Epigenetic Inactivation of Wnt Inhibitory Factor-1Plays an Important Role in Bladder Cancer through Aberrant Canonical Wnt/B-Catenin Signaling Pathway

Transcription

1 Human Cancer Biology Epigenetic Inactivation of Wnt Inhibitory Factor-1Plays an Important Role in Bladder Cancer through Aberrant Canonical Wnt/B-Catenin Signaling Pathway Shinji Urakami, 1,2 Hiroaki Shiina, 2 Hideki Enokida, 1 Toshifumi Kawakami, 1 Takashi Tokizane, 1 Tatsuya Ogishima, 1 Yuichiro Tanaka, 1 Long-Cheng Li, 1 Leopoldo A. Ribeiro-Filho, 1 Masaharu Terashima, 2,3 Nobuyuki Kikuno, 2 Hiroyuki Adachi, 2 Tatsuaki Yoneda, 2 Hirofumi Kishi, 2 Kazushi Shigeno, 2 Badrinath R. Konety, 1 Mikio Igawa, 2 and Rajvir Dahiya 1 Abstract Purpose: Aberrant activation of the Wingless-type (Wnt) pathway plays a significant role in the pathogenesis of several human cancers. Wnt inhibitory factor-1 (Wif-1) was identified as one of the secreted antagonists that can bind Wnt protein.we hypothesize that Wif-1plays an important role in bladder cancer pathogenesis. Experimental Design: To test this hypothesis, epigenetic and genetic pathways involved in the Wif-1gene modulation and expression ofwnt/h-catenin-related genes were analyzed in 4 bladder tumor cell lines and 54 bladder tumor and matched normal bladder mucosa. Results: Wif-1 mrna expression was significantly enhanced after 5-aza-2V-deoxycytidine treatment in bladder tumor cell lines. Wif-1 promoter methylation level was significantly higher and Wif-1 mrna expression was significantly lower in bladder tumor samples than in bladder mucosa samples. In the total bladder tumor and bladder mucosa samples, an inverse correlation was found between promoter methylation and Wif-1 mrna transcript levels. However, lossof-heterozygosity at chromosome 12q14.3 close to the Wif-1 gene loci was a rare event (3.7%). Nuclear accumulation of h-catenin was significantly more frequent in bladder tumor than in bladder mucosa and inversely correlated with Wif-1 expression. In addition, known targets of the canonical Wnt/h-catenin signaling pathway, such as c-myc and cyclin D1, were up-regulated in bladder tumor compared with bladder mucosa, and this up-regulation was associated with reduced Wif-1 expression at both mrna and protein levels. Furthermore, transfection of Wif-1 small interfering RNA into bladder tumor cells expressing Wif-1mRNA transcripts had increased levels of c-myc and cyclin D1and accelerated cell growth. Conclusion: This is the first report showing that CpG hypermethylation of the Wif-1promoter is a frequent event in bladder tumor and may contribute to pathogenesis of bladder cancer through aberrant canonical Wnt/h-catenin signaling pathway. The present study elucidates novel pathways that are involved in the pathogenesis of bladder cancer. In normal conditions, h-catenin is controlled by the upstream regulators of the Wingless-type (Wnt) signaling pathway (1). At Authors Affiliations: 1 Department of Urology, Veterans Affairs Medical Center, and University of California at San Francisco, San Francisco, California and Departments of 2 Urology and 3 Biochemistry and Molecular Medicine, School of Medicine, Shimane University, Izumo, Japan Received 6/21/05; revised 9/18/05; accepted10/26/05. Grant support: VA Merit Review Grant/Research Enhancement Award Program and NIH grants RO1CA101844, RO1AG21418, T32DK07790, and D43TW06215 funded by the Fogarty International Center and the Office of Dietary Supplements. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section1734 solely to indicate this fact. Requests for reprints: Rajvir Dahiya, Department of Urology (112F), Veterans Affairs Medical Center, and University of California at San Francisco, 4150 Clement Street, San Francisco, CA Phone: ; Fax: ; rdahiya@urol.ucsf.edu. F 2006 American Association for Cancer doi: / ccr the cell surface, the binding of Wnt protein with its frizzled transmembrane receptor activates disheveled phosphoprotein, which in turn inactivates glycogen synthase kinase-3h. The inhibited glycogen synthase kinase-3h fails to phosphorylate h-catenin, which in turn cannot form a complex with adenomatous polyposis coli (APC) to form an ubiquitin-mediated proteolytic complex and be degraded. Consequently, h-catenin accumulates in the cytoplasm and enters the nucleus. As a transcriptional activator, the h-catenin in the nucleus binds to members of the TCF/LEF family and activates the target genes, including c-myc and cyclin D1 (2, 3). This is a known canonical pathway of Wnt signaling. Urinary bladder tumor is the second most common malignancy of the genitourinary tract and the second most common cause of death of all genitourinary tract tumors in the United States (4). The most common pathology of bladder tumor is transitional cell carcinoma (TCC). Although the Wnt/h-catenin signal transduction pathway is constitutively Clin Cancer Res 2006;12(2) January 15, 2006

2 Human Cancer Biology activated in several major human cancers (5), its functional role involved in the pathogenesis of TCC still remains unclear. Genetic alterations in the components of this pathway, such as APC and h-catenin, can activate Wnt/h-catenin signaling and such alterations are frequently observed in colon cancer (6 8). Wnt/h-catenin signaling has been implicated as pivotal in the development of urothelium (9), and extracellular components of the Wnt protein have shown a difference in their distribution among normal bladder mucosa, superficial bladder tumor, and invasive bladder tumor (10). Based on these findings, it seems that activation of the Wnt/h-catenin pathway could be important in the carcinogenesis of bladder tumor. We and others have reported previously that genetic alterations in components of this pathway, such as APC and h-catenin, were infrequent in TCC (11, 12). Therefore, we hypothesized that other mechanisms may play an important role in activated signaling in