Rin1 is a Negative Regulator of the IL3 Receptor Signal Transduction Pathways

Transcription

1 Rin1 is a Negative Regulator of the IL3 Receptor Signal Transduction Pathways C.M. HUNKER, A. GALVIS, M.L. VEISAGA and M.A. BARBIERI Department of Biological Sciences, Florida International University, University Park, Miami, Florida 33199, U.S.A. Abstract. Cytokines interact with cell-surface receptors, initiating signaling cascades that promote cell growth while inhibiting the pathways of apoptotic cells. Rin1 is a multifunctional protein that has been shown to regulate EGF receptor signaling and endocytosis. To examine the role of Rin1 in IL3 receptor signaling pathways, Rin1 and deletion mutants were expressed in cells using a retrovirus system. In this study, the overexpression of Rin1 molecules was shown to selectively block IL-3 activation of the Ras-Erk1/2 and PI3K/Akt pathways and the IL-3-stimulated incorporation of [ 3 H] thymidine into DNA without a significant effect on the activity of the JNK and p38k pathways. Moreover, the depletion of Rin1 by RNA interference induced cell growth. In addition, Rin1 was also required as a downstream effector of BCR/ABL-induced cell proliferation. Interestingly, the expression of Rin1 selectively blocked the activation of Erk1/2 induced by the BCR/ABL oncogene. These results demonstrate that Rin1 plays an essential and selective role in both IL3- and BCR/ABLinduced cell proliferation and highlight a new function for Rin1 in leukemic cells. Cytokines interact with cell-surface receptors initiating signaling cascades that promote cell growth and survival (1, 2). The JAK/STAT, Raf/Mek/Erk and PI3K/Akt signaling pathways are activated by a variety of cytokines, including interleukin 3 (IL3) (1-3). Signaling through IL3/IL3-receptor interaction has been widely studied as a prototype for how cytokines regulate signal transduction pathways, which, in turn modulate normal and abnormal hematopoiesis (4-10). The abnormality first described as the Philadelphia chromosome Abbreviations: Rin1, Ras interference 1; EGF, epidermal growth factor; Erk1/2, extracellular signal-regulated kinase; GEF, guanine nucleotide exchange factor; GFP, green fluorescence protein; JNK, Jun N-terminal kinase; p38k, p38 protein kinase; IL3, interleukin 3. Correspondence to: M.A. Barbieri, Florida International University, Department of Biological Sciences, S.W. 8th Street-OE167, Miami, FL, 33199, U.S.A. Tel: , Fax: , e- mail: barbieri@fiu.edu Key Words: Signal transduction, Rin1, Ras, BCR/ABL. (9:22 translocation) is often found in patients with leukemia, commonly with chronic myelogenous (>95%) and less commonly with acute lymphocytic leukemia (<40%). Much research has been focused on understanding the consequence and cause of this alteration and it has been shown that the Philadelphia chromosome results in the fusion of sequences from the BCR and ABL genes (11-18). The BCR/ABL fusion product is an activated tyrosine kinase that confers survival and proliferation advantages to hematopoietic cells, thus contributing to leukemogenesis. Several common points of convergence between cytokinegrowth factor signaling and BCR/ABL oncogenesis have been described and cells expressing BCR/ABL no longer require exogenous cytokines (i.e. IL3) for their continual growth or survival (4-10, 19). Thus, in cancer cells BCR/ABL constitutively activates various intracellular signaling pathways, such as those involving Ras, Erk1/2, phosphatidylinositol 3- kinase (PI3K), STAT5 and NFκB to regulate cell growth and prolong survival (4-10, 19). Under normal circumstances, these pathways are involved in the regulation of hematopoiesis by hematopoietic cytokines and other extracellular stimuli. Furthermore, it has been suggested that PI3K and Ras are independently regulated by the BCR/ABL oncogene (20). Interestingly, Ras interference 1 (Rin1), a multi-domain protein that contains a proline rich region, has been shown to interact with c-abl (21). However, the possible involvement of Rin1 in a downstream signaling from BCR/ABL remains to be examined. In this study, it is demonstrated that both overexpression and depletion of Rin1 affects both the IL3-receptor and BCR- ABL signal transduction pathways. The overexpression of Rin1 was found to selectively block the IL3 activation of the Ras- Erk1/2 kinase and PI3K/Akt pathways and IL3-stimulated incorporation of [ 3 H] thymidine into DNA without a significant effect on the activity of the JNK and p38k pathways. Moreover, the depletion of Rin1 by RNA interference induced cell growth. In addition, Rin1 is also required as a downstream effector of BCR/ABL-induced cell proliferation. Interestingly, the expression of Rin1 selectively blocked the activation of Erk1/2 induced by the BCR/ABL oncogene. These results demonstrate that the Rin1, PI3K/Akt /2006 $

