Expression of NRF2 and NRF2-modulated genes in peripheral blood leukocytes of bladder cancer males

Transcription

1 Neoplsm 60, 2, doi: /neo_2013_016 Expression of NRF2 nd NRF2-modulted genes in peripherl blood leukocytes of bldder cncer mles E. RESZKA 1, *, Z. JABLONOWSKI 2, E. WIECZOREK 1, J. GROMADZINSKA 1, E. JABLONSKA 1, M. SOSNOWSKI 2, W. WASOWICZ 1 1 Deprtment of Toxicology nd Crcinogenesis, Nofer Institute of Occuptionl Medicine, Lodz, Polnd; 2 I Deprtment of Urology, Medicl University, Lodz, Polnd *Correspondence: edyt@imp.lodz.pl Received My 7, 2012/ Accepted August 1, 2012 Nucler fctor (erythroid-derived 2)-like 2 (NRF2) is n oxidnt-responsive trnscription fctor involved in induction of ntioxidnt genes. We ssessed NRF2 nd selected NRF2-modulted gene expression: glutthione S-trnsferse A1 nd P1 (GSTA1 nd GSTP1), mitochondril superoxide dismutse (SOD2) in blood leukocytes of 51 bldder cncer ptients nd 90 control mles. A significnt up-regultion of SOD2 expression (P=0.002) ws observed in leukocytes of ptients. NRF2 expression ws positively correlted with GSTP1 nd with SOD2 mrna level, both in ptients nd controls. These dt suggest disturbnces in SOD2 trnscription in circulting blood leukocytes of mles with bldder cncer. Moreover, concomitnt constitutive expression of NRF2 nd its trget genes my suggest importnt role of NRF2 trnscription fctor in positive regultion of ntioxidnt genes, resulted in enhnced cytoprotection in humn peripherl blood leukocytes. Key words: NRF2, ntioxidnt gene expression, bldder cncer, leukocytes Oxidtive stress, disturbed blnce between reduction nd oxidtion rections, my be involved in the crcinogenic process ssocited with exposure to environmentl crcinogens. Bldder cncer ws one of the first cncer diseses to be linked to environmentl crcinogens (concomitnt to niline dye mnufcture, rubber nd lether industries) such s heterocyclic romtic mines, nitrites nd nitrtes, polycyclic romtic hydrocrbons (PAHs), ionizing rdition, etc. [1]. Overproduction of free rdicls my cuse formtion of oxidnt DNA, protein nd lipid dmges nd lso my induce disturbnces in cellulr trnsduction pthwys [2]. Antioxidnt enzymes, including ctlse (CAT), selenium-dependent glutthione peroxidse (GPX), selenium-independent glutthione peroxidse glutthione S-trnsferse (GST) nd superoxide dismutse (SOD) re involved in response to redox sttus ltertion due to removing of specific free rdicls [3]. Rodent nd in vitro studies showed tht mjor mechnism in the defense ginst oxidtive stress is nucler fctor (erythroid-derived 2)-like 2 (NFE2L2 or NRF2)-regulted signling pthwy, which controls the expression of trget genes possessing ntioxidnt response element (ARE) sequence in their promoters. Under bsl conditions, trnscription fctor NRF2 is loclized in the cytoplsm nd regulted by inhibitor Kelchlike ECH-ssocited protein 1 (KEAP1). Upon ctivtion by oxidnts nd electrophiles, NRF2 is shuttled to the nucleus nd recognizes ARE of vrious ntioxidnt nd detoxifying genes, leding to their up-regultion. Therefore, NRF2-modulted ntioxidnt enzymes my protect ginst electrophilic gents nd oxidnts nd my contribute to the enhncing nti-crcinogenic potentil [4, 5]. GSTs, lrge group of cytosolic nd lso membrne-bound enzymes, ply criticl role in