir-217 played a suppressor role in osteosarcoma tumorigenesis and cell invasion. In recent years, several mirnas, such as mir-199b-5b, mir- 195, mir-221, mir-183, had been identifiedto be involved in osteosarcoma [23 28]. In addition, mir-217 was found to be significantly down-regulated in 21 PDAC patient tissue samples and 7 PDAC cell lines [15]. In agreement with the previous results, we found that mir-217 was down-regulated in 56 cases (56/60, 93%) osteosarcoma tissues compared to in the adjacent tissues. In this study, we found that restoration of mir-217 significantly inhibited cell proliferation, migration and invasion; and reduced cell viability in osteosarcoma cell lines, indicating that repression of mir-217 might promote tumor progression in osteosarcoma carcinogenesis. Moreover, down-regulation of mir-217 significantly promoted cell proliferation, migration and invasion; enhanced cell viability in osteosarcoma cell lines, indicating that inhibition of mir-217 might promote tumor progression in osteosarcoma carcinogenesis. In conclusion, our results suggested that mir-217 acted as a tumor-suppressor whose downregulation may contribute to the progression of osteosarcoma. Identification of cancer-specific mirnas and their targets is pivotal for understanding their roles in tumorigenesis [29,30]. TargetScan was employed to identify these direct targets of mir WASF3 was predicted as one of the targets of mir-217. Furthermore, overexpression of mir-217 led to a significantly reduction in WASF3 protein and mrna level and overexpression of mir-217 suppressed WASF3 39UTR luciferase report activity and this effect was abolished by mutation of the mir-217 seed binding sites. The function of WASF3 was further supported by the observations that inhibition in cell proliferation, invasion and proliferation by overexpression of mir-217 was significantly attenuated by re-introduction of WASF3. These results indicated that mir-217 might function as a tumor suppressor partly by repressing WASF3 expression in osteosarcoma. The WASF3 gene was a member of the Wiskott Aldrich syndrome family of proteins (WASP), which contained verprolincofilin-acidic domains at their C-terminal ends [31,32]. These domains were thought to coordinate the recruitment of monomeric actin and the ARP2/3 complex of proteins to facilitate actin polymerization, which was essential for cell movement and invasion [32,33]. Previous studies had shown that inactivation of the WASF3 gene in prostate cancer cells led to suppression of tumorigenicity and metastases [33]. Moreover, activation of PLOS ONE 6 October 2014 Volume 9 Issue 10 e109138