TCC. Recently, several antagonists of Wnt have been identified (13). Wnt antagonists can be divided into two functional classes, secreted frizzled-related protein (sfrp) and Dickkopf (Dkk). The former class, which includes the sfrp family (sfrp1-sfrp5), Wnt inhibitory factor-1 (Wif-1), and Cerberus, inhibits Wnt signaling by directly binding to Wnt molecules instead of frizzled (13). The latter class, which comprises certain Dkk family proteins (Dkk1-Dkk4), inhibits Wnt signaling by binding to the LRP5/LRP6 component of the Wnt receptor complex. Thus, the functional loss of Wnt antagonists can contribute to activation of the Wnt pathway. Recently, down-regulation of the Wnt antagonists, such as sfrp and Dkk, has been identified in several human malignancies, including bladder tumor (14, 15). In addition, inactivation caused by promoter hypermethylation seems to be one of the mechanisms underlying down-regulation of the Wnt antagonists (16, 17). Wif-1 is one of the sfrp class antagonists, is highly conserved between species, and was initially identified in the human retina (18). Recent studies have shown down-regulation of Wif- 1 expression in various cancers (19), which is correlated with promoter hypermethylation (20). The focus of this study was to elucidate whether the Wif-1 gene is associated with the pathogenesis of bladder tumor. We also analyzed the epigenetics of Wif-1 down-regulation and its interaction with aberrant activation of the canonical Wnt/h-catenin signaling pathway in bladder tumor. Materials and Methods Bladder tumor samples. Fifty-four samples of primary TCC of bladder tumor and corresponding bladder mucosa were obtained by either total cystectomy or transurethral resection of bladder tumor. These samples were staged according to the tumor-node-metastasis classification and graded histologically (21). The mean age of the patients was 62 years (range, years). The bladder tumor cohort included 36 cases of superficial (pt a -pt 1 ) and 18 of invasive (pt 2 -pt 4 ) bladder tumor, 28 cases of grade 1 and 2, and 26 cases of grade 3 bladder tumor. Each tissue sample was fixed in 10% buffered formalin (ph 7.0) and embedded in paraffin wax. Sections (5 Am) were used for H&E staining for histologic evaluation. Snap-frozen samples were stored at 80jC until analyzed. Informed consent was obtained from each patient for molecular analysis of the resected specimen. Bladder tumor cell lines. Four human bladder tumor cell lines, J82C, T24C, TCC, and UMUC, were obtained from the American Type Culture Collection (Rockville, Maryland). These cell lines were cultured in McCoy s 5A medium with 10% fetal bovine serum and antibiotics (100 units/ml penicillin and 100 Ag/mL streptomycin) and maintained in a humidified atmosphere of 5% CO 2, 95% air at 37jC. Nucleic acid extraction. Although we have to be aware of the potential for a sampling bias of nonurothelial cell populations in normal urothelium or tumor, genomic DNA and total RNA was extracted from bladder tumor and matched bladder mucosa samples using a Qiagen kit (Qiagen, Valencia, CA) after microdissection (22). The concentrations of DNA and RNA were determined with a spectrophotometer and their integrity was assessed by gel electrophoresis. 5-Aza-2V-deoxycytidine treatment. Bladder tumor cell lines (J82C, T24C, TCC, and UMUC) were treated with demethylating agent 5-aza- 2V-deoxycytidine (5-Aza-dC; 5 Amol/L) for 3 days in triplicate and harvested after 3 days of treatment. The genomic DNA and total RNA were extracted from the cell lines before and after 5-Aza-dC treatment and were used for methylation-specific PCR (MSP) and reverse transcription-pcr (RT-PCR; TITANIUM One-Step RT-PCR kit, BD Biosciences, Palo Alto, CA). cdna preparation and RT-PCR analysis. The cdna was prepared using total RNA (1 Ag) and stored at 20jC until used. Primer pairs were designed to detect Wif-1, h-catenin, c-myc, and cyclin D1 mrna expression. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. The primer sequences, annealing temperatures, and PCR cycles are shown in Table 1. The PCR products were electrophoresed in 1.5% agarose gels. Expression levels of the genes were evaluated by ImageJ software, and the areas under the curves were calculated and analyzed to determine relative levels of target gene expression to GAPDH levels [arbitrary units (AU)]. As reported previously (23 25), for semiquantitative analysis of PCR products, a suitable number of PCR cycles for target genes and GAPDH was determined so that it was within the exponential phase. For this purpose, we did RT-PCR using five dilutions (1:1, 1:2, 1:4, 1:8, and 1:16) from the same sample and calculated the absorbance of each band. For example using 32 RT-PCR cycles for Wif-1, the logistically converted densities of each band from the same sample were on the same regression line and PCR amplification was considered to be within the exponential phase. This method was used to determine the suitable number of cycles for all RT-PCR in this study (Table 1). RNA interference. UMUC bladder tumor cells ( ) were plated and grown overnight in six-well plates in McCoy s 5A medium containing 10% fetal bovine serum without antibiotics (day 0). They were transiently transfected at day 1 with either Wif-1 small interfering RNA (sirna) or a nonsilencing control sirna according to the manufacturer s instructions (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). After transfection, cells were cultured from days 2 to 8. Cell lysates were harvested, and total RNA was extracted from these at day 3 and used for determination of Wif-1, h-catenin, c-myc, and cyclin D1 mrna transcripts by RT-PCR (TITANIUM One-Step RT-PCR kit). At the same time, viable cells were collected by trypsinization at various time points (days 2, 4, 6, and 8) and counted for analysis of cell growth using a hemocytometer after trypan blue staining (Sigma Chemical Co., St. Louis, MO). Experiments