detoxifiction of electrophilic compounds, including crcinogen, drugs, nd products of oxidtive stress by conjugtion with glutthione (GSH). GST izoenzymes re involved in detoxifiction of environmentlly nd tobcco smoke derived xenobiotics (e.g. PAHs, diolperoxides nd lkylting drugs). GST isoenzymes exhibit peroxidse ctivity, thereby protecting the cells from rective oxygen species nd ftty cid hydroperoxides. Bsed on sequence homology nd chromosoml loction, GSTs hve been divided into seven cytosolic clsses: lph (GSTA), mu (GSTM), omeg (GSTO), pi (GSTP), sigm (GSTS), thet (GSTT), zet (GSTZ); mitochondril clss kpp (GSTK) nd three microsoml subfmilies (MGST) [6]. Three SOD enzymes: cellulr SOD1,

2 124 E. RESZKA, Z. JABLONOWSKI, E. WIECZOREK, J. GROMADZINSKA, E. JABLONSKA, M. SOSNOWSKI, W. WASOWICZ Tble 1. Group chrcteristics Control, n=90 or n (freq) Bldder cncer, n=51 or n (freq) Age (yers) 58.3± ± BMI (kg/m 2 ) 26.5± ± Non-smokers 66 (73.3%) 20 (39.2%) < Smokers 24 (26.7%) 31 (60.8%) T1 44 (86.3%) T2 to T4 7 (13.7%) G1 b 22 (43.1%) G2 22 (43.1%) G3 7 (13.8%) T stge b G grde mitochondril SOD2 nd extrcellulr SOD3 re involved in dismuttion of superoxide nion ( ˉ). Hydrogen peroxide (H 2 ), product of this rection, is further metbolized by CAT or GPXs nd GSTs. SOD2 is ntioxidtive enzyme essentil for vitlity. It ctlyses conversion of deriving from electron lekge from the mitochondril electron trnsport chin ˉ to H 2 [7, 8]. Antioxidtive properties of GSTs nd SOD2, regulted by NRF2 trnscription fctor, my be importnt in cncers of vrious types. GSTs protein expression nd ctivity ws extensively investigted, while SOD2 nd NRF2 trnscript levels hve been seldom studied in urinry bldder cncer. Severl studies report tht urinry bldder tumors hve been shown to express high levels of vrious GST isoenzymes compred with surrounding non-mlignnt uroephitelium [9-12]. Similrly, SOD2 nd NRF2 ws up-regulted in humn bldder cncers nd tumor cells [13, 14]. Studies on gene expression in white blood cells (WBC), s n esily ccessible surrogte tissue, offers chnces to obtin gene ptterns in response to endo- nd egzogenous stimuli. Gene expression ptterns my be useful to define biologicl P processes ssocited with humn helth nd disese [15]. However, little is known of NRF2 nd ntioxidnt genes expression in humn WBC. This study investigted NRF2 nd NRF2 trget genes involved in defence ginst oxidtive stress in circulting blood leukocytes of bldder cncer nd control mles to nlyze disese-relted ltertion in NRF2 nd ntioxidnt genes mrna level. Moreover, we nlyzed possible correltion between constitutive expression of NRF2 trnscription fctor nd its trget genes in WBC of ptients nd controls. Ptients nd methods Urinry bldder cncer ptients (n=51) nd controls (n=90), both mles, were recruited from I st Deprtment of Urology, Medicl University in Lodz nd volunteers from Nofer Institute of Occuptionl Medicine in Lodz, respectively. Bldder cncer occurs more frequently in men thn women nd therefore we hve decided to investigte mles only. Moreover, gender is regrded s potentil confounder of gene expression in humn WBC [16]. All ptients underwent trnsurethrl resection nd they presented non-muscle invsive bldder cncer with low T1 stge nd muscle invsive bldder cncer