7 WASF3 was required for invasion and lamellipodia formation in breast cancer cells, which was achieved to some extent through its phosphorylation by ABL kinase [34]. WASF3 was previously shown to be required for invasion and metastasis in different cancer cell types and knowckdown of WASF3 led to suppression of invasion and metastasis [35]. In our study, we confirmed that WASF3 was up-regulated in osteosarcoma tissues and overexpression of WASF3 induced osteosarcoma cells proliferation and invasion. However, the relevant mechanisms were still unclear. The ability of mir-217 to target WASF3 might provide one possible mechanism of post-transcriptional control of WASF3. In conclusion, the current study provided a novel evidence that mir-217 function as a tumor suppressor mirna in osteosarcoma through repressing WASF3 expression. Based on the association between deregulated mirna expression and cancers, mirnabased therapeutic strategies were developed either by restoring the expression or reducing mirna expression in cancer or, conversely, abrogating overexpressed mirna. Consequently, our findings provided a molecular basis for the role of mir-217/wasf3 in the References 1. Yang J, Zhang W (2013) New molecular insights into osteosarcoma targeted therapy. Curr Opin Oncol 25: Ji F, Zhang H, Wang Y, Li M, Xu W, et al. (2013) MicroRNA-133a, downregulated in osteosarcoma, suppresses proliferation and promotes apoptosis by targeting Bcl-xL and Mcl-1. Bone 56: Gougelet A, Pissaloux D, Besse A, Perez J, Duc A, et al. (2011) Micro-RNA profiles in osteosarcoma as a predictive tool for ifosfamide response. Int J Cancer 129: Kobayashi E, Hornicek FJ, Duan Z (2012) MicroRNA Involvement in Osteosarcoma. Sarcoma 2012: Van Wynsberghe PM, Chan SP, Slack FJ, Pasquinelli AE (2011) Analysis of microrna expression and function. Methods Cell Biol 106: Liang W, Gao B, Fu P, Xu S, Qian Y, et al. (2013) The mirnas in the pathgenesis of osteosarcoma. Front Biosci (Landmark Ed) 18: Tang JT, Fang JY (2009) MicroRNA regulatory network in human colorectal cancer. Mini Rev Med Chem 9: Suzuki H, Maruyama R, Yamamoto E, Kai M (2012) DNA methylation and microrna dysregulation in cancer. Mol Oncol. 9. Song B, Ju J (2010) Impact of mirnas in gastrointestinal cancer diagnosis and prognosis. Expert Rev Mol Med 12: e Schotte D, Pieters R, Den Boer ML (2012) MicroRNAs in acute leukemia: from biological players to clinical contributors. Leukemia 26: Sandoval J, Esteller M (2012) Cancer epigenomics: beyond genomics. Curr Opin Genet Dev 22: Rottiers V, Najafi-Shoushtari SH, Kristo F, Gurumurthy S, Zhong L, et al. (2011) MicroRNAs in metabolism and metabolic diseases. Cold Spring Harb Symp Quant Biol 76: Qi J, Yu JY, Shcherbata HR, Mathieu J, Wang AJ, et al. (2009) micrornas regulate human embryonic stem cell division. Cell Cycle 8: Li H, Zhao J, Zhang JW, Huang QY, Huang JZ, et al. (2013) MicroRNA-217, down-regulated in clear cell renal cell carcinoma and associated with lower survival, suppresses cell proliferation and migration. Neoplasma 60: Zhao WG, Yu SN, Lu ZH, Ma YH, Gu YM, et al. (2010) The mir-217 microrna functions as a potential tumor suppressor in pancreatic ductal adenocarcinoma by targeting KRAS. Carcinogenesis 31: Kato M, Putta S, Wang M, Yuan H, Lanting L, et al. (2009) TGF-beta activates Akt kinase through a microrna-dependent amplifying circuit targeting PTEN. Nat Cell Biol 11: Menghini R, Casagrande V, Cardellini M, Martelli E, Terrinoni A, et al. (2009) MicroRNA 217 modulates endothelial cell senescence via silent information regulator 1. Circulation 120: Li Z, Lei H, Luo M, Wang Y, Dong L, et al. (2014) DNA methylation downregulated mir-10b acts as a tumor suppressor in gastric cancer. Gastric Cancer. 19. Miao J, Wu S, Peng Z, Tania M, Zhang C (2013) MicroRNAs in osteosarcoma: diagnostic and therapeutic aspects. Tumour Biol. progression of human osteosarcoma and suggested that this mirna could be a potential target for the treatment of osteosarcoma in future. Supporting Information Table S1 Clinic pathologic charateristics of patients with osteosarcoma. (DOC) Table S2 (DOC) Primer sequence. Author Contributions Conceived and designed the experiments: LS PW JY XL. Performed the experiments: LS PW JY XL. Analyzed the data: LS PW JY XL. Contributed reagents/materials/analysis tools: LS PW JY XL. Wrote the paper: LS PW JY XL. 20. Jones KB, Salah Z, Del Mare S, Galasso M, Gaudio E, et al. (2012) mirna signatures associate with pathogenesis and progression of osteosarcoma. Cancer Res 72: Dai N, Zhong ZY, Cun YP, Qing Y, Chen C, et al. (2013) Alteration of the microrna expression profile in human osteosarcoma cells transfected with APE1 sirna. Neoplasma 60: Chen L, Wang Q, Wang GD, Wang HS, Huang Y, et al. (2013) mir-16 inhibits cell proliferation by targeting IGF1R and the Raf1-MEK1/2-ERK1/2 pathway in osteosarcoma. FEBS Lett 587: Won KY, Kim YW, Kim HS, Lee SK, Jung WW, et al. (2013) MicroRNA- 199b-5p is involved in the Notch signaling pathway in osteosarcoma. Hum Pathol 44: Ouyang L, Liu P, Yang S, Ye S, Xu W, et al. (2013) A three-plasma mirna signature serves as novel biomarkers for osteosarcoma. Med Oncol 30: Mao JH, Zhou RP, Peng AF, Liu ZL, Huang SH, et al. (2012) microrna-195 suppresses osteosarcoma cell invasion and migration in vitro by targeting FASN. Oncol Lett 4: Zhao G, Cai C, Yang T, Qiu X, Liao B, et al. (2013) MicroRNA-221 induces cell survival and cisplatin resistance through PI3K/Akt pathway in human osteosarcoma. PLoS One 8: e Zhao H, Guo M, Zhao G, Ma Q, Ma B, et al. (2012) mir-183 inhibits the metastasis of osteosarcoma via downregulation of the expression of Ezrin in F5M2 cells. Int J Mol Med 30: Zhu J, Feng Y, Ke Z, Yang Z, Zhou J, et al. (2012) Down-regulation of mir-183 promotes migration and invasion of osteosarcoma by targeting Ezrin. Am J Pathol 180: Wu X, Zhong D, Gao Q, Zhai W, Ding Z, et al. (2013) MicroRNA-34a inhibits human osteosarcoma proliferation by downregulating ether a go-go 1 expression. Int J Med Sci 10: Song L, Yang J, Duan P, Xu J, Luo X, et al. (2013) MicroRNA-24 inhibits osteosarcoma cell proliferation both in vitro and in vivo by targeting LPAATbeta. Arch Biochem Biophys 535: Teng Y, Mei Y, Hawthorn L, Cowell JK (2014) WASF3 regulates mir-200 inactivation by ZEB1 through suppression of KISS1 leading to increased invasiveness in breast cancer cells. Oncogene 33: Teng Y, Ghoshal P, Ngoka L, Mei Y, Cowell JK (2013) Critical role of the WASF3 gene in JAK2/STAT3 regulation of cancer cell motility. Carcinogenesis 34: Teng Y, Ren MQ, Cheney R, Sharma S, Cowell JK (2010) Inactivation of the WASF3 gene in prostate cancer cells leads to suppression of tumorigenicity and metastases. Br J Cancer 103: Teng Y, Liu M, Cowell JK (2011) Functional interrelationship between the WASF3 and KISS1 metastasis-associated genes in breast cancer cells. Int J Cancer 129: Ghoshal P, Teng Y, Lesoon LA, Cowell JK (2012) HIF1A induces expression of the WASF3 metastasis-associated gene under hypoxic conditions. Int J Cancer 131: E PLOS ONE 7 October 2014 Volume 9 Issue 10 e109138

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells

mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells European Review for Medical and Pharmacological Sciences 2017; 21: 108-114 mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells H.-X.

More information

Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma

Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma European Review for Medical and Pharmacological Sciences 2017; 21: 5624-5629 Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma Z. WANG 1, Y.-J.

More information

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,

More information

Decreased expression of mir-490-3p in osteosarcoma and its clinical significance

Decreased expression of mir-490-3p in osteosarcoma and its clinical significance European Review for Medical and Pharmacological Sciences Decreased expression of mir-490-3p in osteosarcoma and its clinical significance B. TANG, C. LIU, Q.-M. ZHANG, M. NI Department of Orthopedics,

More information

Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4

Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4 European Review for Medical and Pharmacological Sciences 2017; 21: 4584-4590 Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing

More information

MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma

MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma European Review for Medical and Pharmacological Sciences MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma Y.-H. LIU 1, B. LI 1, F.-G. MENG 1, L. QIU 2 2017; 21:

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer

Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer European Review for Medical and Pharmacological Sciences 2017; 21: 4278-4282 Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer Q.-H. ZHOU 1, Y.-M. ZHAO 2, L.-L.

More information

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,

More information

Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for osteosarcoma

Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for osteosarcoma Int J Clin Exp Pathol 2016;9(1):186-190 www.ijcep.com /ISSN:1936-2625/IJCEP0018032 Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information

mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression

mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression EXPERIMENTAL AND THERAPEUTIC MEDICINE 7: 1757-1761, 2014 mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression ZHI YONG SHEN *, ZI ZHEN ZHANG *, HUA LIU, EN HAO ZHAO

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information

Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer

Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer European Review for Medical and Pharmacological Sciences 2019; 23: 2353-2359 Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer K. HUANG, W.-S. FAN, X.-Y. FU, Y.-L.

More information

Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis

Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis European Review for Medical and Pharmacological Sciences 2018; 22: 7178-7182 Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis T. ZOU, P.-L. WANG, Y.