were done in triplicate. Methylation-specific PCR. Genomic DNA (100 ng) was modified with sodium bisulfite using a commercial kit (Invitrogen, Carlsbad, CA). Based on the 5Vsequence of the Wif-1 gene, we identified the human Wif-1 promoter region using the MethPrimer program ( itsa.ucsf.edu/~urolab/methprimer). The identified Wif-1 promoter was CpG rich, showing >60% C + G content and an observed CpG frequency of >0.6, satisfying the criteria for a CpG island (26). Generally, CpG sites within a promoter are nonmethylated but are occasionally methylated in various cancers. Nonmethylated cytosines are converted to uracil by bisulfite treatment, whereas methylated cytosine cannot be converted and remain as cytosine. Based on this potential difference in the DNA sequence between methylated and unmethylated alleles after bisulfite treatment, we designed primer sequences that could distinguish methylated from unmethylated Clin Cancer Res 2006;12(2) January 15,

3 Methylation of Wif-1 Gene in Bladder Cancer Table 1. Primer sequence and PCR conditions Sense primer (5V-3V) Antisense primer (5V-3V) Anneal temperature ( C), PCR cycles Product size (bp) Microsatellite primers AFM164ZB4 CAACAAGGAGTGATGGGAC ACAAGGCTTGGGAGACAAAC 55, D12S1585 CCTAGCACTTTTTGAGGCAGAG ACAAAGCGAGATTTCATCTAATACG 55, D12S1649 AGCTAGTCAGGTATAAGCAGGGC GGCTGCAACCAATTATTAGAGAG 55, D12S1686 CTAGGGTCAGAGTTCCTGCT CACTGTCCAATCAAGTAAGGC 55, MSP primers Universal Wif-1PAN TAGGGGTTTTTGAGTGTTT ACCTAAATACCAAAAAACCTAC 50, Methylated Wif-1MSP CGTTTTATTGGGCGTATCGT ACTAACGCGAACGAAATACGA 57, Unmethylated Wif-1USP GGGTGTTTTATTGGGTGTATTGT AAAAAAACTAACACAAACAAAATACAAAC 52, RT-PCR primers Wif-1 TCTGTTCAAAAGCCTGTCTGC CCTTTTATTGCAGTGTCTTCCA 57, h-catenin GCTTGGAATGAGACTGCTGA CTGGCCATATCCACCAGAGT 57, c-myc AGCGACTCTGAGGAGGAACA TCCAGCAGAAGGTGATCCA 57, Cyclin D1 TGCCACAGATGTGAAGTTCATT CAGTCCGGGTCACACTTGAT 57, GAPDH CAATGACCCCTTCATTGACC TGGAAGATGGTGATGGGATT 55, NOTE: Boldface indicates the differences between modified and unmodified sequences. Underline indicates the changes between methylated and unmethylated sequences after bisulfite modification. alleles. As shown in Fig. 1A and Table 1, the first universal primer set covers no CpG sites in either forward or reverse primer and amplifies a 404-bp DNA fragment of the Wif-1 promoter region containing 38 CpG sites. Then, a second round of nested MSP or unmethylationspecific PCR (USP) was done using the universal PCR products as templates. According to a previous report (20), the primer sequences for MSP and USP of the Wif-1 gene promoter were designed to include 17 CpG sites in this region (ref. 27; Fig. 1A). The primer sequences and PCR conditions (product size and PCR cycles) are shown in Table 1. For semiquantitative MSP analysis, a preliminary suitable number of PCR cycles for each primer set was carried out to determine the linear range of the reaction. To ensure this, at least one initial PCR was done using 30 cycles. Then, a suitable PCR cycle was chosen for each sample. The PCR products were separated by electrophoresis in a 1.5% agarose gel containing ethidium bromide, and DNA bands were visualized by UV light. In samples with a positive MSP band, the relative methylation ratio was determined after the MSP or USP product was electrophoresed in nondenaturing 12% polyacrylamide gels. The area under the curve corresponding to each band was calculated using ImageJ software ( and the relative MSP ratios (%) were determined [MSP ratio = MSP band density / (MSP band density + USP band density)] as reported previously (23 25). Bisulfite DNA sequencing. Bisulfite-modified DNA was amplified using a pair of universal primers. Direct bisulfite DNA sequencing of the PCR products using either forward universal primer or reverse primer was done according to the manufacturer s instructions (Applied Biosystems, Foster City, CA). Loss-of-heterozygosity analysis. Genomic DNA from microdissected bladder tumor and matched bladder mucosa areas were separately amplified by PCR using four different microsatellite markers found on chromosome 12q14.3 close to the Wif-1 gene (centromere: AFM164ZB4 and D12S1585; telomere: D12S1649 and D12S1686). The primer sequences and PCR conditions are shown in Table 1. PCR products were denatured and electrophoresed through a 10% polyacrylamide gel containing 8 mol/l urea at room temperature for 12 hours at 3 W conditions. Gels were stained with GelStar (Cambrex Bio Science Rockland, Inc., Rockland, ME) and examined using an UV transilluminator. Loss-of-heterozygosity (LOH) was defined as the disappearance or significant reduction in intensity of one allele in tumor DNA compared with normal samples. Only informative (heterozygous) cases were considered for LOH frequency calculations. Immunostaining. Immunostaining of Wif-1, h-catenin, c-myc, and cyclin D1 was done on 5-Am-thick consecutive sections using mouse monoclonal antibody for Wif-1 (clone , R&D Systems, Inc., Minneapolis, MN), h-catenin (clone 14, BD Transduction Labs, Lexington, KY), c-myc (clone 9E10, Santa Cruz Biotechnology), and cyclin D1 (clone A-12, Santa Cruz Biotechnology) at 1:50 dilution for 12 hours. The slides were prepared with antigen retrieval using citrate buffer [10 mmol/l (ph 6.0)] before incubation of primary antibody. In negative controls, the primary antibody was replaced with nonimmune serum. 3,3V-Diaminobenzidine (Sigma-Aldrich) was used as the chromogen, and counterstaining was done using hematoxylin. Protein expression in the nuclei (h-catenin, c-myc, and cyclin D1) was evaluated according to the proportion of positive nuclei to all epithelial or cancer cells [i.e., uniformly positive (+ means higher expression group/>20% positive nuclei) and negative ( means lower expression group/0-20% positive nuclei)], because protein expression of c-myc and cyclin D1 is usually observed in nuclei and the nuclear entry of h-catenin is a key step necessary for gene activation by the h-catenin/tcf/lef transcriptional complex (28). For Wif-1 protein expression, nuclear staining was considered to be negative, whereas cytoplasmic and membrane expression was analyzed according to the proportion of positive cells to all epithelial or cancer cells. ImageJ was applied to quantify immunohistochemical results. Statistical analysis. All data were analyzed by the StatView V statistical package (SAS Institute, Inc., Cary, NC). Statistical analysis was done using the Mann-Whitney test and Kruskal-Wallis test. The Clin Cancer Res 2006;12(2) January 15, 2006

4 Human Cancer Biology Fig. 1. A, 5Vflanking region of the humanwif-1 gene. The CpG sites are shown in bold.the first universal primer set (Wif-1PAN-F andwif-1pan-r) and the MSP primer set (Wif-1MSP-F andwif-1msp-r) are underlined.the putative initial ATG codon of open reading frame is boxed. Italic characters show the sequence corresponding to sequencing results in Fig. 3. RT-PCR forwif-1and GAPDH genes after 5-Aza-dC treatment in cultured bladder tumor cell lines are shown in (B). Increased levels ofwif-1mrna transcripts were observed in the all cell lines after 5-Aza-dC treatment (+) in comparison with untreated controls ( ). Results of MSP and USP in bladder tumor cell lines are shown in (C). After 5-Aza-dC treatment, the intensity of the MSP bands was decreased in all bladder tumor cell lines compared with untreated controls. The intensity of the USP bands after treatment was increased when compared with untreated controls. correlation between two continuous variables was analyzed by Spearman rank correlation. P < 0.05 was regarded as statistically significant. Results Expression of Wif-1 mrna transcript in bladder tumor cell lines. As shown in Fig. 1B, expression of Wif-1 mrna transcript was significantly increased in all four bladder tumor cell lines after treatment with the demethylating agent 5-AzadC. These changes in Wif-1 mrna transcript before and after 5-Aza-dC treatment ran parallel with changes in MSP and USP bands in all bladder tumor cell lines (Fig. 1C). In addition, we confirmed demethylation of the Wif-1 promoter after 5-Aza-dC treatment in these cell lines by bisulfite DNA sequencing. Expression of Wif-1 mrna transcript in clinical samples. Wif- 1 mrna transcripts were detectable in most bladder tumor and matched bladder mucosa samples. However, 38 (70.4%) bladder tumor samples showed significant reduction of Wif-1 mrna expression compared with that of the corresponding normal bladder mucosa. Representative RT-PCR results of Wif-1 expression are shown in Fig. 2A. The difference in Wif-1 expression between bladder tumor (mean F SE, 0.90 F 0.06 AU) and normal bladder mucosa (1.60 F 0.09 AU) reached statistical significance (P < ). Wif-1 expression in normal bladder mucosa (1.60 F 0.09 AU) was significantly higher compared with low-grade (1.05 F 0.10 AU; P < 0.005) or low-stage (1.00 F 0.08 AU; P < 0.001) bladder tumor samples. However, Wif-1 gene expression was not correlated with age, sex, histologic grade (low-grade versus high-grade tumor), and pt category (superficial versus invasive tumor) in bladder tumor samples. Methylation status of the Wif-1 gene promoter. Typical results of methylation analysis are shown in Fig. 2B. Positive MSP bands were found in 36 (66.7%) bladder tumor cases and 26 (48.1%) bladder mucosa cases. The relative methylation level of the Wif-1 promoter analyzed by MSP ratio was significantly higher in bladder tumor (25.0 F 2.8%) than in normal bladder mucosa (14.8 F 2.5%; P < 0.01). Of 29 bladder tumor cases with a higher methylation level compared with the corresponding normal bladder mucosa, 24 (82.8%) showed reduction of Wif-1 expression. As shown in Fig. 2C, expression of Wif-1 mrna transcripts was inversely correlated with the relative methylation level of the Wif-1 promoter (P < 0.05). The relative methylation level of the Wif-1 promoter in normal bladder mucosa (14.8 F 2.5%) was significantly lower compared with low-grade (21.4 F 2.3%; P < 0.05) or lowstage (23.7 F 2.5%; P < 0.05) bladder tumor samples. However, Wif-1 promoter methylation level showed no significant association with age, sex, histologic grade, and pt category in bladder tumor samples. Bisulfite genomic sequencing. Representative bisulfite DNA sequencing of bladder tumor and normal bladder mucosa are shown in Fig. 3. Bisulfite DNA sequencing was carried out to confirm whether the relative MSP ratio reflects the true methylation status of CpG sites. Ten pairs of matched normal/cancer PCR products obtained using the universal primer set were sequenced. The majority of cytosines within CpG sites were completely converted to thymines (unmethylated) after bisulfite modification in the normal samples, indicating a low relative MSP ratio (Figs. 2B, No.22-N, and 3A). On the other hand, in the tumor samples where the MPS ratio was higher ratio, the majority of cytosines were unaltered (methylated; Figs. 2B, No.26-T, and 3C). Furthermore, in the tumor sample indicating a moderate relative MSP ratio, more than half of cytosines were partially altered (partially methylated; Figs. 2B, No.21-T, and 3B). Therefore, the bisulfite sequencing results were consistent with the MSP and USP results (relative MSP ratio). In the bladder tumor sample of patient no. 26 (Fig. 3C), of 17 CpG sites in the promoter region of the Wif-1 gene, 16 sites showed complete methylation. LOH of chromosome 12q14.3 loci. Four different loci of the Wif-1 gene on chromosome 12q14.3 (centromere: AFM164ZB4 and D12S1585; telomere: D12S1649 and D12S1686) were analyzed for LOH in 54 bladder tumor cases. LOH was observed in 2 of 54 (3.7%) cases, suggesting that LOH at 12q14.3 loci is a rare event in bladder tumor (Fig. 2D). Clin Cancer Res 2006;12(2) January 15,