2 and Raf/Erk1/2 signal transduction pathways play essential and selective roles in both IL3- and BCR/ABL-induced cell proliferation and suggest a new function for Rin1 in both normal and cancer cells. Materials and Methods Materials and cell lines. The HL-60 and K562 cells were obtained from the American Type Culture Collection (Rockville, MD, USA). A polyclonal antibody against GFP was obtained from Upstate. An antihisg monoclonal and anti-gst polyclonal antibodies came from Invitrogen (Carlsbad, CA, USA), the anti-flag polyclonal antibody from Sigma and the HA antibody from Usptate. The mouse monoclonal and polyclonal anti-ras and anti-rin1 antibodies were obtained from BD Biosciences Pharmingen. The anti-il3 receptor - subunit antibody, anti-tyrosine (PY20), anti-abl and anti-bcr antibodies for Western blot were purchased from Transduction Laboratories. The phospho-p42/44 (Erk1/2), phospho- Raf, phospo- Elk1 and phospho-akt antibodies were purchased from Cell Signaling Technology. The phospho-jnk and phospho-p38k antibodies, as well as total anti-erk1/2, AKT, p38k, Raf and JNK, were purchased from Sigma-Aldrich. FuGENE6 and LipofectAMINE 2000 were purchased from Roche and Invitrogen, respectively. Recombinant human IL3 was purchased from Calbiochem and Upstate Biotechnology, respectively. The commercial sources for electrophoresis reagents, culture media, sera, films and HRP-linked secondary antibodies, and the ECL detection system for immunoblot detection have been described previously (26). All other reagents were from Sigma unless otherwise noted. Construction of recombinant pmx-retroviruses. The cdnas of Rin1 and mutants were subcloned into the pmx-puro vector as described (22). These were used for the transfection of a 60% confluent PhoA cell monolayer using a Fugene6-mediated procedure (Life Technologies, Inc.). The cells were maintained at 37ÆC and the media containing released viruses were harvested 48 h after transfection. The virus stocks were aliquoted and kept frozen at 80ÆC before use. The Rin1 mutants were generated as described earlier (23). Cell lines. The cell lines were generated by infecting HL-60 (BCR/ABL-negative cell line) and K562 (BCR/ABL-positive cell line) cells with retrovirus encoding GFP, Rin1wild-type (WT) and deletion mutants essentially as described earlier (22-25). Immunoblot analysis of protein expression. The cell lysates (20 Ìg) were analyzed by 10% SDS-PAGE, and the proteins were transferred to a nitrocellulose membrane (Millipore) using a Bio-Rad semi-dry transfer apparatus. The membrane was probed with specific antibodies as described in each figure, and the immunoblot was developed using the ECL reagents (Amersham Corp). Immunoprecipitation. The cells (HL-60 and K562) were incubated in the presence or absence of IL3, as indicated in each figure legend, at 37ÆC. The cells were then washed and lysed in ice-cold lysis buffer (50 mm Tris-HCl, 150 mm NaCl, 1% Triton X-100, 10% glycerol, 1 mm EDTA, 1 mm DTT, 1 mm benzamidine, 1 mm phenylmethylsulfonyl fluoride, 1 mm Na 3 VO 4, 30 mm NaPPi, 10 mm NaF, 100 nm okadaic acid, ph 7.5 and a protease inhibitor mixture (Roche Molecular Biochemicals). The lysate was clarified by centrifugation at 16,000 xg for 10 min at 4ÆC. The protein concentration in the cell lysates was determined using a detergent-compatible protein assay (Bio-Rad). To immunoprecipitate the IL3 receptor, the cell lysates were incubated for 12 h at 4ÆC with 2.5 Ìl of anti-il3 receptor -chain antibody. Immunoprecipitates were washed 3 times with the lysis buffer and twice with the wash buffer (50 mm Tris-HCl, 10 mm MgCl 2, 1 ÌM DTT (ph 7.5) and assayed using anti-rin1 antibodies by Western blot analysis. To immunoprecipitate BCRABL, the cell lysates were incubated for 12 h at 4ÆC with anti-abl antibody. The immunoprecipitates were washed 3 times with the lysis buffer and once with buffer (50 mm Tris- HCl, 10 mm MgCl 2, 1 ÌM DTT (ph 7.5) and were assayed using wash anti- Rin1 antibodies by western blot analysis. Kinase assay. The control and Rin1 cell lines were incubated in the presence or in the absence of IL3, as indicated in each figure legend, at 37ÆC. The cells were then washed and lysed in ice-cold lysis buffer. The lysate was clarified as described above. The protein concentration in the cell lysates was determined using a detergent-compatible protein assay (Bio-Rad). For Erk1/2 activation analysis, 10 Ìg of total protein from lysates were analyzed by 10% SDS-PAGE and transferred to a nitrocellulose membrane using a wet transfer apparatus (Bio-Rad). The membranes were probed with antibodies against total Erk1/2 and phospho-erk1/2. The immunoblots were developed using Super Signal reagents (Pierce). For p38k and JNK activation analysis, 10 Ìg of total protein from the lysates were analyzed by 10% SDS-PAGE and transferred to a nitrocellulose membrane using a wet transfer apparatus (Bio-Rad). The membranes were probed with antibodies against total p38k, phospho-p38k, total JNK and phospho-jnk. The immunoblots were developed using Super Signal reagents (Pierce). For Akt1 activation analysis, 20 Ìg of total protein from the lysates were analyzed by 10% SDS-PAGE and transferred to a nitrocellulose membrane using a wet transfer apparatus (Bio-Rad). The membranes were probed with antibodies against total Akt1 and phospho-akt1 and the immunoblots were developed using Super Signal reagents (Pierce). For PI3K activation analysis, the anti-p85 immunoprecipitates were incubated with [Á- 32 P] ATP and phosphatidylinositol (PI) as a substrate (26). 