SUPPLEMENTARY INFORMATION. Cytochrome P450-2E1 promotes fast food-mediated hepatic fibrosis

Transcription

1 SUPPLEMENTARY INRMATION Cytochrome P-E1 promotes fst food-medited heptic fibrosis Mohmed A. Abdelmegeed, Youngshim Choi, Grzegorz Godlewski b, Seung-Kwon H, Atryee Bnerjee, Sehwn Jng, nd Byoung-Joon Song Section of Moleculr Phrmcology nd Toxicology, Lbortory of Membrne Biochemistry nd Biophysics, Ntionl Institute on Alcohol Abuse nd Alcoholism, Bethesd, MD, 89, USA, b Lbortory of Physiologicl Studies, Ntionl Institute on Alcohol Abuse nd Alcoholism, Bethesd, MD 98, USA. Supplementry Mterils nd Methods Blood chemistry Serum lnine minotrnsferse (ALT) ws quntified by clinicl chemistry nlyzer (IDEXX Vet Test, IDEXX Lbortories, Westbrook, ME, USA). Serum leptin ws evluted by Mouse Leptin ELISA Kit, Abcm Inc., Cmbridge, MA, USA). Endotoxin levels were mesured using the commercil kit from Lonz (Wlkersville, MD, USA). Mesurements for leptin nd endotoxin were by following the mnufcturers instructions. Tissue extrction, immunoblot nlyses nd mesurements of heptic TG content nd CYPE1 ctivity Liver homogentes were prepred in ice cold extrction buffer ( mm Tris Cl, ph 7., 1 mm EDTA, nd 1% CHAPS), s described 1. Equl mounts of liver homogentes were resolved on 1% SDS PAGE gels nd immunoblot procedures were performed, s previously described. Imge detection ws performed using SuperSignl West Pico Kit

2 (Pierce) ccording to the mnufcturer s instructions. β-actin ws used s loding control, unless otherwise indicted. Vlues described on top of ech immunoblot represent densitometric mesurements normlized to the loding control, nd the vlues of WT-STD were set t 1 s controls for ll other groups t different time points. For heptic TG mesurement, liver tissues ( mg wet weight) from individul mice of different groups were homogenized in % Triton X-1 solution nd heted in 8 1 C wter bth for min to solubilize TG. The smples were then centrifuged t 1, g for 1 min, nd the resulting superntnts were used to determine the TG levels using the mnufcturer s instruction provided with the EnzyChromTM TG Assy Kit (BioAssy Systems, Hywrd, CA, USA). CYPE1 ctivities were mesured by quntifying the oxidtion rte of p-nitrophenol (PNP) to p-nitroctechol, s previously described 3. IR nd glucose tolernce (GT) tests After 11 nd 3 wks of feeding, IR nd GT tests were performed in mice fsted for h nd subsequently injected with insulin (.7 U/kg; Eli Lilly) nd in mice fsted overnight nd injected with glucose ( g/kg), respectively. GT tests were performed 3 dys fter the IR tests. Til blood ws collected t, 3,, 9, nd 1 min fter intrperitonel injection of insulin (IR) or glucose (GT). Blood glucose levels were determined using the Elite glucometer (Byer), s detiled. Indirect clorimetry nd mbultory ctivity. Mesurements for both WT nd Cype1-null mice fed were conducted in metbolic cges (Oxymx; Columbus Instruments, USA), s previously described. The chmbers were equipped with two-dimensionl infrred bem sensors (Opto-M3;

3 Columbus Instruments, USA) for locomotor ctivity mesurements. Totl energy expenditure (TEE) ws clculted s oxygen consumption (VO) ( RQ), where RQ is the respirtory quotient [the rtio CO production (VCO)/VO]. Net ft oxidtion rte ws clculted using the formul by Simonson nd DeFronzo : Ft oxidtion = 1.9 (VO VCO). Vlues were normlized with respect to the body weight nd djusted to n effective metbolic body size (kg.7 ). Gene expression Anlysis Totl RNA ws isolted from mg of frozen liver nd 1 mg of frozen ft tissues using Trizol from Life Technologies (Grnd Islnd, NY), ccording to the mnufcturer s recommendtions. The concentrtion of RNA smples ws mesured by Nnodrop ND-1 (Thermo Scientific, Wilmington, DE). Rel-time quntittive PCR mplifictions were crried out in 79HT Sequence Detection System from Applied Biosystems (Foster City, CA) nd Eco Rel-Time PCR system from Illumin (Sn Diego, CA) in μl volume. The rection ws conducted using Power SYBR Green RNA-to- CT 1-Step Kit from Life Technologies (Grnd Islnd, NY) following the mnufcturer s recommendtions. Both of the forwrd nd reverse primers ( nm ech), nd ng of templte RNA were used. All rections were crried out in four biologicl replictes. The PCR mplifictions were conducted by the mnufcturer s recommendtions. To distinguish specific mplicons from non-specific mplifictions, dissocition curve ws generted nd exmined. The Ct-vlues were clculted with SDS.3, RQ Mnger 1. (Applied Biosystems), nd Eco softwre V. (Illumin) with n utomtic djustment of bse line nd determintion of Ct. The resulting Ct-vlues were imported to Microsoft Excel worksheet for further nlysis. Sttisticl nlysis ws conducted using Grphpd

4 Prism softwre (GrphPd Softwre Inc.). The primers used for Collgen nd TGF-β were designed by using Primer-BLAST softwre ( The primer sequences were designed to spn the intron region of trget gene to void mplifiction of trce mounts of genomic DNA in the smples. The sequences were s follows: collgen 11 (Col11)-F, CTGACGCATGGCCAAGAAGA, Col11-R, ATACCTCGGGTTTCCACGTC; TGF-β-F, ACGTCACTGGAGTTGTAGG, TGF-β-R, ATGTCATGGATGGTGCCCAG; β-ctin-f, TTTGCAGCTCCTTCGTTGCC, nd β-ctin- R, ACGGTTGGCCTTAGGGTTCAG. Reference 1. Abdelmegeed, M.A. et l. PPARlph expression protects mle mice from high ft-induced nonlcoholic ftty liver. J Nutr 11, 3-1 (11).. Abdelmegeed, M.A. et l. Criticl role of cytochrome P E1 (CYPE1) in the development of high ft-induced non-lcoholic stetoheptitis. J Heptol 7, 8-8 (1). 3. Abdelmegeed, M.A., Moon, K.H., Hrdwick, J.P., Gonzlez, F.J. & Song, B.J. Role of peroxisome prolifertor-ctivted receptor-lph in fsting-medited oxidtive stress. Free Rdic Biol Med 7, (9).. Tm, J. et l. Peripherl CB1 cnnbinoid receptor blockde improves crdiometbolic risk in mouse models of obesity. J Clin Invest 1, 93-9 (1).. Simonson, D.C. & DeFronzo, R.A. Indirect clorimetry: methodologicl nd interprettive problems. Am J Physiol 8, E399-1 (199).. Ye, J. et l. Primer-BLAST: tool to design trget-specific primers for polymerse chin rection. BMC Bioinformtics 13, 13 (1).

5 Supplementry Tble 1. Composition of the experimentl diets Chow (3. kcl/g) Fst Food (.9 kcl/g) % kcl from % kcl from Protein. Crbohydrte. Ft 1.1 Ingredient % Sucrose 3.7 Milk Ft Csein 19.7 Mltodextrin 9.98 Corn Strch.993 Powdered Cellulose.993 Minerl mixture 3.9 Vitmin mixture b.998 Corn Oil.998 Clcium Crbonte.399 DL-Methionine.99 Choline Bitrtrte.18 Cholesterol.7 Ethoxyquin. AIN-7 minerl mixture b AIN-7 vitmin mixture

6 Supplementry Figures S1- A C o ll g e n (Reltive m RNA level) STD b WT Null weeks B TG Fβ (Reltive m RNA level) 3 1 STD b WT Null weeks Figure S1. Incresed mrna levels of collgen nd TGF-β in WT- t wks. Reltive mrna levels of the two genes involved in fibrosis: (A) collgen nd (B) TGF-β re shown. Reltive expression of ech trget mrna hs been stndrdized to β-ctin mrna. Dt re presented s men ± SEM (n = /group). Columns without common smll lphbeticl chrcter re significntly different from the other group(s).

7 WT Cype1-null N N STD ER M N N N M ER ER M Figure S. Ultrstructurl fetures of -induced liver injury. Trnsmission EM studies demonstrting regulr prllel orgnized ER (ER) in close ssocition with mitochondri (M) in control (STD) livers in WT nd Cype1-null mice (N, nucleus) nd irregulrly rrnged nd disrupted ER, prticulrly in WT-. There ws slight vribility in mitochondril size nd shpe in groups.

8 A Glucose Intolernce - 1 weeks C Insulin resistnce - 1 weeks control 3 1 m in control 3 1 m in control Control 1 m in WT Cype1-null WT Cype1-null B Glucose Intolernce - weeks D Insulin resistnce - weeks 3 control 1 m in WT control 1 m in Cype1-null control 1 m in WT Control 1 m in Cype1-null Figure S3. Impired GT nd incresed IR in WT-. Til blood ws collected following glucose injection (i.p. g/kg) (A nd B) or insulin (i.p..7 U/kg) (C nd D) t the indicted time points for ll groups, s illustrted (n=/group). Sttisticl differences for AUC re shown in Fig. 7

9 A VO 3 KO Metbolic profiling t weeks VO 3 1 Dy 1 Dy 1 :3 m :3 pm :3 m :3 pm :3 m B VCO 3 3 VCO 3 1 :3 m :3 pm :3 m :3 pm :3 m C T E E (K c l/h /k g.7 ) 1 TEE 1 8 :3 m :3 pm :3 m :3 pm :3 m D P=.7 :3 m :3 pm :3 m :3 pm :3 m E A m b u l to ry A c tiv ity (Counts, X+Y) 1 :3 m :3 pm :3 m :3 pm :3 m AA 3 1 Figure S. Metbolic profiles of -fed mice for weeks s nlyzed by mens of indirect clorimetry. Dt were monitored by indirect clorimetry for WT- nd null- nd presented s hourly observtions (right pnels; shded re indictes lights off) or s verge of 8-hours recording period (left pnels). The rtes of (A) O consumption, (B) CO production, (C) totl energy expenditure (TEE), (D) ft oxidtion (), nd (E) mbultory ctivity (AA) re presented. n = 3- smples/group, P <..

10 A VO 3 1 KO Dy 1 Dy Metbolic profiling t 1 weeks VO 3 1 B VCO :3 m :3 pm :3 m :3 pm :3 m 3 1 VCO 1 C T E E (K c l/h /k g.7 ) :3 m :3 pm :3 m :3 pm :3 m 1 :3 m :3 pm :3 m :3 pm :3 m TEE 1 8 D E A m b u l to ry A c tiv ity (Counts, X+Y) :3 m :3 pm :3 m :3 pm :3 m 1 8 :3 m :3 pm :3 m :3 pm :3 m AA 1 Figure S. Metbolic profiles of -fed mice for 1 weeks s nlyzed by mens of indirect clorimetry. Dt were monitored by indirect clorimetry for WT- nd null- nd presented s hourly observtions (right pnels; shded re indictes lights off) or s verge of 8-hours recording period (left pnels). The rtes of (A) O consumption, (B) CO production, (C) totl energy expenditure (TEE), (D) ft oxidtion (), nd (E) mbultory ctivity (AA) re presented. n = 3- smples/group, P <..

11 A KO Metbolic profiling t weeks 3 VO 3 VO 1 1 Dy 1 Dy :3 m :3 pm :3 m :3 pm :3 m B 3 VCO 1 VCO 1 :3 m :3 pm :3 m :3 pm :3 m C D TEE(Kcl/h/kg.7 ) 1 :3 m :3 pm :3 m :3 pm :3 m 1 TEE P=.7 P=.7 E A m b u l to ry A c tiv ity (Counts, X+Y) :3 m :3 pm :3 m :3 pm :3 m 1 :3 m :3 pm :3 m :3 pm :3 m AA 3 1 Figure S. Metbolic profiles of -fed mice for weeks s nlyzed by mens of indirect clorimetry. Dt were monitored by indirect clorimetry for WT- nd null- nd presented s hourly observtions (right pnels; shded re indictes lights off) or s verge of 8-hours recording period (left pnels). The rtes of (A) O consumption, (B) CO production, (C) totl energy expenditure (TEE), (D) ft oxidtion (), nd (E) mbultory ctivity (AA) re presented. n = 3- smples/group, P <..