5 Methylation of Wif-1 Gene in Bladder Cancer Relationship between Wif-1 and Wnt/b-catenin signalingrelated genes. Restoration of Wif-1 expression by 5-Aza-dC treatment and corresponding RT-PCR results for b-catenin, c-myc, and cyclin D1 genes in T24 bladder tumor cells without Wif-1 expression are shown in Fig. 4A (1). Restoration of Wif-1 expression was inversely related to c-myc and cyclin D1 mrna transcript levels. Typical results of h-catenin, c-myc, and cyclin D1 mrna expression are shown in Fig. 4B. Expression of mrna transcript was significantly higher in bladder tumor than normal bladder mucosa for c-myc (0.56 F 0.06 and 0.14 F 0.04 AU, respectively; P < ) and cyclin D1 (0.23 F 0.03 and 0.11 F 0.03 AU, respectively; P < ). However, there was no significant difference in h-catenin mrna levels (0.43 F 0.10 and 0.50 F 0.14 AU, respectively). In addition, as shown in Fig. 4C (1) and (2), correlation analysis revealed a significant inverse association of Wif-1 with c-myc and cyclin D1 mrna expression (P < and P < , respectively). However, no significant association of Wif-1 mrna expression with h-catenin mrna expression was found in this series. Knockdown of the Wif-1 gene by sirna in Wif-1-expressing cells. To further investigate whether Wif-1 is involved in bladder tumor pathogenesis or progression through the canonical Wnt signaling pathway, specific knockdown of the Wif-1 gene using sirna was carried out in Wif-1-expressing UMUC cells. The Wif-1-specific sirna appropriately silenced expression of Wif-1 mrna compared with the control sirna [Fig. 4A (2)]. As a result, the specific knockdown of the Wif-1 gene up-regulated levels of c-myc and cyclin D1 mrna transcripts [Fig. 4A (2)]. In addition, the cell growth rate was significantly enhanced in Wif-1 sirna-treated cells compared with control sirna-treated cells (Fig. 4D). Immunoreactivity of Wif-1 and canonical Wnt/b-catenin signaling-related proteins. Immunostaining for Wif-1 showed a strong cytoplasmic and membranous staining pattern in normal bladder mucosa compared with bladder tumor [Fig. 5A (1) and (2)]. Endothelial cells of lamina propria were intensively stained and used as a positive internal control. As shown in Fig. 5E, correlation analysis between mrna and protein expression of Wif-1 showed a significant association (P < ). The difference in the Wif-1 protein expression between bladder mucosa and bladder tumor reached statistical significance (26.9 F 3.3% and 9.3 F 1.4%, respectively; P < ; Fig. 5F). Wif-1 expression in normal bladder mucosa was significantly higher even if the comparison was made with low-grade (P < 0.005) or superficial (P < 0.001) bladder tumor samples, although it was not correlated with histologic grade (low-grade versus high-grade tumor) and pt category (superficial versus invasive tumor; Fig. 5F) in bladder tumor samples. In h-catenin immunostaining, all bladder mucosa samples (100%) were negative for nuclear h-catenin accumulation but positive for membrane expression [Fig. 5B (1)]. However, 22.2% (12 of 54) of bladder tumor was positive for h-catenin nuclear accumulation with cytoplasmic staining [Fig. 5B (2)]. The nuclear h-catenin accumulation (the proportion of positive nuclei) was significantly higher in bladder tumor than in normal bladder mucosa (11.8 F 2.1% and 2.7 F 0.7%, respectively; P < ). The majority of normal bladder mucosa did not show intracellular accumulation of h-catenin but showed membrane localization of h-catenin [Fig. 5B (1)]. Both c-myc [Fig. 5C (1) and (2)] and cyclin D1 nuclear staining [Fig. 5D (1) and (2)] were significantly higher in bladder tumor than in normal bladder mucosa (c-myc, 14.3 F 7.1% and 3.6 F 2.7%, respectively; P < ; cyclin D1, 39.5 F 11.7% and 5.6 F 3.5%, respectively; P < ). When immunostaining of h-catenin, c-myc, and cyclin D1 was classified into two groups ( means lower expression group and + means higher expression group), the Fig. 2. A, typical RT-PCR results of the Wif-1 gene in10 matched pairs (No.17-No.26) of normal bladder mucosa (N) and bladder tumor (T). GAPDHis shown as a control.the fragments of amplified humanwif-1and GAPDH cdna are111and135 bp, respectively.wif-1mrna expression was lower in bladder tumor than in normal bladder mucosa. Representative methylation status of thewif-1promoter in 10 matched pairs (No.17-No.26) of normal bladder mucosa and bladder tumor is shown in (B).MSP(145bp)andUSP (154 bp) bands are shown in (B). The intensity of the MSP bands was increasedin bladder tumor compared with normal bladder mucosa. Correlation ofwif-1mrna expression with MSP ratio is shown in (C). There was a significant inverse correlation betweenwif-1 gene expression and methylation using Spearman rank correlation (P < 0.05). LOH analysis using denaturing gels in five matched pairs (No.33-No.37) of normal bladder mucosa and bladder tumor is shown in (D). Samples showed heterozygosity in normal bladder mucosa using the D12S1649 microsatelite marker, whereas No.34 had LOH in bladder tumor Clin Cancer Res 2006;12(2) January 15, 2006

6 Human Cancer Biology Fig. 3. The majority of CpG sites are unmethylated in normal bladder sample (A), where weak MSP band with strong USP bands are observed (Fig. 2B, No.22-N). In bladder cancer sample (B), more than half of the CpG sites are partially methylated ( C covered with T ), and the 3Vprime end of the reverse primer ofwif-1msp-r (arrow) showed similar size C and T peaks. In this case, the intensity of the MSP and USP RT-PCR bands (Fig. 2B, No.21-T) is almost the same. In bladder cancer sample (C), 16 of17 CpG sites are completely methylated, and only a strong MSP band is observed (Fig. 2B, No.26-T).Thus, the bisulfite DNA sequencing results are consistent with those obtained by PCR (MSP and USP). Horizontal bar, CpG sites; arrow, 3Vprime end of the reverse primer ofwif-1msp-r; UM, PM, and CM, unmethylation, partial methylation, and complete methylation, respectively. Wif-1 protein expression was significantly higher in the lower expression