32 P-labelled phosphatidylinositol-phosphate (PIP) was resolved by thin layer chromatography (TLC) and visualized by autoradiography. Each stop containing the PIP was then quantified by scintillation counting. Analysis of DNA synthesis. The cell lines (0.5x10 5 cells/ml, ~ 60% confluence) were seeded into 12-well dishes. The cells were then starved in DMEM without serum for 36 h. For the last 12 h they were incubated in either the absence or the presence of IL3. For the last 4 h they were labelled with 2 µci/ml of methyl-[ 3 H] thymidine. After the incubation, the cells were washed 3 times with phosphate-buffered saline. Cold 10% (w/v) trichloroacetic acid was then added and the cells were solubilized with 1 M NaOH. Tritium was measured by scintillation counting. RNA interference. Three pairs of 21 nucleotide sense and antisense RNA oligonucletides protected by 2 3 -overhang (2 deoxy) thymidines (dt) were synthesized by Ambion. The sirnas synthesized correspond to the human Rin1 coding nucleotides AAGCGGGAGA AATTCAAGAGA (R1a) and AACATGT CCTGGAGAAGTCAT (R1b); to the human Rin2 coding nucleotides AAGAGAAGAGG AAGATGGCA (R2a) and AACAACCGCAAGCTGTACAAG (R2b); and to the human Rin3 coding nucleotides AAGCTCATT 906

3 Hunker et al: Rin1 and IL3 Receptor Signaling GACACAATTGCC (R3a) and AACTGAAACAGGAGATGGTGC (R3b). The sirna synthesized correspond to the GFP coding nucleotides AACTCT CCACTGACAGAGAATCCTGTCTC (G). Equal amounts of sense and antisense RNA oligonucleotides were mixed and annealed, according to the manufacturer s protocol, to form RNA duplexes before transfection. The cells in 6-well plates were transfected twice ( ~ 60% confluence; 1 ml of DMEM/fetal bovine serum per well) with 4 Ìl of 20 ÌM sirna duplex and 3 Ìl of liofectamine2000 reagent in 100 Ìl of Opti-MEM medium according to the manufacturer s recommendations at 12-h intervals. For transfections in which 3 sirna duplexes were included, the amount of each duplex was decreased so that the final sirna concentration remained constant between experiments. The cells were placed into normal growth culture medium 6 h prior to the experiments, which were performed 3 days after the initial transfection. Pull down assay. Small GTPase activation in cells was examined by using activation-specific probes for Ras (GST-Raf-RBD) as described previously (27). In brief, the cells were lysed and incubated with the fusion proteins pre-coupled to glutathione-agarose beads. GTP-bound small GTPase was eluted from the beads and analyzed by immunoblotting. The detected bands were analyzed by densitometry. The experiments were repeated 3 times with similar results. Results Expression of Rin1 in HL-60 cells. Rin1, a multifunctional protein, has been shown to regulate EGF receptor membrane trafficking and signaling (22-24). Rin1 contains several domains, including an SH 2 (Src homology 2) domain, a proline-rich domain, a Vps9p domain and a region involved in the binding of activated Ras (22-24). To examine the potential role of Rin1 in IL3 receptor signaling, a pmxpuro retrovirus system, an approach that allows for the efficient expression of proteins into a variety of cells, was used. Initially, the ability of the retrovirus to express Rin1:WT and mutants was assessed in HL-60 cells, which do not express the BCR/ABL oncogene. The cells infected with retrovirus encoding either green fluorescence protein (GFP) alone or His-tagged Rin1:WT and deletion mutants were immunoblottled for the presence of Rin1 (Figure 1). The expression of endogenous Rin1 in HL-60 cells was not affected by the overexpression of GFP. To ensure that the antibodydetected Rin1 proteins were, in fact, due to retrovirus infection, these cell extracts were also immunoblottled with His-specific antibody. Rin1 selectively blocks IL3 activation of Erk1/2 pathways. It has been shown that the addition of IL3 leads to the activation of Ras and, hence, to the activation of the downstream mitogenicactivated protein kinases, Erk1/2 (28, 29). It is well established that Ras plays a major role in the activation of the Erk1/2-Elk1 signaling pathway by BCR-ABL or by cytokine receptors, including the IL3 receptor (29, 30). Activation of the IL3 receptor also stimulated other signaling pathways, including the PI3K/Akt pathways (20). Thus, to explore the possibility that Figure 1. Expression of Rin1 proteins in HL-60 cells. The HL-60 cells were either infected with retrovirus encoding green fluoresence protein (GFP), His-Rin1: wild-type (WT), His- Rin1:N, or His-Rin1:C as described in the Materials and Methods. After selection of the infected cells with puromycin, cell extracts (12 Ìg) were prepared and the proteins were resolved by SDS-PAGE and then transferred to nitrocellulose for immunoblotting analysis with anti-rin1 antibodies, anti-gfp antibodies and anti-his antibodies. Rin1 may selectively affect IL3 receptor signaling pathways, the activity of Erk1/2, Akt, p38k and JNK proteins in HL-60 cells expressing either GFP (control) or Rin1 constructs (Figure 1) was analyzed. The HL-60 cells were stimulated with IL3 and the cell lysates were analyzed by SDS-PAGE. Erk1/2, Akt, JNK and p38k activities were then measured by Western blotting with phospho-specific antibodies for each kinase. The data shown in Figure 2A suggest that the overexpression of Rin1 constructs selectively inhibits Erk1/2 activity (control cells + IL3= 100%; cells expressing Rin1:WT+IL3=36±4%; cells expressing RIN1:N+IL3=82±12%; cells expressing RIN1:C+IL3=30±9%) without affecting JNK and p38k activities (Figure 2C and D). In addition, a lesser, although still significant, inhibition of the Akt activity (control cells + IL3=100%; cells expressing Rin1:WT+IL3=71±6%; cells expressing RIN1:N+IL3=62±7%; cells expressing RIN1:C+IL3=90±9%) was observed upon addition of IL3 (Figure 2B). Our data suggest that Rin1 plays a major role in the Erk1/2 and Akt pathways driven by the IL3 receptor in HL-60 cells. Rin1 does not block IL3 activation of Ras. Given the selective linkage shown above between the Rin1 and Erk1/2 pathways in HL-60 cells, we further examined the time-dependent IL3- stimulation of Erk1/2 in cells expressing GFP, Rin1:WT, or 907

