Biochemical and Biophysical Research Communications

Transcription

1 Biochemicl nd Biophysicl Reserch Communictions 423 (2012) Contents lists vilble t SciVerse ScienceDirect Biochemicl nd Biophysicl Reserch Communictions journl homepge: Humn therosclerotic plque lipid extrct impirs the ntioxidnt defense cpcity of monocytes Andre Szuchmn-Spir,b,, Morr Etzmn,b, Snit Tmir,b Lbortory of Humn Helth nd Nutrition Sciences, MIGAL- Glilee Technology Center, P. O. Box 831, Kiryt Shmon 11016, Isrel b Tel Hi College, Upper Glilee 12210, Isrel rticle info bstrct Article history: Received 12 June 2012 Avilble online 20 June 2012 Keywords: Atherosclerosis Oxidtive stress Monocyte Plque Oxidtive stress, induced by rective oxygen species (ROS), is implicted in the pthogenesis of plque formtion nd instbility. During this ongoing oxidtive process, cells in the vsculture re exposed to the therogenicity of the plque; previous studies hve suggested tht the rteril plque, prt from being consequence of the development of therosclerosis, is lso cuse of its progression. Objective: In this study, we chllenged this ide by investigting the effect of crotid plque lipid extrct on the humn monocyte ntioxidnt system. Methods nd Results: Exposure of monocytes to crotid plque lipid extrct (LE) for up to 72 h resulted in significnt increse in the ROS level (170%), with simultneous rise of 177% in glutthione oxidtion. Experiments reveled significnt decrese, in the intrcellulr ntioxidnt enzyme ctivity of CAT, GPx nd TRxR, (by 17, 33 nd 43%, respectively). Although the ctivity of these enzymes subsequently returned to those of the controls, the levels of ROS did not decrese but rther continued incresing with extended LE exposure. Intriguingly, intrcellulr SOD ctivity rose significntly nd remined high (176%), implying tht endogenously produced H 2 O 2, nd not O 2 < is the fctor tht promotes the oxidtive stress resulting from the presence of LE. Conclusion: Lipids from the therosclerotic plque my contribute to the progression of therogenic conditions in djcent regions by wekening the cellulr ntioxidnt system nd promoting oxidtive stress, minly through H 2 O 2 production. Ó 2012 Elsevier Inc. All rights reserved. 1. Introduction Corresponding uthor t: Lbortory of Humn Helth nd Nutrition Sciences, MIGAL- Glilee Technology Center, P. O. Box 831, Kiryt Shmon 11016, Isrel. Fx: E-mil ddresses: ndres@migl.org.il (A. Szuchmn-Spir), snit@migl.org.il (S. Tmir). Accumulting evidence indictes tht oxidtive stress, induced by rective oxygen species (ROS), is implicted in the pthogenesis of plque formtion nd instbility [1,2]. Oxidized low density lipoprotein (LDL) nd its lipid components induce therogenic events, such s injury to vsculr cells, n increse in interctions between inflmmtory nd endothelil cells nd the induction of vsculr smooth muscle cell prolifertion. Previous studies hve suggested tht rteril plques, prt from being consequence of the development of the therosclerosis disese, re lso cuse of its progression. A few studies hve chllenged this ide, e.g., sonicted crotid nd coronry plques were shown to reduce the ctivity of n ntitherogenic enzyme, proxonse I, in vitro [3]. A lipid frction of humn plques ws found to cuse LDL oxidtion, elevte the oxidtive stte of mouse mcrophges nd decrese the bility of high density lipoprotein (HDL) to cuse cholesterol efflux from mcrophges, in dose response mnner [3]. In ddition, lipid extrct (LE) of therosclerotic plque, derived from ptients tht underwent endrterectomy, ws found to medite cytokine up-regultion in monocytes, cusing inflmmtion [4]. These dt imply tht plque lipids my enhnce plque formtion nd tht during this oxidtive ongoing progression, cells in the vsculture re widely exposed to the therogenicity of the plque. Studies investigting the role of ntioxidnt enzymes in the protection of cells from therogenicity hve demonstrted tht n increse in the ctivity of either Cu/Zn-superoxide dismutse (SOD) or ctlse reduces cell-medited LDL oxidtion nd oxldl-induced poptosis [5]. Overexpression of ctlse significntly decresed therosclerotic lesions nd the level of oxidized lipids in the rteril wll of polipoprotein E-deficient (ApoE / ) mice [6]. Overexpression of GPx4 in ApoE / mice inhibited the development of therosclerosis in ssocition with decrese in the level of oxidized lipids in the ort [7], while thioredoxin (TRX) expression in symptomtic unstble coronry plques ws shown to increse nd be positively correlted with intrplque hemorrhge nd thrombus formtion [8] X/$ - see front mtter Ó 2012 Elsevier Inc. All rights reserved.