groups of Wnt/h-catenin signaling-related proteins than in the corresponding higher expression groups in bladder tumor (Fig. 5G; h-catenin, P = ; c-myc, P < 0.002; cyclin D1, P < 0.05). Discussion The Wnt proteins are powerful regulators of cell proliferation and differentiation, and activation of the Wnt signaling pathway is involved in the pathogenesis of various human tumors (29). The Wif-1 gene has been identified recently as a secreted protein that binds to Wnt proteins and inhibits their interaction with the frizzled receptor, which may lead to the termination of transcription of genes activated by the h- catenin/tcf/lef transcriptional complex (18). Thus, it is possible that functional loss of Wif-1 results in the activation of the Wnt signaling pathway, with increased proliferation and uncontrolled differentiation leading to tumorigenesis. Decreased Wif-1 mrna and protein expression has been observed in several cancers (19). In agreement with this report, we also found that both Wif-1 mrna and protein expression were significantly reduced in bladder tumor compared with bladder mucosa. However, the mechanisms leading to down-regulation of Wif-1 expression remained to be elucidated in bladder tumor. We tested the hypothesis that epigenetic promoter hypermethylation contributes to inactivation of the Wif-1 gene in bladder cancer. In the present study, we found that expression of Wif-1 mrna transcripts in four bladder cancer cell lines was significantly enhanced after 5-Aza-dC treatment. In addition, MSP analysis of Wif-1 promoter also revealed a higher prevalence of CpG methylation in bladder tumor than in bladder mucosa and an inverse association of Wif-1 promoter methylation level with Wif-1 mrna expression (Fig. 2C), which closely correlated with Wif-1 protein expression (Fig. 5E). However, LOH analysis showed that genetic alterations of the Wif-1 gene seemed to be rare in human bladder tumor. Based on these findings, we concluded that Wif-1 expression is predominantly down-regulated by promoter CpG hypermethylation rather than genetic alterations, such as LOH in bladder tumor. Clin Cancer Res 2006;12(2) January 15,

7 Methylation of Wif-1 Gene in Bladder Cancer h-catenin functions as the key mediator of the canonical Wnt signaling pathway (30). Considering that the nuclear entry of h-catenin is a primary step required for gene activation induced by the h-catenin/tcf/lef transcriptional complex (28), we focused on the interaction of Wif-1 downregulation with nuclear localization of h-catenin in bladder samples. In the present study, nuclear h-catenin expression was significantly increased in bladder tumor compared with bladder mucosa, with no significant difference in h-catenin mrna expression between bladder tumor and bladder mucosa. These findings suggest that h-catenin is not regulated transcriptionally but is controlled post-translationally in bladder tumor. Post-translational stabilization of h-catenin affects Wnt signaling to the nucleus along with the TCF/LEF transcription factor leading to the activation of target genes involved in cell growth (30). In turn, a shift of h-catenin protein from membrane to nucleus is a primary step for activation of Wnt signaling leading to bladder carcinogenesis. As shown in Fig. 5G, an inverse correlation was found between nuclear h-catenin accumulation and cytoplasmic/ membranous Wif-1 expression. Thus, it is quite possible that dysregulated Wif-1 caused by promoter hypermethylation can activate the Wnt signaling pathway through nuclear entry of h-catenin. Recent investigation has identified c-myc and cyclin D1 as target genes of the Wnt signal (2, 3). In this study, we clearly showed that down-regulated Wif-1 is closely associated with activation of the Wnt signaling pathway. In T24 cells with no Wif-1 expression, after 5-Aza-dC treatment, c-myc and cyclin D1 mrna transcripts were both significantly downregulated paralleling Wif-1 up-regulation [Fig. 4A (1)]. In addition, in UMUC cells expressing Wif-1, knockdown of Wif-1 by sirna treatment induced c-myc and cyclin D1 mrna transcripts and cell growth [Fig. 4A (2) and D]. Likewise, Taniguchi et al. also have shown that the transfection of the Wif-1 gene into esophageal cancer cells lacking Wif-1 expression had a significant inhibitory effect on cell proliferation (31). In the present study, we also found that down-regulation of Wif-1 correlated with increased expression of c-myc and cyclin D1 in clinical human bladder samples [Figs. 4C (1) and (2) and 5G]. In colon cancer, genetic Fig. 4. A (1), RT-PCR results for b-catenin, c-myc, and cyclin D1 genes after restoration ofwif-1gene expression by 5-Aza-dC int24 bladder tumor cells lackingwif-1 expression. GAPDH was used as an internal control to ensure RNA quality and loading accuracy. Expression of c-myc and cyclin D1mRNA after the restoration ofwif-1were down-regulated in comparison with nontreated cells. A (2), changes of mrna expression in canonicalwnt pathway downstream genes before and afterwif-1sirna treatment.wif-1sirna treatment appropriately silencedwif-1expression in UMUC cells, whereas mrna levels of the canonicalwnt target genes c-myc and cyclin D1were up-regulated. B, typical RT-PCR results of b-catenin, c-myc, and cyclin D1 genes in10 representative matched pairs (No.17-No.26) of normal bladder mucosa and bladder tumor. GAPDH is shown as a control.the fragments of human h-catenin, c-myc, cyclin D1, and GAPDH cdna amplified are114, 108, 162, and135 bp, respectively. Levels of c-myc and cyclin D1mRNA were higher in bladder tumor than in normal bladder mucosa, but h-catenin was not. C (1), correlation ofwif-1mrna expression with c-myc mrna expression.there was a significant inverse correlation betweenwif-1expression and c-myc expression using Spearman rank correlation (P < ). C (2), correlation ofwif-1mrna expression with cyclin D1mRNA expression.there was a significant inverse correlation betweenwif-1and cyclin D1expression using Spearman rankcorrelation (P < ). D, growth curves for UMUC cells transfected with controlandwif-1sirna.the growth rates ofwif-1sirna-treated cells were significantly higher than those of control sirna-treated cells (*, P < 0.01) Clin Cancer Res 2006;12(2) January 15, 2006

8 Human Cancer Biology Fig. 5. A (1), typical immunostaining ofwif-1in normal urothelium. Magnification, 400 (hematoxylin counterstained). Strong cytoplasmic and membranous staining ofwif-1was observed in normal urothelium with positive internal controls consisting of endothelium of the lamina propria. A (2), typical immunostaining ofwif-1 in bladder cancer. Magnification, 400 (hematoxylin counterstained). No membranous and cytoplasmic staining ofwif-1was observed in bladder cancer. B (1), typical immunostaining of h-catenin in normal urothelium. Magnification, 400 (hematoxylin counterstained). Strong membranous staining of h-catenin was observed in normal urothelium. B (2), typical immunostaining of h-catenin in bladder cancer with negativewif-1expression. Magnification, 400 (hematoxylin counterstained). Strong nuclear and weak cytoplasmic staining of h-catenin was observed in bladder cancer. C (1), typical immunostaining of c-myc in normal urothelium. Magnification, 400 (hematoxylin counterstained). No nuclear staining of c-myc was observed in normal urothelium. C (2), typical immunostaining of c-myc in bladder cancer with negativewif-1expression. Magnification, 400 (hematoxylin counterstained). Strong nuclear and moderate cytoplasmic staining of c-myc was observedin bladder cancer. D (1), typicalimmunostaining of cyclin D1in normal urothelium. Magnification, 400 (hematoxylin counterstained). No nuclear staining of cyclin D1was observed in normal urothelium. D (2), typical immunostaining of cyclin D1in bladder cancer with negativewif-1expression. Magnification, 400 (hematoxylin counterstained). Strong nuclear of cyclin D1was observed in bladder cancer. E, relationship betweenwif-1mrna expression and cytoplasmic/membranous protein expression.wif-1protein expression was positively correlated withwif-1mrna expression (P < ). F, relationship betweenwif-1cytoplasmic/membranous protein expression and pathologic features in bladder.wif-1protein expressioninnormalurothelium washigher thaninbladder cancer (P < ). Moreover,Wif-1protein expressioninnormalurothelium was significantly higher compared with superficial bladder cancer (P < 0.001). However,Wif-1protein expression did not correlate with stage (superficial versus invasive tumor) in bladder cancer. Bars, SE. G, relationship betweenwif-1protein expression and protein expression ofwnt/h-catenin signaling-related genes, such as b-catenin, c-myc, and cyclin D1, in bladder cancer. Wif-1cytoplasmic/membranous staining ratio was significantly higher in lower expression groups ( ) of thesewnt/h-catenin signaling-related proteins than in the higher expression groups (+; P = , P < 0.002, and P < 0.05, respectively). Bars, SEM F SE. alterations in the components of the canonical Wnt signaling pathway, such as b-catenin and/or the APC gene, play a central role in the activation of the Wnt/h-catenin signaling pathway (6 8). However, we showed previously that only small subsets of bladder tumor had a mutated b-catenin gene leading to up-regulation of c-myc and cyclin D1 (11). Likewise, genetic mutation of APC seems to be a rare event in human bladder tumor (12). Recent publications have shown that decreased expression of sfrp4, a Wnt antagonist, can enhance the expression of cytosolic h-catenin and Wnt target genes and activate canonical Wnt signaling pathway (32, 33). These findings clearly indicate that even if genetic alterations of b-catenin and/or APC gene are not present, epigenetic hypermethylation of the Wif-1 promoter significantly contributes to the pathogenesis of bladder cancer through the activation of the canonical Wnt signaling pathway. In this study, Wif-1 expression in bladder tumor was downregulated at both protein and mrna levels compared with normal bladder mucosa. Our bladder tumor samples showed lower Wif-1 expression with higher Wif-1 promoter methylation level independent of histologic grade or stage compared with normal bladder mucosa samples (Fig. 5F). In human bladder cancers, other Wnt antagonists, such as sfrp1 (14) and Dkk3 (34), were down-regulated as well. Therefore, it might be plausible that other Wnt antagonists in bladder tumor also serve as regulatory machinery for the Wnt signaling pathway and are interrelated with one other, including Wif-1, during the development and progression of bladder tumor. In the present study, the differences in Wif-1 expression between normal bladder mucosa and low-grade or low-stage bladder tumor samples reached statistical significance (Fig. 5F). Even in premalignant lesions of the urinary bladder, such as cystitis glandularis, intracellular accumulation Clin Cancer Res 2006;12(2) January15,

9 Methylation of Wif-1 Gene in Bladder Cancer of h-catenin was found (35). Alternatively, our results indicate that dysregulated Wif-1 caused by epigenetic CpG hypermethylation is closely associated with bladder tumor carcinogenesis at an early phase. In gastrointestinal carcinogenesis, down-regulation of Wif-1 expression and Wif-1 epigenetic silencing has been reported to be an early event (31). A similar observation was reported for another Wnt antagonist [i.e., (a) epigenetic functional loss of sfrp occurs at early phase of colorectal cancer progression (36) and (b) stable overexpression of sfrp genes is related to the substantial down-regulation of intracellular h-catenin expression and c-myc mrna transcripts (16)]. In conclusion, this is the first report suggesting that the functional loss of Wif-1 by promoter hypermethylation might play an important role in bladder cancer pathogenesis through aberrant canonical Wnt/h-catenin signal activation. Therefore, the present study elucidates the novel pathways involved in the pathogenesis of bladder cancer. References 1. Bienz M, Clevers H. Linking colorectal cancer to Wnt signaling. Cell 2000;103:311^ He TC, Sparks AB, Rago C, et al. Identification of c-myc as a target of the APC pathway. Science 1998;281:1509^ Tetsu O, McCormick F. h-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 1999;398:422 ^ SteinJP, Grossfeld GD, Ginsberg DA, et al. Prognostic markers in bladder cancer: a contemporary review of the literature. J Urol1998;160:645^ Polakis P.Wnt signaling and cancer. Genes Dev 2000; 14:1837 ^ Morin PJ. h-catenin signaling and cancer. Bioessays 1999;21:1021 ^ Peifer M, Polakis P.Wnt signaling in oncogenesis and embryogenesisöa look outside the nucleus. Science 2000;287:1606^9. 