4 Figure 2. The effects of Rin1 on the IL3-dependent signaling pathways. The HL-60 cells expressing either GFP, Rin1: WT, Rin1: N or Rin1: C were incubated in the absence or in the presence of 50 ng/ml IL3 at 37ÆC for 6 min, washed and the cell lysates were prepared as described in the Materials and Methods. The cell proteins were separated by SDS-PAGE, blotted to nitrocellulose and antibody to (A) phospho-erk1/2 and total Erk1/2, (B) phospho-p38 kinase and total p38 kinase, (C) phospho-jn kinase and total JN kinase and (D) phospho-akt1 and total Akt1 were used to visualize these proteins. The experiment was repeated 3 times with similar results. 908

5 Hunker et al: Rin1 and IL3 Receptor Signaling Figure 3. Activation of the Erk pathway in HL-60 cells expressing Rin1 and its mutants. The HL-60 cells expressing either GFP, Rin1: WT, Rin1: N or Rin1: C were incubated in the absence or the presence of 50 ng/ml IL3 at 37ÆC for the indicated times, washed and the cell lysates were prepared as described in the Materials and Methods. The cell proteins were separated by SDS-PAGE, blotted to nitrocellulose and (A) the Erk1/2 proteins were visualized with antibodies to phospho Erk1/2 and total Erk1/2. (B) Mek and (C) Raf were visualized with antibodies to phospho-mek, phospho-raf, total Mek and total Raf, respectively. (D) The activated Ras small GTPase was affinity purified from cell lysates as described in the Materials and Methods. Eluates from precipitates were subjected to Western blot analysis with anti-hras antibodies. The relative Ras activity was quantified by densitometric analysis. The results represent the mean±sd from 3 independent experiments performed in duplicate. 909

6 Rin1 deletion mutants by using anti-phospho-erk1/2 antibodies in HL-60 cells. In Figure 3A, the time course of inhibition and activation of protein in the MAP-kinase cascade in cells expressing Rin1 constructs in response to IL3 are shown. The time course of this cascade is shown in the control cells, where Erk1/2 is fully activated at 3-min incubation in the presence of IL3. Furthermore, the phosphorylation of Mek (Figure 3B) and Raf (Figure 3C) were found to be blocked in those cells expressing Rin1:WT and Rin1:C. The expression of Rin1:N shows very little effect on the activation of Erk1/2, Mek and Raf (Figure 3A-C), suggesting a potential role for Rin1 just downstream of the Ras GTP-bound form. We next examined the effect of the Rin1 constructs on the GTP-loading of Ras upon stimulation with IL3. As shown in Figure 3D, treatment of HL-60 cells with IL3 induced the activation of Ras. However, the expression of Rin1:WT, Rin1:N and Rin1:C did not alter the activation of Ras (GTP-bound form) upon the addition of IL3. These data indicate that Rin1 plays a key role during the activation of the Raf/Mek/Erk1/2 pathway, by affecting the phosphorylation and /or activation of Mek and Raf without affecting the GTP-loading of Ras. Effects of Rin1 on the PI3K/Akt pathway. It is also well established that cytokines activate both PI3K and Akt proteins (18, 30, 31). The activation of PI3K has been associated both with the interaction of the SH 2 domain of the p85 subunit with the cytokine receptor tail and with the association of the p110 subunit with GTP-bound Ras. We first examined the activity of PI3K in HL-60 cells expressing the Rin1 constructs. In Figure 4A, the time course of the activation of PI3K upon the addition of IL3 either in cells expressing GFP (control) or in cells expressing the Rin1 constructs is shown. IL3 stimulation of the control cells resulted in a time-dependent stimulation of PI3K activity, where PI3K was partially activated after 1 min of incubation. The PI3K activity was inhibited by the expression of Rin1:WT and Rin1:N, but not by the expression of RIN1:C. The role of Rin1 in the time-dependent activation of Akt by IL3 in HL-60 cells expressing GFP, Rin1:WT and mutants was examined by using anti-phospho Akt antibodies. The IL3 stimulation of the GFP-infected cells resulted in a timedependent activation of Akt activity, where Akt was partially activated after 3 min of incubation. Moreover, the addition of IL3 partially activated Akt in cells expressing Rin1:WT and Rin1:N, but not the Rin1:C construct (Figure 4B). These results suggest that Rin1 is involved in the IL3-induced PI3K/Akt pathway. Taken together, these data suggest that Rin1 may have a dual action as an effector for both Ras and the IL3 receptor and /or activated kinases. In vivo associations have shown that Rin1: WT and Rin1:N, but not Rin1:C, interact with the IL3 receptor tail through the N- terminal region of Rin1, which contains the SH 2 domain (see Figure 7). Similarly, Rin1:WT and Rin1:C, but not RIN1:N, are associated with Ras. Effect of Rin1 on IL3-induced cell growth in HL-60. The growth-promoting