with stge from T2 to T4. The Regionl Ethics Committee for Scientific Reserch pproved the study protocol nd written consent ws obtined from ech prticipnt of the study. Venous blood smples were collected into S-Monovette heprinized test tubes. Study prticipnts completed questionnire tht provided informtion on demogrphic chrcteristics (ge, body mss index (BMI)), nd smoking history. The chrcteristics of the study subjects is presented in Tble 1. Totl RNA ws isolted from whole blood using QIAmp RNA Blood Mini Kit (Qigen). Bsl expression levels of GSTA1, GSTP1, SOD2 nd NRF2 in circulting blood leukocytes were determined by mens of quntittive Rel-Time PCR. Primers for trget genes were designed with Becon Designer 7.0 (PREMIER Biosoft Interntionl) ccording Tble 2. Oligonucleotides for gene expression nlysis Gene (size) Nucleotide sequence GI number GSTA1 (1046 bp) GI: GSTP1 (737 bp) GI: NRF2 (2884 bp) GI: SOD2 (1593 bp) GI: GAPDH (1310 bp) GI: F-forwrd, R-reverse primer 5 3 Primers F TGGTTGAGATTGATGGGATGAAG R TGGACATACGGGCAGAAGG F ACCAGTCCAATACCATCC R GCCTTCACATAGTCATCC F AGCGACGGAAAGAGTATGAG R TGGGCAACCTGGGAGTAG F CCTGGAACCTCACATCAAC R GCTGTAACATCTCCCTTGG F GGACCTGACCTGCCGTCTAG R TGTAGCCCAGGATGGCCCTTG Amplicon size nd position (nucleotides rnge) 170 bp ( ) 175 bp ( ) 199 bp ( ) 129 bp ( ) 101 bp ( )

3 ANTIOXIDANT GENES EXPRESSION IN LEUKOCYTES OF BLADDER CANCER MALES 125 to GenBnk genetic sequence dtbse (Tble 2). The cdna ws synthesized on 250 ng RNA with Quntitect Kit (Qigen). Expression ws quntified with FstStrt SYBR Green Mster (Roche) nd using glycerldehyde 3-phosphte dehydrogense (GAPDH) s the endogenous control, presenting stble expression in humn circulting leukocytes. Stndrd curves were prepred for ech gene using Universl Humn Reference RNA (Strtgene) previously reverse-trnscribed. All smples were mplified in triplicte. Control nd cncer smples were co-mplified on the sme plte. Gene expression dt were evluted by Pfffl method with reference gene-normlized reltive quntifiction with efficiency correction using Q-Gene softwre [17], while clibrtor-normlized reltive expression to estimte up nd down regultion for gene expression in bldder cncer group ws clculted with REST 2009 Softwre (Version: ). The differences between the groups were ssessed by Mnn-Whitney U nd t-test. The ssocition between gene expression ws computed by multivrite logistic regression nd the results were djusted for ge, BMI, nd smoking sttus. The vlue of P<0.05 ws considered to reflect sttisticl significnce, nd sttisticl tests were two-sided. All nlyses were crried out with STATA11 (SttCorp. LP) nd GrphPd Prism Version 5.04 (GrphPd Softwre, Inc.) softwre. Results Urinry bldder cncer mles were significntly older (66.0±1.3 yers) thn control mles (58.3±1.7 yers). Smokers were more prevlent mong cncers thn controls (60.8% vs. 26.7%). The mjority of bldder cncer ptients were nonmuscle invsive chrcterized by low stge (T1) (n=44, 86.3%) nd seven ptients (13.7%) presented muscle invsive bldder cncer. High degree of neoplsm (G) ws found in twenty two (43.1%) ptients with grde G2 nd seven ptients with grde G3 (13.8%). All subjects expressed detectble mrna levels in blood leukocytes with lrge inter-individul vritions in gene expression. The highest