More information

Original Article Increased expression of lncrna HULC indicates a poor prognosis and promotes cell metastasis in osteosarcoma

Original Article Increased expression of lncrna HULC indicates a poor prognosis and promotes cell metastasis in osteosarcoma Int J Clin Exp Pathol 2015;8(3):2994-3000 www.ijcep.com /ISSN:1936-2625/IJCEP0005023 Original Article Increased expression of lncrna HULC indicates a poor prognosis and promotes cell metastasis in osteosarcoma

More information

mir-132 inhibits lung cancer cell migration and invasion by targeting SOX4

mir-132 inhibits lung cancer cell migration and invasion by targeting SOX4 Original Article inhibits lung cancer cell migration and invasion by targeting SOX4 Yang Li, Lingling Zu, Yuli Wang, Min Wang, Peirui Chen, Qinghua Zhou Tianjin Key Laboratory of Lung Cancer Metastasis

More information

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng

More information

Research Communication

Research Communication IUBMB Life, 64(7): 628 635, July 2012 Research Communication MicroRNA-181b Targets camp Responsive Element Binding Protein 1 in Gastric Adenocarcinomas Lin Chen*, Qian Yang*, Wei-Qing Kong*, Tao Liu, Min

More information

Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion and metastasis

Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion and metastasis European Review for Medical and Pharmacological Sciences 2016; 20: 4445-4451 Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma JBUON 2018; 23(1): 157-162 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis

More information

Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer

Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer European Review for Medical and Pharmacological Sciences 2018; 22: 5525-5530 Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer Y.-X. SHI, B.-L. YE, B.-R. HU, X.-J.

More information

Expression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival

Expression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival European Review for Medical and Pharmacological Sciences 2017; 21: 5655-5660 Expression of lncrna TCONS_00027978 in hepatocellular carcinoma and its influence on prognosis and survival Q. CHEN 1, G.-D.

More information

CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer

CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer European Review for Medical and Pharmacological Sciences 2018; 22: 3713-3718 CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer N. LIU 1, J. ZHANG 1, L.-Y. ZHANG 1, L.

More information

Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis

Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis https://doi.org/10.1186/s13578-017-0192-0 Cell & Bioscience RESEARCH Open Access Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis Zhi Qiang Gao *,

More information

Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer

Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer Int J Clin Exp Pathol 2017;10(4):4688-4693 www.ijcep.com /ISSN:1936-2625/IJCEP0047128 Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer Jun Ma, Xiaokun

More information

95% CI: , P=0.037).

95% CI: , P=0.037). Biomedical Research 2017; 28 (21): 9248-9252 Reduced expression level of mir-205 predicts poor prognosis in Qiang Yang 1*#, Peng Sun 2#, Haotian Feng 1, Xin Li 1, Jianmin Li 1 1 Department of Orthopedics,

More information

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,

More information

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan

More information

mir-204 suppresses non-small-cell lung carcinoma (NSCLC) invasion and migration by targeting JAK2

mir-204 suppresses non-small-cell lung carcinoma (NSCLC) invasion and migration by targeting JAK2 mir-204 suppresses non-small-cell lung carcinoma (NSCLC) invasion and migration by targeting JAK2 P. Wang 1, H.Y. Lv 2, D.M. Zhou 1 and E.N. Zhang 1 1 Department of Oncology, the Yantaishan Hospital, Yantai,

More information

Original Article MicroRNA-370 directly targets FOXM1 to inhibit cell growth and metastasis in osteosarcoma cells

Original Article MicroRNA-370 directly targets FOXM1 to inhibit cell growth and metastasis in osteosarcoma cells Int J Clin Exp Pathol 2015;8(9):10250-10260 www.ijcep.com /ISSN:1936-2625/IJCEP0013027 Original Article MicroRNA-370 directly targets FOXM1 to inhibit cell growth and metastasis in osteosarcoma cells Ning

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1

More information

Knockdown of Long Noncoding RNA LUCAT1 Inhibits Cell Viability and Invasion by Regulating mir-375 in Glioma

Knockdown of Long Noncoding RNA LUCAT1 Inhibits Cell Viability and Invasion by Regulating mir-375 in Glioma Oncology Research, Vol. 26, pp. 307 313 0965-0407/18 $90.00 +.00 Printed in the USA. All rights reserved. DOI: https://doi.org/10.3727/096504017x15088061795756 Copyright Ó 2018 Cognizant, LLC. E-ISSN 1555-3906

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway

MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway INTERNATIONAL JOURNAL OF ONCOLOGY 54: 807-820, 2019 MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway LONG GUO 1, YU BAI 2, SHUZHE

More information

LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma

LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma European Review for Medical and Pharmacological Sciences 2018; 22: 1979-1986 LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma Z. ZHANG 1,

More information

Original Article microrna-217 was downregulated in ovarian cancer and was associated with poor prognosis

Original Article microrna-217 was downregulated in ovarian cancer and was associated with poor prognosis Int J Clin Exp Pathol 2016;9(8):8555-8559 www.ijcep.com /ISSN:1936-2625/IJCEP0026997 Original Article microrna-217 was downregulated in ovarian cancer and was associated with poor prognosis Qiong Pan,

More information

mir 483-5p promotes prostate cancer cell proliferation and invasion by targeting RBM5

mir 483-5p promotes prostate cancer cell proliferation and invasion by targeting RBM5 ORIGINAL ARTICLE Vol. 43 (6): 1060-1067, November - December, 2017 doi: 10.1590/S1677-5538.IBJU.2016.0595 mir 483-5p promotes prostate cancer cell proliferation and invasion by targeting RBM5 Zhi-Gang

More information

RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers

RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers Xu et al. Molecular Cancer (2019) 18:8 https://doi.org/10.1186/s12943-018-0932-8 LETTER TO THE EDITOR RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers

More information

MiR-329 suppresses osteosarcoma development by downregulating Rab10

MiR-329 suppresses osteosarcoma development by downregulating Rab10 MiR-329 suppresses osteosarcoma development by downregulating Rab10 Wenwei Jiang 1*, Jin Liu 2*, Tianyang Xu 1 and Xiao Yu 3 1 Department of Orthopedics, Shanghai Tenth People s Hospital, Tong Ji University

More information

Long Non-Coding RNA TUG1 Promotes Proliferation and Inhibits Apoptosis of Osteosarcoma Cells by Sponging mir-132-3p and Upregulating SOX4 Expression

Long Non-Coding RNA TUG1 Promotes Proliferation and Inhibits Apoptosis of Osteosarcoma Cells by Sponging mir-132-3p and Upregulating SOX4 Expression Original Article Yonsei Med J 2018 Mar;59(2):226-235 pissn: 0513-5796 eissn: 1976-2437 Long Non-Coding RNA Promotes Proliferation and Inhibits Apoptosis of Osteosarcoma Cells by Sponging mir-132-3p and

More information

ONCOLOGY LETTERS 15: , 2018

ONCOLOGY LETTERS 15: , 2018 10098 MicroRNA 154 functions as a tumor suppressor in non small cell lung cancer through directly targeting B cell specific Moloney murine leukemia virus insertion site 1 SIDA LIU 1, YANG YANG 2, LU CHEN

More information

Effect of lncrna LET on proliferation and invasion of osteosarcoma cells

Effect of lncrna LET on proliferation and invasion of osteosarcoma cells European Review for Medical and Pharmacological Sciences 2018; 22: 1609-1614 Effect of lncrna LET on proliferation and invasion of osteosarcoma cells G. KONG 1, X.-J. QI 2, J.-F. WANG 3 1 Department of

More information

Association of mir-21 with esophageal cancer prognosis: a meta-analysis

Association of mir-21 with esophageal cancer prognosis: a meta-analysis Association of mir-21 with esophageal cancer prognosis: a meta-analysis S.-W. Wen 1, Y.-F. Zhang 1, Y. Li 1, Z.-X. Liu 2, H.-L. Lv 1, Z.-H. Li 1, Y.-Z. Xu 1, Y.-G. Zhu 1 and Z.-Q. Tian 1 1 Department of

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

mir-218 tissue expression level is associated with aggressive progression of gastric cancer

mir-218 tissue expression level is associated with aggressive progression of gastric cancer mir-218 tissue expression level is associated with aggressive progression of gastric cancer X.X. Wang 1, S.J. Ge 2, X.L. Wang 2, L.X. Jiang 1, M.F. Sheng 2 and J.J. Ma 2 1 Department of General Surgery,

More information

Original Article Artemin promotes proliferation and metastasis in human laryngeal squamous cell carcinoma

Original Article Artemin promotes proliferation and metastasis in human laryngeal squamous cell carcinoma Int J Clin Exp Pathol 2017;10(10):10413-10418 www.ijcep.com /ISSN:1936-2625/IJCEP0058793 Original Article Artemin promotes proliferation and metastasis in human laryngeal squamous cell carcinoma Chao-Bing

More information

Cellular Physiology and Biochemistry

Cellular Physiology and Biochemistry Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0

More information

mir-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN

mir-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN mir-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN J.W. Ling 1, P.R. Lu 2, Y.B. Zhang 1, S. Jiang 1 and Z.C. Zhang 1 1 Department of Ophthalmology, Third Hospital of Zhangjiagang,

More information

Expression and functions of microrna-139 in osteosarcoma.

Expression and functions of microrna-139 in osteosarcoma. Biomedical Research 2017; 28 (22): 9879-9884 ISSN 0970-938X www.biomedres.info Expression and functions of microrna-139 in osteosarcoma. Qi Liao *, Jianghua Ming, Geliang Hu, Yaming Li, Chun Zhang, Yanchao

More information

Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma

Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Y.-J. Hu 1, X.-Y. Luo 2, Y. Yang 3, C.-Y. Chen 1, Z.-Y. Zhang 4 and X. Guo 1 1 Department

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

The lncrna MIR4435-2HG is upregulated in hepatocellular carcinoma and promotes cancer cell proliferation by upregulating mirna-487a

The lncrna MIR4435-2HG is upregulated in hepatocellular carcinoma and promotes cancer cell proliferation by upregulating mirna-487a Kong et al. Cellular & Molecular Biology Letters (2019) 24:26 https://doi.org/10.1186/s11658-019-0148-y Cellular & Molecular Biology Letters RESEARCH LETTER Open Access The lncrna MIR4435-2HG is upregulated

More information

LncRNA LET function as a tumor suppressor in breast cancer development

LncRNA LET function as a tumor suppressor in breast cancer development European Review for Medical and Pharmacological Sciences 2018; 22: 6002-6007 LncRNA LET function as a tumor suppressor in breast cancer development C.-X. ZHOU, X. WANG, N. YANG, S.-K. XUE, W.-C. LI, P.-P.

More information

Targeting effect of microrna on CD133 and its impact analysis on proliferation and invasion of glioma cells

Targeting effect of microrna on CD133 and its impact analysis on proliferation and invasion of glioma cells Targeting effect of microrna on CD133 and its impact analysis on proliferation and invasion of glioma cells C. Zhao 1,2 *, Z.G. Ma 3 *, S.L. Mou 4, Y.X. Yang 2, Y.H. Zhang 2 and W.C. Yao 1 1 Department

More information

Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17

Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17 Int J Clin Exp Pathol 2015;8(9):10922-10928 www.ijcep.com /ISSN:1936-2625/IJCEP0011715 Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17 Jiang-Tao

More information

Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients

Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients European Review for Medical and Pharmacological Sciences 2016; 20: 5126-5131 Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients F.-M. TIAN 1, F.-Q. MENG 2, X.-B. WANG

More information

mir-125a-5p expression is associated with the age of breast cancer patients

mir-125a-5p expression is associated with the age of breast cancer patients mir-125a-5p expression is associated with the age of breast cancer patients H. He 1 *, F. Xu 2 *, W. Huang 1, S.Y. Luo 1, Y.T. Lin 1, G.H. Zhang 1, Q. Du 1 and R.H. Duan 1 1 The State Key Laboratory of

More information

Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis

Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis B.-S. Li, H. Liu and W.-L. Yang Department of Gastrointestinal and Pancreatic Surgery, The Third Xiangya Hospital

More information

Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma

Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma Z.Q. Peng 1, R.B. Lu 2, D.M. Xiao 3 and Z.M. Xiao 1 1 Department of Orthopedics, The First Affiliated Hospital

More information

Regulatory role of microrna184 in osteosarcoma cells

Regulatory role of microrna184 in osteosarcoma cells Regulatory role of microrna184 in osteosarcoma cells G.R. Yin 1,2, Q. Wang 3, X.B. Zhang 2 and S.J. Wang 1 1 Department of Joint Surgery, The Second Hospital of Shandong University, Jinan, China 2 Department

More information

MicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1

MicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1 European Review for Medical and Pharmacological Sciences 2018; 22: 5954-5963 MicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1 B.-B. XU 1, Z.-F.