or mitogenic effects of IL3 appear to involve many of the pathways utilized by other growth factors and cytokines, including GM-CSF and EPO, whose receptors do not have intrinsic tyrosine kinase activity (28). To determine whether the expression of Rin1 alters IL3- induced cell-growth, the effects of Rin1 overexpression on cell proliferation were investigated. HL-60 cell lines expressing vector alone, Rin1:WT and Rin1 deletion mutants were transfected as described in Materials and Methods. Cells expressing the Rin1 constructs were stimulated with IL3 and the incorporation of [ 3 H] thymidine was measured. In Figure 5A, the expression of Rin1:WT is shown to block IL3- stimulated cell proliferation as determined by thymidine incorporation. In addition, basal thymidine incorporation was not significantly inhibited by the expression of Rin1 (Figure 5A). To identify the domains of Rin1 that might mediate the inhibition of [ 3 H] thymidine incorporation into DNA, HL-60 cell lines expressing the N-and C-terminal regions of Rin1 were prepared. The N-terminal region of Rin1 contains the SH 2 and proline-rich domains and the C-terminal region contains the Vps9p and Ras-binding domains. Expression of both Rin1:N and Rin1:C inhibited the incorporation of [ 3 H] thymidine into DNA in cells treated with IL3 (control cells + IL3= 100%; cells expressing Rin1:WT+IL3=50±10%; cells expressing RIN1:N+IL3=80±5; cells expressing RIN1:C+IL3=60±7%). To provide additional evidence for the role of Rin1 in IL3- driven cell proliferation, Rin1 was depleted from HL-60 cells by using Rin1 RNA interference, as described in Materials and Methods. The depletion of Rin1 by RNA interference clearly showed a significant enhancement in the incorporation of [ 3 H] thymidine into DNA (Figure 5B). Furthermore, it seems that Rin1 and Rin3, but not Rin2, might be required for IL3-induced cell growth since the depletion of Rin2 did not have a significant effect on the incorporation of [ 3 H] thymidine into DNA. The effective depletion of Rin1 and Rin1-like molecules (Rin2 and Rin3) are illustrated in the Figure 5 insert. For Rin1, more than 95% of the protein (and tagged protein version) was eliminated by the 2 RNAi duplexes. Because antibodies that recognize endogenous Rin2 and Rin3 were not available, HA- and Flag-tagged Rin2 and Rin3 were generated and expressed in the HL-60 cells. The experiment with Rin1 validates the use of heterologously expressed tagged-proteins for testing the efficiency of RNA interference. As was the case with Rin1, the levels of Rin2 and Rin3 were reduced by more than 99% using the 2 RNAi duplexes, as determined using antibody directed against each epitope tag as described in Materials and Methods. Taken together, these observations suggest that the requirement of Rin1 in IL3-induced cell growth might be related to the ability to alter one or more intracellular signaling transduction pathway. 910

7 Hunker et al: Rin1 and IL3 Receptor Signaling Figure 4. Activation of PI3K and Akt1 in HL-60 cells expressing Rin1 and its mutants. (A) The HL-60 cells expressing either GFP, Rin1: WT, Rin1: N or Rin1: C were incubated in the absence or the presence of 50 ng/ml IL3 at 37ÆC for the indicated time, washed and the cell lysates were prepared as described in Materials and Methods. The cell proteins were separated by SDS-PAGE, blotted to nitrocellulose and the Akt1 proteins were visualized with antibodies to phospho-akt1 and total Atk1. (B) The activity of PI3-kinase was analyzed by TLC as described in Materials and Methods. The relative PI3K activity was analyzed by measuring the amount of radioactivity ( 32 P) incorporated into phosphatidylinositol (PI). The results represent the mean±sd from 3 independent experiments performed in duplicate. 911

8 Figure 5. Rin1 is required for cell proliferation in HL-60 cells. (A) The HL-60 cells expressing either GFP, Rin1: WT, Rin1: N or Rin1: C were incubated in the absence or the presence of 10 ng/ml IL3 at 37ÆC for 24 h and the incorporation of [ 3 H] thymidine into the DNA was determined as described in Materials and Methods. The results represent the mean±sd from 3 independent experiments performed in duplicate. (B) The HL-60 cells expressing GFP, His-Rin1:WT, HA-Rin2:WT or Flag-Rin3:WT were transfected with sirnas ( R1a, R2a, R3b and G) as indicated in Materials and Methods. The transfected cells were then incubated in the absence or in the presence of 10 ng/ml IL3 at 37ÆC for 24 h and the [ 3 H] thymidine incorporation into DNA was determined as described in Materials and Methods. The results represent the mean SD from 2 independent determinations performed in duplicates. Insert: The cell proteins were separated by SDS-PAGE, blotted to nitrocellulose and anti-gfp, anti-his, anti-ha and anti-flag antibodies were used to visualize these proteins. The experiment was repeated 3 times with similar results. 912