level of gene trnscripts in circulting leukocytes ws observed for SOD2, while the lowest level ws ttributble to GSTA1 gene. Bldder cncer men presented 1.25-fold (stndrd error: ) up-regultion of SOD2 in circulting blood leukocytes compred to control men, while GSTA1, GSTP1 nd NRF2 mrna expression ws not ffected by cncer disese (Tble 3). In controls, significntly negtive reltionship between expression of GSTA1, GSTP1 nd NRF2 mrna level nd ge (β-coefficient= , P=0.04; β-coefficient=-0.001, P=0.04; β-coefficient= , P=0.008, respectively) ws found. Additionlly, in this group BMI index ws ssocited with significnt increse of GSTA1 expression (β-coefficient= , P=0.04). Bldder cncer ptients, nlyzed ccording to ge or BMI did not show differences in GSTA1, GSTP1, SOD2 nd NRF2 mrna expression (dt not shown). We observed higher expression of ntioxidnt genes in non-smokers thn in smokers of control group, but not of bldder cncer mles (Tble 4). We did not observe differences in genes expression of ptients with different invsiveness T nd tumor grde G (dt not shown). In both groups, nlyzed seprtely nd together, significnt positive reltionship between mrna level of NRF2 nd SOD2 nd between NRF2 nd GSTP1 ws found (Tble 5). Discussion Peripherl blood leukocytes my be used s surrogte tissue insted of inccessible tissue to nlyze effects of exo-nd en- Tble 3. Reltive mrna expression normlized to GAPDH nd reltive mrna expression in leukocytes of bldder cncer ptients normlized to GAPDH nd controls b Gene Control Bldder cncer P Fold chnge (Std. error) P b GSTA ± ± ± ± ± ± ± ± ( ) 0.50 GSTP ( ) 0.83 NRF ( ) 0.56 SOD ( ) 0.002

4 126 E. RESZKA, Z. JABLONOWSKI, E. WIECZOREK, J. GROMADZINSKA, E. JABLONSKA, M. SOSNOWSKI, W. WASOWICZ Tble 4. Reltive gene expression in leukocytes of bldder cncer ptients nd controls in reltion to smoking hbit Control Non-smokers Smokers Non-smokers Smokers Bldder cncer β-coeff. P β-coeff. P GSTA ± ± ± ± GSTP ± ± ± ± NRF ± ± ± ± SOD ± ± ± ± djusted for ge nd BMI Tble 5. Reltionship between reltive gene expression in leukocytes Whole group Control b Bldder cncer b β-coeff. P β-coeff. P β-coeff. P GSTA1/GSTP GSTA1/SOD GSTA1/NRF GSTP1/SOD GSTP1/NRF SOD2/NRF < < < djusted for dignosis, smoking hbit, ge nd BMI b djusted for smoking hbit, ge nd BMI dogenous stimuli on the helth sttus [15]. In previous studies, bsl expression of GSTA1, GSTP1 [18], SOD2 [16] nd NRF2 [19] in humn circulting WBC ws detected. To dd, we nlyzed these genes in blood leukocytes, encompssing grnulr nd grnulr WBC. All nlyzed genes presented detectble level in circulting leukocytes of exmined ptients, with the highest mrna expression ttributble to SOD2, followed by GSTP1, NRF2 nd the lowest to GSTA1. Similrly, GSTP1 mrna expression ws most bundnt mong GST mrna in humn lymphocytes, followed by GSTA1 nd GSTM1, which were detectble in pproximtely hlf of nlyzed smples with GSTM1 positive genotype [18]. Severl studies on GSTs in urinry bldder tissues showed significntly higher ctivity nd expression of these enzymes in bldder cncer tissues thn in norml uroepithelium. Moreover, chnges in GSTs hve been ssocited with tumor stge, ggressiveness nd cncer progression [9-12] nd lso resistnce to chemotherpy [20]. GST ctivity ws lso found to be higher in the