2 A. Szuchmn-Spir et l. / Biochemicl nd Biophysicl Reserch Communictions 423 (2012) Aim The purpose of the current study ws, therefore, to investigte the effect of humn crotid plque lipid extrct (LE) on the cellulr expression nd ctivity of ntioxidnt enzymes nd on the oxidtive stte of monocytes. Our experiments demonstrted tht LE impirs ntioxidnt enzyme ctivity nd expression to n extent tht lessened their bility to combt the incresing levels of ROS in the cells. 2. Mterils nd Methods 2.1. Mterils Humn crotid plques were obtined from ptients tht underwent routine endrterectomy surgery under locl nesthesi in the Deprtment of Vsculr nd Trnsplnttion Surgery t Rmbm Medicl Center nd Mount Crmel Hospitl in Hif, Isrel. The reserch ws pproved by the Helsinki Committee nd by the ptients themselves. Immeditely upon removl from the ptients, the complete therosclerotic plques (which included the common internl nd externl crotid sections) were frozen nd kept t 70 C. Therefter, they were ground to powder in liquid nitrogen nd pooled. Ethyl cette (EtAc) ws used to extrct lipid frction, termed LE, which ws used t the indicted concentrtions. All chemicls, unless noted otherwise, were of nlyticl grde nd were obtined from Sigm Aldrich (Rehovot, Isrel) Cell culture THP-1 monocytes THP-1, humn leukemic monocytes were grown in RPMI 1640 medium supplemented with 5% FCS, 2 mm L-glutmine solution, 1 mm sodium pyruvte, 100 U/ml penicillin nd 100 lg/ml streptomycin (Biologicl Industries, Isrel). All cells were mintined in stndrd culture incubtor with humidified ir contining 5% CO 2 t 37 C. Cell tretments Cells were plted in 6-well culture pltes t concentrtion, which would give cells ml 1 t the end of the experiment. Cells were treted with mg/ml LE or with 200 lm H 2 O 2 (positive control). Negtive controls were treted with dimethylsulfoxide (DMSO): ethnol (96%) only, which is the sme concentrtion s in the LE tretment. Following 4, 24, 48 or 72 h of incubtion, the cell number ws determined using the fluorescence ctivted cell sorter (FACS) (Becton Dickinson) t the excittion nd emission wvelengths of 488 nd 530 nm, respectively. In ddition, expression, protein ctivities nd the glutthione oxidtion ssy were performed on these cells Intrcellulr ROS production Intrcellulr ROS production ws estimted ccording to the oxidtion of the fluorescence probe, dichlorodihydrofluorescein dicette (DCFDA). The formtion of dichlorodihydrofluorescein (DCF) ws mesured t the excittion nd emission wvelengths of 488 nd 530 nm, respectively, by mens of the FACS (Becton Dickinson) [9] Enzyme ctivity determintion Ctlse (Ct) ctivity ws quntified bsed on the rte t which one ctlse unit degrdes one micromole of H 2 O 2 min 1 t 240 nm. Reltive superoxide dismutse (SOD) ctivity ws determined ccording to percent inhibition of the reduction rte of the wtersoluble tetrzolium slt WST-1 to WST-1 formzn t 450 nm, in the presence of xnthine nd xnthine oxidse, using the SOD cellulr ssy kit (Stressgen Ct # ), ccording to the mnufcturer s instructions. The glutthione-(gsh) peroxidse (GPx) ctivity ws quntified bsed on the rte of NADPH consumption t 340 nm in the presence of mm hydrogen peroxide, s described elsewhere [10]. Thioredoxin reductse (TRxR) ctivity ws quntified using the urnofin (20 nm)- inhibitble proportion of 5,5 0 -dithiobis(2-nitrobenzoic cid) (DTNB) reduction t 412 nm, s hs been described previously [11] Intrcellulr GSH nd glutthione disulfide (GSSG) ssy At the end of the experiment cells were hrvested (200 g for 5 min t 4 C) nd wshed with cold phosphte buffered sline (PBS). Cell pellets were lyzed with cold extrction buffer (0.1 M PBS with 5 mm ethylenediminetetrcette (EDTA), 0.1% triton X-100, 0.6% sulfoslicylic cid, ph = 7.5) following 2 min of soniction on ice nd two freeze thw cycles. Cell lystes were centrifuged (200g for 5 min t 4 C), nd the superntnts were immeditely removed nd stored t 80 C until use. Totl cellulr GSH concentrtions nd GSSG/GSH rtios were quntified using liquid chromtogrphy mss spectrometry (LCMS) nd stndrd curve bsed on GSH nd GSSG commercil smples. LCMS nlysis ws performed in the positive ion mode with 6540 UHD ccurte mss (Q-TOF) (Agilent technologies, USA) coupled to Wters HPLC system (Irelnd). GSH nd GSSG were seprted on reverse-phse column (C18 XTerr; 3.5 lm; mm, ml/min flow rte) t room temperture, using 98% H 2 O: 2% cetonitrile + 0.1% cetic cid. Mss spectrometry gs flow ws set t 9 l/min, nebulizer gs t 40 PSI, sheth gs temperture t 350 C nd sheth gs flow t 11 l/min. The GSH spectrum ws identified t the retention time of 0.9 min with mss-to-chrge (m/z) rtio of The GSSG spectrum ws observed t the retention time of 1.2 min with n m/z rtio of expression The expression of ws nlyzed by the rel time polymerse chin rection (PCR). Totl RNA ws extrcted from cell pellets with Triregent (Sigm, Isrel). Ech cdna smple ws produced from 1 lg totl RNA, which ws incubted t 74 C for 10 min with 100 pmols of oligo dt17 primer. This mixture ws dded to finl volume of 25 ll solution, contining 2 mm deoxynucleotides (dntp) (Lrov, Germny), 30 U RNsin, 10 U vin myeloblstosis virus-reverse trnscriptse (AMV-RT) nd the AMV-RT buffer (Promeg, Isrel), followed by incubtion t 42 C for 2 h, nd 52 C for n dditionl 1 h. The cdna of the trnscripts ws mplified in mixture contining Absolute Blue QPCR SYBER Green ROX Mix (ABgene, UK) nd specific primers by the spectrofluorometric therml cycler (Rotor-Gene TM 6000, Corbett Reserch, Austrli), ccording to the protocol supplied by the mnufcturer. The primers used were: ctlse (forwrd) 5 0 AGGCCAGTCCTGA- CAAAATG 3 0, (reverse) 5 0 GAATCTCCGCACTTCTCCAG 3 0 ; Mn SOD (forwrd) 5 0 GCACTAGCAGCATGTTGAGC 3 0, (reverse) 3 0 GCGTTGAT GTGAGGTTCCAG 5 0 ; GPx (forwrd) 5 0 AATTCCCTCAAGTACGTCCG 3 0, (reverse) 5 0 CTCGATGTCAATGGTCTGGAA 3 0 ; TRxR (forwrd) 5 0 ATT- GCCACTGGTGAAAGACC 3 0, (reverse) 5 0 CGACATAGGATGCTCCAACA 3 0. The nneling temperture of ll primers ws 60 C, with the exception of GPx, which ws 57 C Sttisticl nlysis Results from three seprte experiments were reported s men ± SE nd considered to be sttisticlly significnt if p < 5.

3 886 A. Szuchmn-Spir et l. / Biochemicl nd Biophysicl Reserch Communictions 423 (2012) LE reduces CAT ctivity while enhncing SOD Fig. 1. Plque lipid extrct (LE) increses ROS level in monocytes. THP-1 monocytes were treted with LE mg/ml or DMSO 0.275%. After 4, 24, 48 nd 72 h of tretment, cells were hrvested nd counted by flow cytometry (solid line). ROS production ws determined ccording to the oxidtion of DCFH (brs). Results: men ± SE. p < 5, p < 1 significnt difference from the negtive controls (dotted line). n = 9, from three independent experiments. The Student s t-test ws employed when compring the mens of two groups. Anlysis of vrince (ANOVA) ws used when more thn two groups were compred. 3. Results 3.1. LE elevtes ROS production in monocytes The effect of LE on ROS production nd ntioxidnt enzyme expression nd ctivity ws ssessed in monocytes, which re the most prevlent leukocyte in the plque nd re lso key plyers in therogenesis [12,13]. THP-1 humn monocytes were treted with mg/ml LE or DMSO: EtOH (1:1) (96%, negtive control) for 4, 24, 48 nd 72 h. A significnt increse of 47% nd 70% (p < 05) in cellulr ROS levels ws detected t 48 nd 72 h fter LE tretment, respectively (Fig. 1). The subsequent count of vible cells reveled no significnt chnge in cell number up to 48 h fter tretment. Following 72 h LE tretment, slight decrese (by 16%, p < 1) in the cell number ws observed. The effect of LE on CAT nd SOD enzyme ctivities nd expression in the monocytes ws ssessed fter 4, 24, 48 nd 72 h of tretment with LE. CAT ctivity ws significntly reduced by 17% (±51, p < 1) fter 4 h, s ssyed by the rte of NADPH consumption (described in Mterils nd Methods), nd continued to remin t significntly low level, reltive to the control, during the 72 h LE tretment (Fig. 2A). This reduction ws ccompnied by significnt decrese in cellulr CAT expression, (by 12% ± 71) following 4 h of LE tretment, which returned to control levels over the course of incubtion. In contrst, cellulr SOD ctivity (quntified by the production of WST-1 formzn) nd expression incresed fter 24 h of LE tretment (by 1.25 ± 7 nd 1.45 ± 7, respectively), reltively to those of the control (Fig. 2B). The elevtion in diminished, while the ctivity continued to mount significntly, reching 1.77 ± 7 (p < 01) following 72 h of LE tretment LE ffects GPx nd TRxR enzyme ctivities nd expression The exposure of monocytes to LE (s bove) significntly reduced GPx enzyme ctivity fter 4 nd 24 h of LE tretment by 0.77 ± 2 nd 0.67 ± 6, respectively (Fig. 3A). A concomitnt, but not significnt, reduction in levels ws lso detected during this time period. Such reductions in GPx ctivity nd expression diminished following h of tretment. The ctivity of the TRxR enzyme, which cn potentilly reduce oxidized TRx bck to its monomer form, ws lso reduced by 7 ± 5 nd 7 ± 9, p < 5, respectively, 4 nd 24 h fter cells were incubted in the presence of LE (Fig. 3B). The TRxR expression, 4 h fter LE tretment, however, did not differ from tht of the control level, lthough it incresed significntly by 8 ± 17, p < 1, following 24 h of tretment LE increse glutthione oxidtion Intrcellulr glutthione levels of THP-1 cells were mesured to obtin n indiction of the cellulr