9 Hunker et al: Rin1 and IL3 Receptor Signaling Figure 6. Rin1 interacts with BCR/ABL in K562 cells. (A) The K562 cell line expressing Rin1:WT, Rin1:N or Rin1:C was incubated in the absence or in the presence of 50 ng/ml IL3 for 8 min at 37ÆC. The cells were lysed and immunoprecipitated (IP) with anti-abl antibody. The proteins were then separated by SDS-PAGE and blotted to nitrocellulose. The immunoprecipitated cells were subjected to Western blotting (WB) with Rin1 antibodies. (B) The cell lysates obtained from the K562 and HL-60 cells, incubated in the absence or the presence of IL3, were immuno-precipitated (IP) with anti-il3 receptor -chain antibody. The proteins were then separated by SDS-PAGE and blotted to nitrocellulose. The immunoprecipitated cells were subject to Western blotting (WB) with Rin1 and anti-il3 receptor -chain. The positions where molecular mass standards ran on the gel are indicated. Specific association of Rin1 with the IL3 receptor and BCR/ABL in K562 cells. K562, a cell line that expresses BCR/ABL, was either left untreated or treated with IL3 and the cell lysates were immunoprecipitated with an anti-abl antibody and were then immunoblotted with anti-abl and anti-rin1 antibodies. A 210-kDa protein band corresponding to BCR/ABL was detected. This protein was tyrosine phosphorylated (data not shown). In addition to the 210 kda band, another band of ~ 90 kda was also detected and there was a very marked interaction even in the absence of IL3. By probing this membrane with anti-rin1 antibody, we demonstrated that the ~ 90 kda band corresponded to Rin1. Thus, the association of Rin1 with BCR/ABL occurs independently of the addition IL3 (Figure 6A). Furthermore, Rin1:N, but not Rin1:C, also interacted with BCR/ABL. Again, this association occured independently of IL3. The next investigation focussed on whether Rin1 interacts with the IL3 receptor in the K562 and HL-60 cell lines. In HL- 60 cells, we observed that, upon addition of IL3, Rin1 was coimmunoprecipitated with the IL3 receptor. However, to our surprise, Rin1 was not associated with the IL3 receptor even in the presence of IL3 (Figure 6B). In addition, the IL3 receptor was tyrosine phosphorylated in both cell lines (data not shown). Consistent with this observation, Rin1 was constitutively associated with the BCR/ABL oncoprotein in the K562 cells. These results suggest that Rin1 is selectively bound to the IL3 receptor in the BCR/ABL-negative cell line. However, in the BCR/ABL-positive cell line, Rin1 was associated with BCR/ABL but not with the the IL3 receptor, even in the presence of IL3. Effect of Rin1 on BCR/ABL-induced cell growth in K562. Several points of convergence between cytokine signaling and BCR-ABL oncogenesis have been described and cells expressing BCR-ABL no longer require exogenous cytokines (IL3 or GM-CSF) for their proliferation and/or survival by activation of several signaling molecules, including kinases and GTPases (28). To determine whether the expression of Rin1 or its mutants affects cell growth induced by BCR-ABL, the effects of Rin1 overexpression on cell proliferation were investigated. The K652 cell line expressing the vector alone, Rin1:WT or Rin1 mutants was transfected as described in Materials and Methods. The cells expressing Rin1:WT and Rin1:C, but not Rin1:N, were incubated either in the presence or in the absence of IL3, and the incorporation of [ 3 H] thymidine was 913

10 Figure 7. Rin1 blocks the BCR/ABL activation of cell growth. (A) The K652 cells expressing either GFP, Rin1: WT, Rin1: N or Rin1: C were incubated in the absence or the presence of 10 ng/ml IL3 at 37ÆC for 24 h and the incorporation of [ 3 H] thymidine into DNA was determined, as described in Materials and Methods. The results represent the mean±sd from 3 independent experiments performed in duplicate. (B) K652 cells expressing GFP, His- Rin1:WT, HA-Rin2:WT or Flag-Rin3:WT were transfected with sirna as indicated in Materials and Methods. The transfected cells were then incubated in the absence or in the presence of 10 ng/ml IL3 at 37ÆC for 24 h and [ 3 H] thymidine incorporation into DNA was determined as described in Materials and Methods. The results represent the mean±sd from 2 independent experiments performed in duplicate. (C) The activation of Erk1/2 and Akt in K652 cells expressing either GFP or Rin1:WT was analyzed by antibody to phospho-erk1/2 and total Erk1/2 and (D) phospho-akt1 and total Akt1, respectively. The experiment was repeated 3 times with similar results. measured. As expected, the addition of IL3 did not affect the proliferation of the K652 control cells (Figure 7A). We also found that the expression of Rin1:WT and Rin1:C blocked BCR/ABL-induced cell proliferation, as determined by thymidine incorporation. The expression of Rin1:N also significantly inhibited thymidine incorporation (control cells + IL3= 100%; control cells -IL3=95±6%; cells expressing Rin1:WT -IL3=42±10%; cells expressing Rin1:N - IL3=78±6%; cells expressing Rin1:C -IL3=39±6%). To provide additional evidence for the role of Rin1 in BCR/ABL-driven cell proliferation, Rin1 was depleted from K562 cells by using Rin1 RNA interference, as described in Materials and Methods. The depletion of Rin1 by RNAi clearly showed a significant enhancement in the incorporation of [ 3 H] thymidine into DNA (Figure 7B). Similar results were also found by the depletion of Rin3, but not of Rin2, proteins. In addition, the effectiveness of the depletion of Rin1 and Rin1- like molecules (Rin2 and Rin3) was also confirmed by Western blot analysis (data not shown). Furthermore, the expression of Rin1:WT (Figure 7C) and Rin1:C, but not Rin1:N (data not shown), blocked only the activation of Erk1/2 but not that of Akt (Figure 7D). These results suggest that Rin1, and probably