8. Fodde R. The APC gene in colorectal cancer. Eur J Cancer 2002;38:867^ Lako M, StrachanT, Bullen P, et al. Isolation, characterisation and embryonic expression ofwnt11, a gene which maps to 11q13.5 and has possible roles in the development of skeleton, kidney and lung. Gene 1998;219:101^ Bui TD, O BrienT, Crew J, et al. High expression of Wnt7b in human superficial bladder cancer vs invasive bladder cancer. BrJCancer1998;77:319^ Shiina H, Igawa M, Shigeno K, et al. h-catenin mutations correlate with over expression of C-myc and cyclin D1genes in bladder cancer. J Urol 2002;168: 2220 ^ Stoehr R, Krieg RC, Knuechel R, et al. No evidence for involvement of h-catenin and APC in urothelial carcinomas. IntJ Oncol 2002;20:905^ Kawano Y, Kypta R. Secreted antagonists of the Wnt signalling pathway. J Cell Sci 2003;116: 2627 ^ Stoehr R,Wissmann C, Suzuki H, et al. Deletions of chromosome 8p and loss of sfrp1 expression are progression markers of papillary bladder cancer. Lab Invest 2004;84:465^ Hsieh SY, Hsieh PS, Chiu CT, et al. Dickkopf-3/REIC functions as a suppressor gene of tumor growth. Oncogene 2004;23:9183 ^ Suzuki H, Watkins DN, Jair KW, et al. Epigenetic inactivation of SFRP genes allows constitutive WNT signaling in colorectal cancer. Nat Genet 2004;36: 417 ^ Kobayashi K, Ouchida M, Tsuji T, et al. Reduced expression of the REIC/Dkk-3 gene by promoterhypermethylation in human tumor cells. Gene 2002; 282:151 ^ HsiehJC, Kodjabachian L, Rebbert ML, et al. A new secreted protein that binds townt proteins and inhibits their activities. Nature1999;398:431^ Wissmann C,Wild PJ, Kaiser S, et al.wif1, a component of the Wnt pathway, is down-regulated in prostate, breast, lung, and bladder cancer. J Pathol 2003; 201:204 ^ MazieresJ, He B,You L, et al.wnt inhibitory factor-1 is silenced by promoter hypermethylation in human lung cancer. Cancer Res 2004;64:4717^ Sobin LH, Wittekind Ch, editors. TNM classification of malignant tumours. 6th ed. Geneva: International Union Against Cancer; Dahiya R, Lee C, McCarvilleJ, et al. High frequency of genetic instability of microsatellites in human prostatic adenocarcinoma. IntJCancer1997;72:762^ Enokida H, Shiina H, Igawa M, et al. CpG hypermethylation of MDR1gene contributes to the pathogenesis and progression of human prostate cancer. Cancer Res 2004;64:5956^ Ogishima T, Shiina H, Breault JE, et al. Increased heparanase expression is caused by promoter hypomethylation and up-regulation of transcriptional factor early growth response-1 in human prostate cancer. Clin Cancer Res 2005;11:1028^ Shiina H, Breault JE, Basset WW, et al. Functional loss of the g-catenin gene through epigenetic and genetic pathways in human prostate cancer. Cancer Res 2005;65: Li LC, Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics 2002;18:1427^ ReguartN,HeB,XuZ,etal.Cloningandcharacterization of the promoter of human Wnt inhibitory factor-1. Biochem Biophys Res Commun 2004;323: 229 ^ Wong SC, Lo ES, Lee KC, et al. Prognostic and diagnostic significance of h-catenin nuclear immunostaining in colorectal cancer. Clin Cancer Res 2004;10: 1401^ Karim R, Tse G, Putti T, et al. The significance of the Wnt pathway in the pathology of human cancers. Pathology 2004;36:120^ Cadigan KM, Nusse R. Wnt signaling: a common theme in animal development. Genes Dev 1997;11: 3286 ^ Taniguchi H, Yamamoto H, Hirata T, et al. Frequent epigenetic inactivation of Wnt inhibitory factor-1 in human gastrointestinal cancers. Oncogene 2005;24: 7946 ^ Hrzenjak A, Tippl M, Kremser ML, et al. Inverse correlation of secreted frizzled-related protein 4 and h-catenin expression in endometrial stromal sarcomas. J Pathol 2004;204:19^ He B, Lee AY, Dadfarmay S, et al. Secreted frizzled-related protein 4 is silenced by hypermethylation and induces apoptosis in h-catenin-deficient human mesothelioma cells. Cancer Res 2005;65: 743 ^ Hsieh SY, Hsieh PS, Chiu CT, et al. Dickkopf-3/REIC functions as a suppressor gene of tumor growth. Oncogene 2004;23:9183 ^ Bryan RT, Nicholls JH, Harrison RF, et al. The role of h-catenin signaling in the malignant potential of cystitis glandularis. J Urol 2003;170:1892 ^ CaldwellGM,JonesC,GensbergK,etal.TheWnt antagonist sfrp1in colorectal tumorigenesis. Cancer Res 2004;64:883^ Clin Cancer Res 2006;12(2) January 15, 2006

10 Epigenetic Inactivation of Wnt Inhibitory Factor-1 Plays an Important Role in Bladder Cancer through Aberrant Canonical Wnt/β-Catenin Signaling Pathway Shinji Urakami, Hiroaki Shiina, Hideki Enokida, et al. Clin Cancer Res 2006;12: Updated version Access the most recent version of this article at: Cited articles Citing articles This article cites 35 articles, 12 of which you can access for free at: This article has been cited by 18 HighWire-hosted articles. Access the articles at: alerts Sign up to receive free -alerts related to this article or journal. Reprints and Subscriptions Permissions To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at To request permission to re-use all or part of this article, use this link Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.