More information

RESEARCH ARTICLE Jianjun Han, et al.: mir-361-5p in breast cancer

RESEARCH ARTICLE Jianjun Han, et al.: mir-361-5p in breast cancer The Bosnian Journal of Basic Medical Sciences publishes an Advanced online manuscript format as a free service to authors in order to expedite the dissemination of scientific findings to the research community

More information

Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival

Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival European Review for Medical and Pharmacological Sciences 2017; 21: 3397-3401 Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival W.-X. LI 1, R.-L.

More information

Inhibiting mirna-30a-3p has anti-tumor effects in glioma cancer via PTEN

Inhibiting mirna-30a-3p has anti-tumor effects in glioma cancer via PTEN Inhibiting mirna-30a-3p has anti-tumor effects in glioma cancer via PTEN Liexiang Zhang 1,3,*, Wei Jin 2, Jing Zheng 3, Yuxiang Dai 2,Yue Song 1, Hongbin Ni 2, 1. Department of Neurosurgery, Nanjing Drum

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

MiRNA-485-5p, inhibits esophageal cancer cells proliferation and invasion by down-regulating O-linked N-acetylglucosamine transferase

MiRNA-485-5p, inhibits esophageal cancer cells proliferation and invasion by down-regulating O-linked N-acetylglucosamine transferase European Review for Medical and Pharmacological Sciences 2019; 23: 2809-2816 MiRNA-485-5p, inhibits esophageal cancer cells proliferation and invasion by down-regulating O-linked N-acetylglucosamine transferase

More information

Supplementary information

Supplementary information Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun

More information

Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients

Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients European Review for Medical and Pharmacological Sciences 2017; 21: 2103-2107 Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients J.-H. ZHANG 1,

More information

LncRNA AWPPH promotes the growth of triple-negative breast cancer by. up-regulating frizzled homolog 7 (FZD7)

LncRNA AWPPH promotes the growth of triple-negative breast cancer by. up-regulating frizzled homolog 7 (FZD7) Bioscience Reports: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date

More information

Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis

Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis European Review for Medical and Pharmacological Sciences 2018; 22: 7710-7715 Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis J.-F. ZHOU, H.-G. WANG,

More information

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Ling Xu, Wei-Qi Dai, Xuan-Fu Xu, Fan Wang, Lei He, Chuan-Yong Guo*

Ling Xu, Wei-Qi Dai, Xuan-Fu Xu, Fan Wang, Lei He, Chuan-Yong Guo* DOI:http://dx.doi.org/10.7314/APJCP.2012.13.7.3203 RESEARCH ARTICLE Effects of Multiple-target Anti-microRNA Antisense Oligodeoxyribonucleotides on Proliferation and Migration of Gastric Cancer Cells Ling

More information

Original Article MiR-506 suppresses proliferation and invasion of bladder cancer by targeting FOXQ1

Original Article MiR-506 suppresses proliferation and invasion of bladder cancer by targeting FOXQ1 Int J Clin Exp Pathol 2017;10(4):4538-4544 www.ijcep.com /ISSN:1936-2625/IJCEP0021257 Original Article MiR-506 suppresses proliferation and invasion of bladder cancer by targeting FOXQ1 Xiang Sun, Longhua

More information

Clinical significance of serum mir-21 in breast cancer compared with CA153 and CEA

Clinical significance of serum mir-21 in breast cancer compared with CA153 and CEA Original Article Clinical significance of serum mir-21 in breast cancer compared with CA153 and CEA Jianjian Gao, Qingyun Zhang, Jianjun Xu, Lijuan Guo, Xuefeng Li Key Laboratory of Carcinogenesis and

More information

http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA

http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2015 8 31 8 836 ~ 842 DOI 10 13865 /j cnki cjbmb 2015 08 09 FUT4-siRNA 5-aza-dC 1 3 * 1 1 3

More information

MiR-24 promotes migration and invasion of non-small cell lung cancer by targeting ZNF367

MiR-24 promotes migration and invasion of non-small cell lung cancer by targeting ZNF367 JBUON 2018; 23(5): 1413-1419 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE MiR-24 promotes migration and invasion of non-small cell lung cancer

More information

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of

More information

Reduction of angiocidin contributes to decreased HepG2 cell proliferation

Reduction of angiocidin contributes to decreased HepG2 cell proliferation Reduction of angiocidin contributes to decreased HepG2 cell proliferation Guan XG 1, Guan XQ 2, Feng K 3, Jian R 3, Tian D 1, Tian D 1, Tong HB 1, *Sun X 1 1. Life Science Research Center, Beihua University,

More information

Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis

Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis European Review for Medical and Pharmacological Sciences 2018; 22: 726-730 Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis H.-L. ZHANG 1, L. LI 2, C.-J.