response resulting from the oxidtive stte, which hd been induced by exposure to LE. Cell incubtion with LE brought bout significnt increse in GSH oxidtion levels (1.93 ± 7-fold tht of the control, s determined A CAT levels # ctivity B SOD levels ctivity ## # b Fig. 2. Plque lipid extrct (LE) ffects CAT nd SOD enzyme ctivities nd expression. THP-1 monocytes were treted with LE mg/ml or DMSO 0.275%. After 4, 24, 48 nd 72 h of tretment, trnscription ws determined. Ech gene ws normlized to the housekeeping gene, b-ctin. Antioxidnt enzyme ctivity ws mesured for ech enzyme (A- CAT, B- SOD) s described in the Mterils nd Methods section. Results: men ± SE. p < 5, p < 1 significnt difference of enzyme ctivity from the negtive controls (dotted line), # p < 5, ## p < 1 significnt difference of enzyme expression from the negtive controls (dotted line). n = 9 12 from three independent experiments.

4 A. Szuchmn-Spir et l. / Biochemicl nd Biophysicl Reserch Communictions 423 (2012) A GPx levels ctivity b b b B TRxR levels ## b ctivity # b Fig. 3. Plque lipid extrct (LE) ffects GPx nd TRxR enzyme ctivities nd expression. THP-1 monocytes were treted with LE mg/ml or DMSO 0.275%. After 4, 24, 48 nd 72 h of tretment, trnscription ws determined. Ech gene ws normlized to the housekeeping gene, b-ctin. Antioxidnt enzyme ctivity ws mesured for ech enzyme (A- GPx, B- TRxR), s described in the Mterils nd Methods section. Results: men ± SE. p < 5, p < 1 significnt difference of enzyme ctivity from the negtive controls (dotted line), # p < 5, ## p < 1 significnt difference of enzyme expression from the negtive controls (dotted line). n = 9 12 from three independent experiments. by the formtion of GSSG) 24 h fter LE tretment (Fig. 4). This elevtion in the cellulr GSSG/GSH oxidtion rtio becme enhnced, incresing by 2.37 ± nd 1.87 ± 0.11, respectively, during the h exposure to LE. However, no chnge in the GSH levels ws detected fter 72 h incubtion. 4. Discussion In the present study, the effect of the therosclerotic plque lipid moiety on the intrcellulr oxidtive stte nd on the expression nd ctivity of cellulr ntioxidnt enzymes ws investigted. The presence of plque nd its effect within the rtery on the djcent tissue nd cells is difficult to ssess, s these tissues re not ccessible for reserch. Therefore, the therogenic effect of plque on the ntioxidnt system ws studied in vitro using monocytes (THP-1). Exposure of these cells to the plque lipid moiety during n extended incubtion of 72 h reveled chnges in ntioxidnt enzyme expression nd ctivity nd chrcterized the oxidtive stte vrition. Our results demonstrted tht LE promotes cellulr oxidtive stress s exhibited by the production of ROS, which ply role in GSSG/GSH (Fold chnge reltive to control) 3.0 Fig. 4. Plque lipid extrct (LE) increses GSH oxidtion. THP-1 monocytes were treted with LE mg/ml or DMSO 0.275%. After 4, 24, 48 nd 72 h of tretment, cells were hrvested. Cellulr GSSG/GSH rtio ws quntified using LC/MS. Results: men ± SE. p < 5, p < 1 significnt difference from the negtive controls (dotted line). n = 8 from two independent experiments. reducing endogenous ntioxidnt properties, thereby excerbting oxidtive sttus. Mmmlin cells contin severl peroxide scvengers, including ctlse, glutthione peroxidses (GPxs) nd peroxiredoxins [reviewed in [14]]. In this study, incubtion of humn monocytes with LE resulted in significnt reduction in intrcellulr CAT, GPx nd TRxR ctivity during the first 24 h of incubtion. Although these reductions subsequently diminished during the 72 h LE tretment, returning to control levels, ROS levels did not decrese nd continued to increse up to 70% more thn tht of the controls. SOD enzymes nd ctlse ct in concert to detoxify O 2 nd H 2 O 2 (see Review of Yu BP. [15]); i.e., SOD enzymes convert O 2 to H 2 O 2, while ctlse destroys H 2 O 2 by converting it to wter. During the exposure of monocytes to LE, intrcellulr SOD ctivity rose significntly 24 h fter tretment nd remined high (up to 76% more thn tht of the control) t 72 h. These results re in greement with previous findings [6], which showed tht overexpression of ctlse lone, or of Cu/Zn-SOD nd ctlse in combintion, reduced the level of plsm nd ortic F2-isoprostne nd retrded the development of therosclerosis in ApoE / mice, in contrry to the effect obtined from the overexpression of Cu/Zn- SOD lone. This implies tht endogenously produced H 2 O 2, but not O 2, is fctor tht promotes the formtion of oxidtive stress in monocytes incubted in the presence of LE. Nevertheless, the rise in SOD ctivity lone did not combt cellulr ROS production. Glutthione peroxidse (GPx) is selenium-contining ntioxidnt enzyme tht effectively reduces hydrogen peroxide nd lipid peroxides to wter nd lipid lcohols, respectively, nd in turn, oxidizes glutthione (GSH) to glutthione disulfide (GSSG). The decrese in GPx ctivity, observed in our experiments, my inhibit the detoxifiction of hydrogen peroxide nd lipid peroxides. These peroxides cn be converted to hydroxyl rdicls nd lipid peroxyl rdicls, respectively, by trnsition metls (e.g. Fe 2 ), subsequently contributing to the elevtion in cellulr ROS levels, t lest during the first 24 h of LE tretment. The rise in ROS levels ws correlted with significnt increse in the GSSG/GSH levels. Thioredoxin reductse is nother ntioxidnt enzyme tht prticiptes in thiol-dependent cellulr reductive processes. The enzyme regenertes reduced thioredoxin, which serves s reducing equivlent, nd my lso directly reduce lipid hydroperoxides. In the presence of LE, the ctivity of the TRxR enzyme ws decresed. This my ffect the TRxR bility to ctlyze the glutthione-dependent disulfide reduction, contributing to the increse in the rtio of GSSG/GSH. The reduction in the enzyme ctivity

5 888 A. Szuchmn-Spir et l. / Biochemicl nd Biophysicl Reserch Communictions 423 (2012) my be explined by post-trnsltionl modifiction, which my occur during exposure to therosclerotic lipids. However, this remins to be investigted. Humn therosclerotic plque contins oxidized lipids, proteins, hydroperoxides [16], cholesterol, oxidized cholesterol products [3] nd oxidized nd ggregted LDL. Oxidized lipids induce vrious therogenic events, including the recruitment of inflmmtory cells to the intim nd induction of vsculr cell deth [5].In previous study in our lbortory [4], LE ws found to promote inflmmtion by elevting the expression of the pro-inflmmtory fctors, including interleukin (IL)-1b nd tumor necrosis fctor (TNF)-. Such results, concurrent with the present dt, support the ide tht the plque lipid content hs n therogenic effect on djcent cells nd tissues. Acknowledgments The uthors wnt to thnk Dr. Solimn Khtib for his ssistnce in the GSH/GSSG nlyses on the LCMS. References [1] K.K. Griendling, G.A. FitzGerld, Oxidtive stress nd crdiovsculr injury: Prt II: niml nd humn studies, Circultion 108 (2003) [2] N.R. Mdmnchi, A. Vendrov, M.S. Runge, Oxidtive stress nd vsculr disese, Arterioscler., Thromb., Vsc. Biol. 25 (2005) [3] A. Gmliel-Lzrovich, Z. Abssi, S. Khtib, H. Tvori, J. Vy, M. Avirm, S. Keidr, Proxonse1 deficiency in mice is ssocited with hypotension nd incresed levels of 5,6-epoxyeicostrienoic cid, Atherosclerosis 222 (2012) [4] H. Yehud, A.J. Szuchmn-Spir, S. Khtib, S. Tmir, Humn therosclerotic plque lipid extrct promotes expression of proinflmmtory fctors in humn monocytes nd mcrophge-like cells, Atherosclerosis 218 (2011) [5] Z. Guo, H. Vn Remmen, H. Yng, X. Chen, J. Mele, J. Vijg, C.J. Epstein, Y.S. Ho, A. Richrdson, Chnges in expression of ntioxidnt enzymes ffect cellmedited LDL oxidtion nd oxidized LDL-induced poptosis in mouse ortic cells, Arterioscler., Thromb., Vsc. Biol. 21 (2001) [6] H. Yng, L.J. Roberts, M.J. Shi, L.C. Zhou, B.R. Bllrd, A. Richrdson, Z.M. Guo, Retrdtion of therosclerosis by overexpression of ctlse or both Cu/Znsuperoxide dismutse nd ctlse in mice lcking polipoprotein E, Circ. Res. 95 (2004) [7] Z. Guo, Q. Rn, L.J. Roberts 2nd, L. Zhou, A. Richrdson, C. Shrn, D. Wu, H. Yng, Suppression of therogenesis by overexpression of glutthione peroxidse-4 in polipoprotein E-deficient mice, Free Rdicl Biol. Med. 44 (2008) [8] K. Nishihir, A. Ymshit, T. Immur, K. Htkeym, Y. Sto, H. Nkmur, J. Yodoi, H. Ogw, K. Kitmur, Y. Asd, Thioredoxin in coronry culprit lesions: possible reltionship to oxidtive stress nd intrplque hemorrhge, Atherosclerosis 201 (2008) [9] C.P. LeBel, H. Ischiropoulos, S.C. Bondy, Evlution of the probe 2,7 - dichlorofluorescin s n indictor of rective oxygen species formtion nd oxidtive stress, Chem. Res. Toxicol. 5 (1992) [10] C.J. Weydert, J.J. Cullen, Mesurement of superoxide dismutse, ctlse nd glutthione peroxidse in cultured cells nd tissue, Nt Protoc [11] M. Luthmn, A. Holmgren, Rt liver thioredoxin nd thioredoxin reductse: purifiction nd chrcteriztion, Biochemistry 21 (1982) [12] P. Sh, B. Modri, J. Humphries, K. Mttock, M. Wlthm, K.G. Burnnd, A. Smith, The monocyte/mcrophge s therpeutic trget in therosclerosis, Curr. Opin. Phrmcol. 9 (2009) [13] P. Libby, Y. Okmoto, V.Z. Roch, E. Folco, Inflmmtion in therosclerosis: trnsition from theory to prctice, Circ J 74 (2010) [14] S.G. Rhee, H.Z. Che, K. Kim, Peroxiredoxins: historicl overview nd specultive preview of novel mechnisms nd emerging concepts in cell signling, Free Rdicl Biol. Med. 38 (2005) [15] B.P. Yu, Cellulr defenses ginst dmge from rective oxygen species, Physiol. Rev. 74 (1994) [16] K. Kthir, J.M. Dennis, K.D. Croft, T.A. Mori, A.K. Lu, M.R. Adms, R. Stocker, Equivlent lipid oxidtion profiles in dvnced therosclerotic lesions of crotid endrterectomy plques obtined from symptomtic type 2 dibetic nd nondibetic subjects, Free Rdicl Biol. Med. 49 (2011)