blood of bldder cncer individuls thn in controls [21] nd high plsm GSTA1 nd GSTP1 levels were more frequently observed in urinry bldder cncer ptients thn in controls [22]. Up-regultion of GSTP1 in urinry bldder cncer ssocited with the high GSTP1 ctlytic ctivity my lso revel high ntioxidnt requirements ginst peroxides nd H 2, in prticulr in response to elevted oxidtive stress in the mlignnt cell. Aprt from ctlytic ctivity in detoxifiction of vrious xenobiotics, GSTP1 plys lso n importnt role in regultion of cellulr prolifertion nd poptosis in the response to ltered redox blnce in the cells [9]. However, except of SOD2 mrna elevted level in peripherl leukocytes of bldder cncer ptients, we did not find significnt differences of GSTA1 nd GSTP1 trnscripts level in circulting blood leukocytes of ptients nd control men. Similrly, there were no differences in NRF2 mrna expression in leukocytes in both studied groups of men. In lrge-scle gene expression profiling, NRF2 ws up-regulted in humn bldder cncer (superficil nd invsive) t 92.9% when compred with norml bldder smples [14]. Although erly studies hve indicted suppressive function of SOD2 on cncer development, lter studies showed enhnced expression of SOD2 in metsttic tumors of specific cncers [7, 8]. Highly metsttic humn bldder cells displyed significntly higher SOD2 levels nd ctivities compred with the non-metsttic prentl cell line. The increse in SOD2 expression ws ccompnied by significnt decrese in CAT ctivity, resulting in net increse in H 2 production in metstctic cell line [13]. Interestingly, fter the exposure of polymorphic blood mononucler cells to H 2, down-regultion of SOD2 ws observed t protein level, while lrge number of other redox-regulting enzymes remined unffected [23]. This effect my point to the significnce of SOD2 in redox blnce ltertions with decresing SOD2 protein level used in ˉremoving ccompnied by incresing mrna SOD2 level for mintennce of ntioxidtive protection. Therefore, elevted expression of SOD2 mrna observed in circulting leukocytes of urinry bldder cncer mles my be result of redox sttus ltertions.

5 ANTIOXIDANT GENES EXPRESSION IN LEUKOCYTES OF BLADDER CANCER MALES 127 It is widely known tht genes studied in blood leukocytes exhibit differentil expression dependent on sex, ge, BMI nd smoking [15]. We found tht gene expression in circulting blood leukocytes presented inter-individul differences cused by ge, smoking hbit nd BMI. Interestingly, these ssocitions were observed only in non-cncer men, which my suggest ltertions in white blood cell metbolism nd trnscription process in humns with cncer disese. It is widely known from in vitro nd rodent studies tht NRF2 controls constitutive expression nd followed by vrious electrophiles nd oxidnts, inducible expression of ntioxidnt nd detoxifying enzymes, which results in enhnced cytoprotection ginst oxidtive stress nd chemicl crcinogenesis [4,5]. NRF2 trnsctivtes wide vriety of enzymes, including GSTA1, GSTP1 nd SOD2 [24-26]. The chemiclly induced urinry bldder crcinogenesis in rodents showed importnce of NRF2 trnscripton fctor in bldder cncer development [27]. However, little is known of NRF2 trnscription fctor nd its trget genes expression in humn WBC, especilly in cncer, including