Rin3, are required for BCR/ABL-induced cell growth. Discussion The present study provides evidence for the role of Rin1 in the IL3 receptor- and BCR/ABL-dependent signaling pathways. We identified Rin1 as a key element in both signaling pathways. This observation is supported by the fact that Rin1 was shown to alter the Raf/Mek/Erk1/2 pathway without affecting the activity of the JN- and p38-kinase pathways. Furthermore, Rin1 played a role in the activation of the PI3K/Akt pathway regulated by IL3. In contrast, Rin1 only inhibited the Raf/Mek/Erk1/2 signaling pathway stimulated by BCR/ABL. The use of the pmx-puro retrovirus system to generate cell lines was important because they express endogenous levels of the IL3-receptor and BCR-ABL fusion protein, and proliferation in these cells is mainly driven by these signaling molecules. The IL3- receptor has served as model for signal 914

11 Hunker et al: Rin1 and IL3 Receptor Signaling Figure 8. Model for the role of Rin1 in BCR/ABL-positive and -negative leukemic cells. (A) Autophosporylation of BCR-ABL generates phosphorylated tyrosines (i.e. tyr 177), which in turn bind Grb2 molecules. This leads to the binding and phosprylation of Gab2. This activates Gab2 signals to recruit molecules, including PI3K, which is required for Akt activation. On the other hand, Grb2 will interact with SOS, which activates Ras. The activation of Ras leads to the activation of Erk1/2. (B) Activation of the IL3 receptor by IL3 induces the activity of the JAK/STAT (not shown), Raf/Erk1/2 and PI3K/Akt pathways. Both Akt and Erk1/2 then send signals to regulate survival/proliferation/transformation. The site of Rin1 action is indicated in this figure. transduction studies and many IL3-receptor-associated molecules have been characterized (28). As shown in this study, Rin1 altered both Erk1/2 and Akt pathways, suggesting a specific and selective role of Rin1 in IL3-dependent Erk1/2 and Akt activation. Consistent with this observation, we found that the expression of Rin1:WT and Rin1:C inhibited IL3-stimulated [ 3 H] thymidine incorporation into DNA. In addition, the activation of Elk-1 was also affected by the expression of Rin1 (data not shown). The activation of Elk-1 by growth factors/cytokines has been demonstrated in leukemic cells (29). However, the effect on Rin1 in BCR/ABLregulated signal transduction pathways has been restricted to the activation of Raf/Mek/Erk1/2 signaling molecules. Our data showed that Rin1 is tightly linked to both the IL3 receptor through the PI3K/Akt and Raf/Erk1/2 pathways, and to the BCR-ABL oncogene through the Raf/Mek/Erk1/2 pathway. These two pathways are known to be involved in cellular growth and proliferation. Both the N- and C-terminal regions of Rin1 appeared to be involved in optimal growth inhibition. It also seems reasonable to assume that the effects of Rin1:N and Rin1:C are mediated by separate molecular mechanisms. Rin1:C may interact with Ras via its Ras-binding domain, thereby blocking Ras action on downstream pathways. Our observations also suggest that Rin1 might alter the Ras-Raf interaction. This hypothesis is further supported by the observation that the Ras binding domain of Rin1 was able to block interaction of GTP-bound Ras and Raf (12) and also by the fact that the expression of Rin1 affected both IL3- dependent and BCR/ABL-dependent Raf phosphorylation. Even though both Rin1:WT and Rin1:N, but not Rin1:C, were found to be associated with BCR/ABL in BCR/ABL-positive cell lines, it seems reasonable that Rin1 may link BCR/ABL directly to signals downstream of Ras. On the other hand, it is likely that the expression of Rin1:N, which contains both SH 2 and proline-rich domains, interferes with the recruitment of adaptor proteins, including full-length Rin1 to activated IL3 receptor, thereby interfering with IL3 receptor signal transduction. Consistent with our hypothesis, Rin1:WT and Rin1:N, but not Rin1:C, were found to interact with the IL3 receptor in BCR/ABL-negative cell lines. Several observations also support the selective effect of Rin1 on the PI3K/Akt pathway; first, Rin1 was associated with BCR/CBL in K526 but not in HL-60 cells (21); second, BCR/ABL independently regulated both Ras and PI3K activity (20); and finally, mutations in the Ras effector loop reveal a surprising observation. The Ras mutation (C40-V12) retained affinity with PI3K, but not with Rin1 or Raf (29). In the BCR/ABL-negative cells, Rin1:WT and Rin1:N, but not Rin1:C, were associated with the IL3 receptor (Figure 7), which may interfere with the recruitment of adaptor proteins, including PI3K. Consistent with our hypothesis, we found that the expression of Rin1 altered the PI3K activity associated with the IL3 receptor (data not shown). Clearly, more work has to be done to fully understand the molecular mechanisms of Rin1 in IL3 receptor signaling pathways. It is likely that this selective and specific association of Rin1 with different molecules in both BCR/ABL-negative and -positive cell lines may help to explain, in part, our observations. 915