More information

MicroRNA 761 is downregulated in colorectal cancer and regulates tumor progression by targeting Rab3D

MicroRNA 761 is downregulated in colorectal cancer and regulates tumor progression by targeting Rab3D EXPERIMENTAL AND THERAPEUTIC MEDICINE MicroRNA 761 is downregulated in colorectal cancer and regulates tumor progression by targeting Rab3D YUPENG REN, GANG SHI, PENG JIANG and QINGKAI MENG Department

More information

Original Article Low-expression of mir-7 promotes cell proliferation and exhibits prognostic value in osteosarcoma patients

Original Article Low-expression of mir-7 promotes cell proliferation and exhibits prognostic value in osteosarcoma patients Int J Clin Exp Pathol 2017;10(8):9035-9041 www.ijcep.com /ISSN:1936-2625/IJCEP0021883 Original Article Low-expression of mir-7 promotes cell proliferation and exhibits prognostic value in osteosarcoma

More information

LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PI3K/Akt pathway

LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PI3K/Akt pathway Original Article LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PIK/Akt pathway Jian Huang #, Lingfeng Zhao #, Wei Chen #, Jian Duan 4, Dibesh Shrestha, Ruize Zhou,

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

MicroRNA-30a functions as tumor suppressor and inhibits the proliferation and invasion of prostate cancer cells by down-regulation of SIX1

MicroRNA-30a functions as tumor suppressor and inhibits the proliferation and invasion of prostate cancer cells by down-regulation of SIX1 Human Cell (2017) 30:290 299 DOI 10.1007/s13577-017-0170-1 RESEARCH ARTICLE MicroRNA-30a functions as tumor suppressor and inhibits the proliferation and invasion of prostate cancer cells by down-regulation

More information

CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer

CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer European Review for Medical and Pharmacological Sciences 2018; 22: 8203-8209 CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer Z. GE,

More information

MicroRNA-145 inhibits tumour growth and metastasis in osteosarcoma by targeting cyclin-dependent kinase, CDK6

MicroRNA-145 inhibits tumour growth and metastasis in osteosarcoma by targeting cyclin-dependent kinase, CDK6 European Review for Medical and Pharmacological Sciences 2016; 20: 5117-5125 MicroRNA-145 inhibits tumour growth and metastasis in osteosarcoma by targeting cyclin-dependent kinase, CDK6 Y. LI 1, J. LIU

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

Original Article B7-H3 repression by mir-539 suppresses cell proliferation in human gliomas

Original Article B7-H3 repression by mir-539 suppresses cell proliferation in human gliomas Int J Clin Exp Pathol 2017;10(4):4363-4369 www.ijcep.com /ISSN:1936-2625/IJCEP0043994 Original Article B7-H3 repression by mir-539 suppresses cell proliferation in human gliomas Rong-Gang Li 1, Zhuo Gao

More information

LncSNHG14 promotes the development and progression of bladder cancer by targeting mirna-150-5p

LncSNHG14 promotes the development and progression of bladder cancer by targeting mirna-150-5p European Review for Medical and Pharmacological Sciences 2019; 23: 1022-1029 LncSNHG14 promotes the development and progression of bladder cancer by targeting mirna-150-5p J. LI 1,2, A.-S. WANG 2, S. WANG

More information

Original Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2

Original Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2 Int J Clin Exp Pathol 2017;10(3):2744-2753 www.ijcep.com /ISSN:1936-2625/IJCEP0046135 Original Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2 Ting Wang

More information

MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer

MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer European Review for Medical and Pharmacological Sciences MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer J.-X.

More information

Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer

Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer Int J Clin Exp Pathol 2016;9(4):4241-4246 www.ijcep.com /ISSN:1936-2625/IJCEP0012296 Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer Hong Jiang,

More information