bldder cncer ptients. Concomitnt mrna expression of NRF2 nd SOD2 or GSTP1 observed in this study for the first time indictes the interply between constitutive expression of NRF2 trnscription fctor nd its two trget genes in humn circulting blood leukocytes. It my confirm dependence of NRF2 nd ntioxidnt genes in peripherl humn tissue, s they shre biologicl functions under common regultory control of NRF2 medited signling pthwy. The positive correltion found in cncer ptients nd control group, suggests tht regultion of constitutive SOD2 or GSTP1 gene expression by NRF2 trnscription fctor is not ffected by cncer disese. In conclusion, SOD2 mrna level up-regultion in leukocytes of bldder cncer mles my indicte ltertions of redox sttus in cncer ptients nd importnce of SOD2 in ntioxidtive defense. Moreover, positive ssocition between constitutive gene expression of trnscription fctor NRF2 nd SOD2 nd lso between NRF2 nd GSTP1 in humn circulting blood leukocytes clerly shows tht interply between NRF2 nd its trget genes, previously observed in rodents nd in vitro studies, is bsl moleculr mechnism observed under physiologicl conditions in helthy men nd independent from pthologicl conditions. Studies on NRF2 nd NRF2-regulted ntioxidnt nd detoxifying enzymes t multiple steps of NRF2 signling pthwys in humns, using blood cells s substitute trget orgn of ction my constitute vluble contribution to the evlution of nticrcinogenic mechnisms nd my be used for the ssessment of the effects of chemotherpy in cncer disese, relted with NRF2 nd NRF2-modulted cytoprotective genes. Acknowledgments: This study ws finncilly supported by the Ministry of Science nd Higher Eduction (1978/B/P01/2009/37) nd internl grnt IMP1.8/2009. Prt of this work ws presented in 36th FEBS Congress Biochemistry for Tomorrow s Medicine, Torino, References [1] VOLANIS D, KADIYSKA T, GALANIS A, DELAKAS D, LOGOTHETI S et l. Environmentl fctors nd genetic susceptibility promote urinry bldder cncer. Toxicol Lett 2010; 193: j.toxlet [2] KLAUNIG JE, KAMENDULIS LM The role of oxidtive stress in crcinogenesis. Annu Rev Phrmcol Toxicol 2004; 44: [3] LIMON-PACHECO J, GONSEBATT ME The role of ntioxidnts nd ntioxidnt-relted enzymes in protective responses to environmentlly induced oxidtive stress. Mutt Res 2009; 674: j.mrgentox [4] KENSLER TW, WAKABAYASHI N Nrf2: friend or foe for chemoprevention? Crcinogenesis 2010; 31: dx.doi.org/ /crcin/bgp231 [5] MAHER J, YAMAMOTO M The rise of ntioxidnt signling The evolution nd hormetic ctions of Nrf2. Toxicol Appl Phrmcol 2010; 244: j.tp [6] NEBERT DW, VASILIOU V Anlysis of the glutthione S-trnsferse (GST) gene fmily. Hum Genomics 2004; 6: [7] HEMPEL N, CARRICO PM, MELENDEZ JA Mngnese superoxide dismutse (Sod2) nd redox-control of signling events tht drive metstsis. Anticncer Agents Med Chem 2011; 11: [8] KINNULA VL, CRAPO JD Superoxide dismutses in mlignnt cells nd humn tumors. Free Rdic Biol Med 2004; 36: [9] PLJESA-ERCEGOVAC M, SAVIC-RADOJEVIC A, DRAGICEVIC D, MIMIC-OKA J, MATIC M et l. Enhnced GSTP1 expression in trnsitionl cell crcinom of urinry bldder is ssocited with ltered poptotic pthwys. Urol Oncol 2011; 29: j.urolonc [10] SAVIC-RADOJEVIC A, MIMIC-OKA J, PLJESA-ERCE- GOVAC M, OPACIC M, DRAGICEVIC D et l. Glutthione