12 In addition, the depletion of Rin1 by RNA interference revealed an important aspect of Rin1 function in IL3 receptor signaling and proliferation. Moreover, the depletion of Rin3, but not Rin2, suggests that the elimination of a combination of at least 2 molecules (Rin1 and Rin3) is necessary to reveal the role of these molecules in both the IL3 receptor and BCR/ABL signaling pathways. Finally, a model of the possible sites of inhibition of Rin1 in the BCR/ABL and IL3 cytokine signal transduction pathways is presented in Figure 8. In summary, this study lends support to the importance of the Ras/Rin1 pathway in cell proliferation driven by the IL3 receptor and the BCR/ABL oncogene and raises the possibility that interference with this pathway might be a rational therapeutic strategy for leukemia characterized by oncogenic activation of tyrosine kinases. Acknowledgements We thank Dr. P. D. Stahl for the generous gifts of experimental materials and suggestions. This work was support by the Jose Carreras International Leukemia Foundation (E.D. Thomas Fellowship Program) at Florida International University, U.S.A. References 1 Lee JT Jr and McCubrey JA: The Raf/MEK/ERK signal transduction cascade as a target for chemotherapeutic intervention in leukemia. Leukemia 16(4): , McCubrey JA et al: Interactions between the PI3K and Raf signaling pathways can result in the transformation of hematopoietic cells. Cancer Detect Prev 25(4): , Hantschel O and Superti-Furga G: Regulation of the c-abl and Bcr-Abl tyrosine kinases. Nat Rev Mol Cell Biol 5(1): 33-44, Nieborowska-Skorska M et al: Signal transducer and activator of transcription (STAT)5 activation by BCR/ABL is dependent on intact Src homology (SH)3 and SH 2 domains of BCR/ABL and is required for leukemogenesis. J Exp Med 189(8): , Neshat MS et al: The survival function of the Bcr-Abl oncogene is mediated by Bad-dependent and -independent pathways: roles for phosphatidylinositol 3- kinase and Raf. Mol Cell Biol 20(4): , Pendergast AM et al: SH1 domain autophosphorylation of P210 BCR/ABL is required for transformation but not growth factor independence. Mol Cell Biol 13(3): , Pendergast AM et al: BCR sequences essential for transformation by the BCRABL oncogene bind to the ABL SH 2 regulatory domain in a non-phosphotyrosine-dependent manner. Cell 66(1): , Sirard C, Laneuville P and Dick JE: Expression of bcr-abl abrogates factor-dependent growth of human hematopoietic M07E cells by an autocrine mechanism. Blood 83(6): , Sillaber C et al: STAT5 activation contributes to growth and viability in Bcr/Abl-transformed cells. Blood 95(6): , de Groot RP et al: STAT5 activation by BCR-Abl contributes to transformation of K562 leukemia cells. Blood 94(3): , Ben-Neriah Y et al: The chronic myelogenous leukemia-specific P210 protein is the product of the bcr/abl hybrid gene. Science 233(4760): , Sawyers CL: Chronic myeloid leukemia. N Engl J Med 340(17): , Faderl S et al: The biology of chronic myeloid leukemia. N Engl J Med 341(3): , Frank DA and Varticovski L: BCR/Abl leads to the constitutive activation of Stat proteins, and shares an epitope with tyrosine phosphorylated Stats. Leukemia 10(11): , Sawyers CL, Denny CT and Witte ON: Leukemia and the disruption of normal hematopoiesis. Cell 64(2): , Calabretta B and Skorski T: Gene regulatory mechanisms operative on hematopoietic cells: proliferation, differentiation, and neoplasia. Crit Rev Eukaryot Gene Expr 7(1-2): , Tenen DG et al: Transcription factors, normal myeloid development, and leukemia. Blood 90(2): , Donato NJ et al: Down-regulation of interleukin-3/granulocytemacrophage colony-stimulating factor receptor beta-chain in BCR- ABL(+) human leukemic cells: association with loss of cytokinemediated Stat-5 activation and protection from apoptosis after BCR-ABL inhibition. Blood 97(9): , Luo JM et al: Possible dominant-negative mutation of the SHIP gene in acute myeloid leukemia. Leukemia 17(1): 1-8, Sattler M et al: Critical role for Gab2 in transformation by BCR/ABL. Cancer Cell 1(5): , Afar DE et al: Regulation of the oncogenic activity of BCR-ABL by a tightly bound substrate protein RIN1. Immunity 6(6): , Barbieri MA et al: Role of rab5 in EGF receptor-mediated signal transduction. Eur J Cell Biol 83(6): , Tall GG et al: Ras-activated endocytosis is mediated by the Rab5 guanine nucleotide exchange activity of RIN1. Dev Cell 1(1): 73-82, Barbieri MA et al: The SRC homology 2 domain of Rin1 mediates its binding to the epidermal growth factor receptor and regulates receptor endocytosis. J Biol Chem 278(34): , Barbieri MA et al: Epidermal growth factor and membrane trafficking. EGF receptor activation of endocytosis requires Rab5a. J Cell Biol 151(3): , Traina F et al: BCR-ABL binds to IRS-1 and IRS-1 phosphorylation is inhibited by imatinib in K562 cells. FEBS Lett 535(1-3): 17-22, Bone H and Welham MJ: Shc associates with the IL-3 receptor beta subunit, SHIP and Gab2 following IL-3 stimulation. Contribution of Shc PTB and SH 2 domains. Cell Signal 12(3): , Steelman LS et al: JAK/STAT, Raf/MEK/ERK, PI3K/Akt and BCR-ABL in cell cycle progression and leukemogenesis. Leukemia 18(2): , Mizuchi D et al: BCR/ABL activates Rap1 and B-Raf to stimulate the MEK/Erk signaling pathway in hematopoietic cells. Biochem Biophys Res Commun 326(3): , Skorski T et al: Transformation of hematopoietic cells by BCR/ABL requires activation of a PI-3k/Akt-dependent pathway. EMBO J 16(20): , McFarlin DR, Lindstrom MJ and Gould MN: Affinity with Raf is sufficient for Ras to efficiently induce rat mammary carcinomas. Carcinogenesis 24(1): , Received October 10, 2005 Accepted December 13,