S-trnsferse-P1 expression correltes with incresed ntioxidnt cpcity in trnsitionl cell crcinom of the urinry bldder. Eur Urol 2007; 52: /j.eururo [11] SIMIC T, MIMIC-OKA J, SAVIC-RADOJEVIC A, OPACIC M, PLJESA M et l. Glutthione S-trnsferse T1-1 ctivity upregulted in trnsitionl cell crcinom of urinry bldder. Urology 2005; 65: j.urology [12] SIMIC T, SAVIC-RADOJEVIC A, PLJESA-ERCEGOVAC M, MATIC M, MIMIC-OKA J Glutthione S-trnsferses in kidney nd urinry bldder tumors. Nt Rev Urol 2009; 1: [13] HEMPEL N, YE H, ABESSI B, MIAN B, MELENDEZ JA Altered redox sttus ccompnies progression to metsttic

6 128 E. RESZKA, Z. JABLONOWSKI, E. WIECZOREK, J. GROMADZINSKA, E. JABLONSKA, M. SOSNOWSKI, W. WASOWICZ humn bldder cncer. Free Rdic Biol Med 2009; 46: [14] KAWAKAMI K, ENOKIDA H, TACHIWADA T, GOTANDA T, TSUNEYOSHI K et l. Identifiction of differentilly expressed genes in humn bldder cncer through genome-wide gene expression profiling. Oncol Rep 2006; 16: [15] DUMEAUX V, OLSEN KS, NUEL G, PAULSSEN RH, BOR- RESEN-DALE AL et l. Deciphering norml blood gene expression vrition The NOWAC postgenome study. PLoS Genet 2010; 6: e pgen [16] KHYMENETS O, COVAS MI, FARRE M, LANGOHR K, FITO M et l. Role of sex nd time of blood smpling in SOD1 nd SOD2 expression vribility. Clin Biochem 2008; 41: [17] MULLER PY, JANOVJAK H, MISEREZ AR, DOBBIE Z Processing of gene expression dt generted by quntittive rel-time RT-PCR. Biotechniques 2002; 2: [18] MARIE JP, SIMONIN G, LEGRAND O, DELMER A, FAUS- SAT AM et l. Glutthione-S-trnsferses pi, lph, mu nd mdr1 mrna expression in norml lymphocytes nd chronic lymphocytic leukemi. Leukemi 1995; 9: [19] YUBERO-SERRANO EM, GONZALEZ-GUARDIA L, RANGEL-ZUNIGA O, DELGADO-CASADO N, DEL- GADO-LISTA J et l. Postprndil ntioxidnt effect of the Mediterrnen diet supplemented with coenzyme Q(10) in elderly men nd women. Age 2011; doi: /s [20] HARBOTTLE A, DALY AK, ATHERTON K, CAMPBELL FC Role of glutthione S-trnsferse P1, P-glycoprotein nd multidrug resistnce-ssocited protein 1 in cquired doxorubicin resistnce. Int J Cncer 2001; 92: org/ /ijc.1283 [21] ARIKAN S, AKCAY T, KONUKOGLU D, OBEK C, KURAL AR The reltionship between ntioxidnt enzymes nd bldder cncer. Neoplsm 2005; 52: [22] BERENDSEN CL, MULDER TPJ, PETERS WHM Plsm glutthione S-trnsferse pi 1-1 nd lph 1-1 levels in ptients with bldder cncer. J Urol 2000; 164: [23] HAUDEK VJ, GUNDACKER NC, SLANY A, WIMMER H, BAYER E et l. Consequences of cute nd chronic oxidtive stress upon the expression pttern of proteins in peripherl blood mononucler cells. J Proteome Res 2008; 7: [24] NGUYEN PM, PARK MS, CHOW M, CHANG JH, WRISCHNIK L et l. Benzo[]pyrene increses the Nrf2 content by downregulting the Kep1 messge. Toxicol Sci 2010; 116: [25] SHAN Y, WANG X, WANG W, HE C, BAO Y p38 MAPK plys distinct role in sulforphne-induced up-regultion of ARE-dependent enzymes nd down-regultion of COX-2 in humn bldder cncer cells. Oncol Rep 2010; 23: [26] TAYLOR RC, ACQUAAH-MENSAH G, SINGHAL M, MAL- HOTRA D, BISWAL S Network inference lgorithms elucidte Nrf2 regultion of mouse lung oxidtive stress. PLoS Comput Biol 2008; 4: e pcbi [27] IIDA K, ITOH K, MAHER JM, KUMAGAI Y, OYASU R, et l. Nrf2 nd p53 coopertively protect ginst BBN-induced urinry bldder crcinogenesis. Crcinogenesis 2007; 28: