Targeted Nano- Therapeutics for Drug Resistant Tumors

Size: px
Start display at page:

Download "Targeted Nano- Therapeutics for Drug Resistant Tumors"

Transcription

1 Invited Presentation at the 2016 American Association of Pharmaceutical Scientists National Biotechnology Conference. Boston, MA. Wednesday, May 18 th, 2016 Targeted Nano- Therapeutics for Drug Resistant Tumors Mansoor M. Amiji, PhD University Distinguished Professor and Director of the Laboratory of Biomaterials and Advanced Nano-Delivery Systems (BANDS) Department of Pharmaceutical Sciences Northeastern University 140 The Fenway Building Boston, MA Website:

2 The Tumor Microenvironment The Hallmarks of Cancer Cells of the TME Ref: D. Hanahan and R.A. Weinberg. Cell; 144: (2011). Ref. D. Leyva-Illades, et al., Transl Gastrointest Cancer; 1: (2012). Tumors are composite of many different cellular and non-cellular constituents that surround the malignant cancer cells harboring activating mutations in oncogenes or loss of tumor suppressors that drive tumor growth. A variety of infiltrating immune cells, cancerassociated fibroblasts, and angiogenic endothelial cells play expanding and critical functions in sustaining cell proliferation, evading growth suppressors, promoting survival, activating invasion and metastasis, and reprogramming energy metabolism.

3 Hypoxia, Glycolysis and Drug Resistance Ref. O. Trendan, et. al., J. Nat. Cancer. Inst. 99(19): (2007) Ref. M.G. Vander-Heiden, et al. Science 324 (5930): (2009)

4 Overcoming MDR by RNAi/Drug Therapy Circumventing antiapoptotic mechanisms (e.g., survivin and Bcl- 2 expression) Inhibiting ATPdependent drug efflux transporters (e.g., mdr-1 and mrp-1 genes) Inhibition of aerobic glycolysis (e.g., PKM-2, HK, and LDH-A genes) Affecting genes that regulate cell-cycle checkpoints (e.g., mad-2) Ref. M. Susa, et al., Pharm. Res., 28(2): (2011). Funded by NCI Alliance in Nanotechnology, Platform Partnership Grants

5 Targeting Module Combinatorial-Designed Nano-Assemblies Module Payloads Imaging Module Payload Encapsulation Pol-Lipid C 2-4 Pol-Lipid C 6-10 Pol-Lipid C Pol-Thiol Pol-PEG Peptide Fluorescence Radioactive Shanthi Ganesh Arun Iyer Amit Singh

6 Hyaluronic Acid Derivatives Hyaluronic acid (HA) is a natural, biocompatible, and biodegradable polymer 5 1 Long history of safe use in clinical applications (e.g., for viscosupplementation therapy in arthritis) 2 Intrinsic targeting to CD44 receptors over-expressed on tumor cells (e.g., cancer stem cells) and macrophages 4 Modular HA nanoparticle platform synthesized using different functional substitutions (EDC coupling or click chemical cojugation) Combinatorial library of formed nanoparticles by self-assembly of the constituents at specific weight ratios of each (i.e., LEGO blocks) sirna/mirna Duplexes OR Small Molecule Drug OR Targeted Self-Assembling Nano-system HA-PEG HA-Thiol HA-PEG-Peptide 3 EGFR Peptide

7 SKOV3 CD44 Expression Evaluation of Combination mdr-1 Silencing and Paclitaxel Co-Therapy in Resistant Ovarian Cancer CD44 expression in human ovarian tumor samples Platinum Refractory Tumor Sensitive Tumor 40X E Zhenfeng Duan, MGH HA shell for tumor targeting PEI for condensing mdr1 sirna PEG corona for prolonging circulation mdr-1 sirna payload CD44 Pgp CD44 Pgp β-actin SKOV-3 TR SKOV-3 Relative Expression CD44 Pgp SKOV-3TR SKOV-3 SKOV3 TR Encapsulation of mdr-1 sirna in HA-PEI/HA-PEG nanoparticles for CD44 targeted delivery in resistant SKOV3 TR human ovarian adenocarcioma model Ref. X. Yang, et al., Scientific Reports, 5(8509): 1-9 (2015).

8 R e l a t i v e M D R 1 E x p r e s s i o n Down-regulation of mdr-1 in SKOV3 TR Cells using sirna- Encapsulation in HA-PEI/HA-PEG Nanoparticles Relative mdr-1 gene silencing after 24 h by qpcr 1. 2 S K O V - 3 T R c e l l o n l y H A - P E I / H A - P E G / n o n - s p e c i f i c s i R N A % L i p o f e c t a m i n e / M D R 1 s i R N A 9 0 n M H A - P E I / H A - P E G / M D R 1 s i R N A 4 5 n M H A - P E I / H A - P E G / M D R 1 s i R N A 9 0 n M H A - P E I / H A - P E G / M D R 1 s i R N A n M 0. 0 Pgp β-actin Relative Pgp Expression Relative P-gp expression after 24 h 1: SKOV-3TR cell only 2: HA-PEI/HA-PEG/non-specific sirna 45nM 3: HA-PEI/HA-PEG/non-specific sirna 90nM 4: HA-PEI/HA-PEG/non-specific sirna 180nM 5: MDR1 sirna alone 45nM 6: MDR1 sirna alone 90nM 7: MDR1 sirna alone 180nM 8: Lipofectamine /MDR1 90nM 9: HA-PEI/HA-PEG/MDR1 sirna 45nM 10: HA-PEI/HA-PEG/MDR1 sirna 90nM 11: HA-PEI/HA-PEG/MDR1 sirna 180nM Ref. X. Yang, et al., Scientific Reports, 5(8509): 1-9 (2015).

9 Evaluation of P-gp and CD44 Expression in Tumor Tissues upon Administration of mdr-1 sirna in HA Nanoparticles CD44 Pgp CD44 Pgp 1 β-actin Relative Expression CD Pgp : saline + paclitaxel 2: MDR1 sirna + paclitaxel 3: HA-PEI/HA-PEG/none specific sirna + paclitaxel 4: HA-PEI/HA-PEG/MDR1 sirna + paclitaxel Ref. X. Yang, et al., Scientific Reports, 5(8509): 1-9 (2015).

10 R e l a t i v e T u m o r V o l u m e Ref. X. Yang, et al., Scientific Reports, 5(8509): 1-9 (2015). In Vivo Anti-tumor Efficacy of Combination mdr-1 sirna/paclitaxel Therapy in SKOV3 TR Xenograft Model Group 4: HA-PEI/HA-PEG/mdr1 sirna Group 3: HA-PEI/HA-PEG/non-specific sirna Group 2: MDR1 sirna alone Group 1: saline Group 1-4: paclitaxel (20mg/kg) Tumors collection s a l i n e + p a c l i t a x e l M D R 1 s i R N A + p a c l i t a x e l H A - P E I / H A - P E G / n o n - s p e c i f i c s i R N A + p a c l i t a x e l H A - P E I / H A - P E G / M D R 1 s i R N A + p a c l i t a x e l Saline + paclitaxel mdr-1 sirna alone + paclitaxel HA-PEI/HA-PEG/ Non-pecific sirna + paclitaxel T i m e a f t e r i n j e c t i o n ( d a y s ) HA-PEI/HA-PEG/ mdr-1 sirna + paclitaxel

11 PKM-2/β-actin MDR-1/β-actin Combination mdr-1/pkm-2 Gene Silencing in SKOV3 Model with HA-PEI/HA-PEG Nanoparticles h 96 h mdr-1 Gene Silencing sirna Dose: 100 nm Time: 72 and 96 hours Michael Goldberg, DFCI h 96 h PKM-2 Gene Silencing Ref. R.A. Cairns, I.S. Harris, & TW. Mak. Nat Revs Cancer, 11: (2011) Partially Funded by DFCI/NU Grant Ref. M. Talekar, et al., Mol. Cancer Therap., 14(7): (2015). Meghna Talekar

12 Ref. M. Talekar, et al., Mol. Cancer Therap., 14(7): (2015). Biodistribution and Tumor-Specific Localization of sirna Upon Administration in HA-PEI/HA-PEG Nanoparticles Non-Targeted EGFR Targeted Whole body near-ir imaging of tumor targeted delivery with ICG-encapsulated control and EGFR targeted HA-PEI/HA-PEG nanoparticles and quantitative assessment of mdr-1 sirna accumulation as a function of time in plasma and various tissues.

13 Ref. M. Talekar, et al., Mol. Cancer Therap., 14(7): (2015). Establishment of Resistant SKOV3 Model by Intravenous Paclitaxel Administration in Athymic Mice In vivo PTX resistance model development. SKOV-3 wild-type tumor bearing mice were injected with 20 mg/kg PTX every alternate day for 10 days. MDR-1 and PKM-2 expression levels were assessed using PCR (A) and immunohistofluorescence (B & C) and an increase in mdr- 1/P-gp expression was observed in animals treated with PTX. However no significant difference was observed following week 1 and week 3 post last dose of PTX. We are currently investigating the efficacy of combination therapy with sirna and PTX in this model. B A C

14 Gene of interest/β-actin Ref. M. Talekar, et al., Mol. Cancer Therap., 14(7): (2015). Tumor volume (mm 3 ) In Vivo mdr-1 and PKM-2 Gene Silencing and Anti-Tumor Efficacy with Combination Therapy in SKOV3 Model In Vivo Silencing Efficiency simdr-1 sipkm In Vivo Anti-Tumor Response PBS PTX solution simdr-1 sipkm-2 HA-PEI (NT) HA-PEI (T) HA-PEI-MDR-1+PTX(NT) HA-PEI-MDR-1+PTX(T) HA-PEI-MDR-1/PKM-2+PTX(NT) HA-PEI-MDR-1/PKM-2+PTX(T) PBS Scrambled sirna NP sirna (NT) NP sirna (T) Time (days) qpcr analysis of in vivo gene silencing efficacy in SKOV3 tumor xenograft model in female nu/nu (athymic) mice upon intravenous administration of mdr-1 and PKM2 silencing sirna (0.5 mg/kg) and the anti-tumor therapeutic response from single and combination sirna/paclitaxel (20 mg/kg) administration

15 Tumor-Associated Macrophages Ref. J.W. Pollard. Nat Revs Cancer, 4, (2004) Ref. T.L. Rogers and I. Holen. J Translational Med, 9:177 (2011) Tumor-associated macrophages (TAMs), which are predominantly M2 polarized, affect virtually all aspects of tumor growth and progression, including stem cells, metabolism, angiogenesis, invasion, metastasis, and therapeutic resistance. Communication between tumor cells and macrophages is critical for tumor malignancy.

16 TAM Repolarization from M2 to M1 Ref. S.K. Biswas & A. Montovani, Nat Immunol., 11: (2010). Ref. R.C. Chang, et al., Cells, 3(3): (2014). Reprogramming TAMs from a predominant M2 to M1 phenotype would provide an opportunity for anti-tumor response and potentially improve cancer immunotherapy. Several microrna s (e.g., mir-155 and mir-125b) have shown to change macrophage polarity from M2 to M1.

17 Exosome Transfer from Human Pancreatic Tumor Cells to Macrophages using a Co-Culture System Transwell Co-Culture System Tumor Cells Macrophages 6 h After treating LPS/IFN-γ Tumor Cells Macrophages Luciferase Expressing Panc-1 Cells 48h & 72h Mei-Ju Su Microscopy and RT-PCR Analysis of Exosome-Mediated Macrophage Polarization RT-PCR Analysis of M1/M2 Macrophage Polarization Markers TEM image of Panc-1 Exosomes Ref. M.J. Su, et al., Nature - Scientific Reports, (Submitted)

18 MicroRNAs 155 and 125b Transfection in Panc-1 Cells with HA-PEI/HA-PEG Nanoparticles Human pancreatic cancer cells (Panc-1) transfected with plasmid DNA expressing mir-155 and mir-125b and the levels of expression in cells relative to control were measured using PCR. The plasmid dose was 20 mg per 200,000 cells. Ref. M.J. Su, et al., Nature - Scientific Reports, (Submitted)

19 Change in Macrophage Polarization from M2 to M1 with Exosome-Mediated Transfer of MicroRNAs 155 and 125b Ref. M.J. Su, et al., Nature - Scientific Reports, (Submitted)

20 MicroRNA Profiling in Cytosol and Exosomes in SK-LU1 Non-Small Cell Lung Cancer Cells Malav Trivedi TEM image of SK-LU1 exosomes Ref. M. Trivedi, et al., Oncogenesis, (Submitted) Meghna Talekar

21 Changes in wt-p53 and mir-125b Levels in Cytosol and Exosomes upon Transfection with HA-Based Nanoparticles A Flag p53 Transcript Levels B mir-125b Transcript Levels (A) Quantitative qrt-pcr analysis of expression of wt-p53 in cells (p53/cells) and in exosomes (p53/exo) when transfected with wt-p53 expressing plasmid DNA alone or in combination with mirna-125b expressing plasmid DNA in cells (combi/cells) and in exosomes (combi/exo) after 18 hours of incubation. (B) Quantitative qrt-pcr analysis of expression of mir-125b expression in cells (mir-125b/cells) and in exosomes (mir-125b /exo) when transfected with mirna-125b expressing plasmid DNA alone or in combination with wt-p53 expressing plasmid DNA in cells (combi/cells) and in exosomes (combi/exo) after 18 hours of incubation. Ref. M. Trivedi, et al., Oncogenesis, (Submitted)

22 Establishment of KRAS/p53 Mutant Genetically-Engineered Mouse Model of Non-Small Cell Lung Cancer Wild type lungs Mutant 4 wks Mutant 10 wks* 6 weeks post AdeCre dosing variable viral dose Time course analysis of stages of tumor progression in Lox-K-ras-G12D mice Papillary adenoma 6 weeks Large adenoma 12 weeks Adenocarcinoma 16 weeks Atypical adenomatous hyperplasia 2 weeks Ref. M. Talekar, et al., Molecular Therapy, 24(4): (2016).

23 R a tio F la g -p 5 3 / -a c tin In Vivo wt-p53 and mir-125b Transfection in Lung Tumor Tissues in the KRAS/p53 GEM Models Relative p53 expression wt-p53 Transcript * AdCre Kras LSL-G12D /p53 fl/fl * * * Day 1 pdna- HA NP s Day 3 pdna- HA NP s Flag p53 β-actin 2.0 Day 5 pdna- HA NP s Day 7 Cisplatin solution Therapy on week 2, 4 and 6 0 PBS CD44 T p53 NP Dual T p53 NP CD44 T combo NP Dual T combo NP 1.5 Relative mir-125b expression mir-125b Transcript * * * PBS CD44 T 125b NP Dual T 125b NP CD44 T combo NP Dual T combo NP * P B S C D 4 4 T p 5 3 N P D u a l T p 5 3 N P C D 4 4 T c o m b o N P D u a l T c o m b o N P Ref. M. Talekar, et al., Molecular Therapy, 24(4): (2016).

24 Changes in the M1/M2 Macrophage Markers and Inflammatory Cytokine Levels in Tumor Tissues Ref. M. Talekar, et al., Molecular Therapy, 24(4): (2016).

25 Changes in the Ki-67 Expression Profile in Tumor Tissues upon Transfection with wt-p53 and mir-125b Ref. M. Talekar, et al., Molecular Therapy, 24(4): (2016).

26 Summary Poor drug delivery efficiency and the various soluble and insoluble tumor microenvironmental factors are critical in the development of drug resistance. Combinatorial-designed multifunctional polymeric nano-systems offer a versatile platform for tumor-targeted delivery of RNAi and small molecule therapeutics for modulation of drug resistance. Our RNAi approaches have relies on the hallmarks of cancer focusing on down-regulation of anti-apoptotic genes (e.g., bcl-2 and survivin), ATPdependant efflux transporters (e.g., mdr-1), glycolytic enzymes (e.g., PKM-2), and cell cycle checkpoint genes (e.g., mad-2). Further evaluation of the role of tumor microenvironment, especially through regulation of tumor cell communication, epigenetics, macrophage polarity, and inflammatory pathways, will be critical to overcome resistance. In all of the above nano-therapeutic strategies, our focus continues to be on the use of safe materials and scalable manufacturing processes that allow for rapid translation of these experimental approaches in clinically-viable therapeutic options for cancer patients.

Nanotechnology applications in medical diagnosis, imaging, and therapy

Nanotechnology applications in medical diagnosis, imaging, and therapy Engineering Conferences International ECI Digital Archives Nanotechnology in Medicine: From Molecules to Humans Proceedings 7-4-2016 Nanotechnology applications in medical diagnosis, imaging, and therapy

More information

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2 Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji

More information

Master's Thesis Research. By, Megha Suresh. Advisor: Mansoor M. Amiji, PhD

Master's Thesis Research. By, Megha Suresh. Advisor: Mansoor M. Amiji, PhD In Vitro Model of Inflammatory Signaling and Cancer Stem Cell Signaling in Pancreatic Cancer using 3D Hetero-Cellular Spheroids and MicroRNA Delivery using Hyaluronic Acid-Based Nanoparticles Master's

More information

Cancer Problems in Indonesia

Cancer Problems in Indonesia mirna and Cancer : mirna as a Key Regulator in Cancer Sofia Mubarika 2 nd Symposium Biomolecular Update in Cancer PERABOI Padang 18 Mei 2013 Cancer Problems in Indonesia 1. Chemoresistency / recurrency

More information

Novel Approaches to CAR-T Cell Platform

Novel Approaches to CAR-T Cell Platform Novel Approaches to CAR-T Cell Platform Vita Golubovskaya, Ph.D. Director, R&D Promab Biotechnologies 3 rd CAR-TCR Summit 2017 S E P T E M B E R 5-7 B O S T O N Novel Approaches To CAR-T Cell Platform

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

Joint Department of Biomedical Engineering

Joint Department of Biomedical Engineering Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2018 Supplementary Data Systemic Delivery of CRISPR/Cas9 with PEG-PLGA Nanoparticles for

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Engineered Immune Cells for Cancer Therapy : Current Status and Prospects

Engineered Immune Cells for Cancer Therapy : Current Status and Prospects When Engineering Meets Immunology Engineered Immune Cells for Cancer Therapy : Current Status and Prospects Yong Taik Lim, Ph.D. Nanomedical Systems Laboratory (http://www.nanomedicalsystems.org) SKKU

More information

Development of Multifunctional Nanoparticles for Brain Tumor Imaging and Therapy

Development of Multifunctional Nanoparticles for Brain Tumor Imaging and Therapy Development of Multifunctional Nanoparticles for Brain Tumor Imaging and Therapy Omid Veiseh, Ph.D. Professor Miqin Zhang s Nanomedicine and Biomaterials Lab Departments of Materials Science & Engineering

More information

Hyaluronic Acid Based Self-Assembled Multifunctional Nanosystems to Overcome Drug Resistance in Lung Cancer

Hyaluronic Acid Based Self-Assembled Multifunctional Nanosystems to Overcome Drug Resistance in Lung Cancer Hyaluronic Acid Based Self-Assembled Multifunctional Nanosystems to Overcome Drug Resistance in Lung Cancer Thesis Presented by Shanthi Ganesh to The Bouvé Graduate School of Health Sciences in Partial

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;

SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas; SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Cancer Biology Dynamical Cell Systems

Cancer Biology Dynamical Cell Systems The Institute of Cancer Research PHD STUDENTSHIP PROJECT PROPOSAL PROJECT DETAILS Project Title: SUPERVISORY TEAM Primary Supervisor: The forces behind pancreatic cancer; and changing them as a therapeutic

More information

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes

More information

Experimental Therapeutics I

Experimental Therapeutics I Experimental Therapeutics I Mary Hitt 5142 Katz Group Centre mhitt@ualberta.ca; or Mary.Hitt@albertahealthservices.ca 1 Specific Topics for Today Preclinical and clinical testing Gene therapy Nonviral

More information

The nab Platform : From Bench to the Clinic and Beyond. Neil P. Desai, PhD Abraxis BioScience LLC

The nab Platform : From Bench to the Clinic and Beyond. Neil P. Desai, PhD Abraxis BioScience LLC The nab Platform : From Bench to the Clinic and Beyond Neil P. Desai, PhD Abraxis BioScience LLC Policy Issues in Nanotechnology and Oncology, National Cancer Policy Forum Workshop, Institute of Medicine,

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

John Bell Centre for Innovative Cancer Therapeutics

John Bell Centre for Innovative Cancer Therapeutics Enhancing Oncolytic Virus Activity by Engineering of Artificial micrornas John Bell Centre for Innovative Cancer Therapeutics Affiliated with Affilié à 1 Oncolytic Viruses: A Therapy for Metastatic Cancers?

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Supplementary information

Supplementary information Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun

More information

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz December 1, 2010 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 25 More mutations as 20 you get older

More information

CELL BIOLOGY - CLUTCH CH CANCER.

CELL BIOLOGY - CLUTCH CH CANCER. !! www.clutchprep.com CONCEPT: OVERVIEW OF CANCER Cancer is a disease which is primarily caused from misregulated cell division, which form There are two types of tumors - Benign tumors remain confined

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

Inflammatory Cells and Metastasis

Inflammatory Cells and Metastasis Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University

More information

Supporting Information

Supporting Information Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis

Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis Myron R. Szewczuk Dept. Biomedical and Molecular Sciences, Queen's University, Kingston, K7L 3N6 Ontario, Canada HIGHLIGHTS. An innovative

More information

Pancreatic Adenocarcinoma: What`s hot

Pancreatic Adenocarcinoma: What`s hot Pancreatic Adenocarcinoma: What`s hot Eva Karamitopoulou-Diamantis Institute of Pathology University of Bern 11.09.2018, 30th ECP, Bilbao Pancreatic Cancer and the Microbiome The Pancreatic Cancer Microbiome

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

Human Lung Cancer Pathology and Cellular Biology Mouse Lung Tumor Workshop

Human Lung Cancer Pathology and Cellular Biology Mouse Lung Tumor Workshop Human Lung Cancer Pathology and Cellular Biology Mouse Lung Tumor Workshop Jan 7 th and 8 th, 2014 Brigitte Gomperts, MD University of California, Los Angeles Lung Structure and Function Airway Epithelial

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Development of Degradable Stealth Nanospheres for Controlled Delivery of Anticancer Drugs

Development of Degradable Stealth Nanospheres for Controlled Delivery of Anticancer Drugs Development of Degradable Stealth Nanospheres for Controlled Delivery of Anticancer Drugs Emmanuel. Akala, R.Ph., Ph.D. Department of Pharmaceutical Sciences School of Pharmacy First Generation Polymeric

More information

Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin

Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin Departments of Chemistry, Infectious Disease, Materials Science & Engineering, Chemical & Biological Engineering, and Biomedical

More information

Final published version:

Final published version: Tumor Penetrating Theranostic Nanoparticles for Enhancement of Targeted and Image-guided Drug Delivery into Peritoneal Tumors following Intraperitoneal Delivery Ning Gao, Emory University Erica N. Bozeman,

More information

Transformation of Normal HMECs (Human Mammary Epithelial Cells) into Metastatic Breast Cancer Cells: Introduction - The Broad Picture:

Transformation of Normal HMECs (Human Mammary Epithelial Cells) into Metastatic Breast Cancer Cells: Introduction - The Broad Picture: Transformation of Normal HMECs (Human Mammary Epithelial Cells) into Metastatic Breast Cancer Cells: Introduction - The Broad Picture: Spandana Baruah December, 2016 Cancer is defined as: «A disease caused

More information

OMICS Journals are welcoming Submissions

OMICS Journals are welcoming Submissions OMICS Journals are welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

New therapies for pancreatic cancer treatment:

New therapies for pancreatic cancer treatment: New therapies for pancreatic cancer treatment:! Targeting of surface proteins! Development of nanoparticles CRRET laboratory Growth factors and angiogenesis School of Sciences and Technologies University

More information

Macrophages and Exosomes Employ Brain Inflammation for CNS Delivery of Therapeutics A. Kabanov

Macrophages and Exosomes Employ Brain Inflammation for CNS Delivery of Therapeutics A. Kabanov Macrophages and Exosomes Employ Brain Inflammation for CNS Delivery of Therapeutics A. Kabanov Targeting Brain Inflammation in Disease Biochemical studies of brains from individuals with many neurologic

More information

Genetics and Cancer Ch 20

Genetics and Cancer Ch 20 Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)

More information

Chapter 1: Curcumin is excellent compound for various medicinal usages

Chapter 1: Curcumin is excellent compound for various medicinal usages Super-Curcumin Story Chapter 1: Curcumin is excellent compound for various medicinal usages Chapter 2: Discovery of Super-Curcumin analog Chapter 3: Anti-tumor activities of Super-Curcumin analog Chapter

More information

Smith Family Awards Program for Excellence in Biomedical Research 2017 Award Recipients

Smith Family Awards Program for Excellence in Biomedical Research 2017 Award Recipients Smith Family Awards Program for Excellence in Biomedical Research 2017 Award Recipients Aaron Hata, M.D., Ph.D. Assistant Professor of Medicine at Harvard Medical School MGH Cancer Center Determining the

More information

Mesenchymal stem cells release exosomes that transfer mirnas to endothelial cells and promote angiogenesis

Mesenchymal stem cells release exosomes that transfer mirnas to endothelial cells and promote angiogenesis Mesenchymal stem cells release exosomes that transfer mirnas to endothelial cells and promote angiogenesis Tanja Wagner 1 Introduction 2 Mesenchymal stem cells (MSCs) non-haematopoietic, multipotent stem

More information

Supplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer.

Supplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer. Supplemental Materials Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in Pancreatic Cancer Jun Zhao 1, Zhilan Xiao 2, 3, Tingting Li 1, 4, Huiqin Chen 5, Ying Yuan 5, Alan

More information

stability and tumor suppression

stability and tumor suppression Supplementary information The stress kinase MKK7 couples oncogenic stress to p53 stability and tumor suppression Daniel Schramek 1, Athanassios Kotsinas 2, Arabella Meixner 1, Teiji Wada 1, Ulrich Elling

More information

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Expanding its HDL strategy into Immuno-oncology and Chemotherapeutic drug delivery. Acquisition of LYPRO Biosciences

Expanding its HDL strategy into Immuno-oncology and Chemotherapeutic drug delivery. Acquisition of LYPRO Biosciences Expanding its HDL strategy into Immuno-oncology and Chemotherapeutic drug delivery Acquisition of LYPRO Biosciences CERENIS is well positioned to change the drug delivery paradigm Over a decade of experience

More information

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time

More information

IMMUNOTOOLS: EFFECT OF NOTCH-DEFICIENT MACROPHAGES TO AUTOIMMUNE DISEASE WIPAWEE WONGCHANA

IMMUNOTOOLS: EFFECT OF NOTCH-DEFICIENT MACROPHAGES TO AUTOIMMUNE DISEASE WIPAWEE WONGCHANA IMMUNOTOOLS: EFFECT OF NOTCH-DEFICIENT MACROPHAGES TO AUTOIMMUNE DISEASE 22-02-2017 WIPAWEE WONGCHANA WHAT DO YOU SEE? Allergy Ref: http://carrington.edu/blog/medical/vaccines/smallpox-andsmallpox-vaccine/

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-10-1-1029 TITLE: PRINCIPAL INVESTIGATOR: Mu-Shui Dai, M.D., Ph.D. CONTRACTING ORGANIZATION: Oregon Health Science niversity, Portland, Oregon 97239 REPORT DATE: October 2013 TYPE

More information

Oncology for Scientists RPN 530 Fall 2017 Cancer Cell Metabolism

Oncology for Scientists RPN 530 Fall 2017 Cancer Cell Metabolism Oncology for Scientists RPN 530 Fall 2017 Cancer Cell Metabolism Gokul Das, Ph.D. Department of Pharmacology & Therapeutics Center for Genetics & Pharmacology (CGP) Room 4-304 Tel: 845-8542 Email: gokul.das@roswellpark.org

More information

Cancer therapeutics in the clinical setting. Need for alternate therapeutics. Target multiple cancer pathways. Circumvent the genetic mutations

Cancer therapeutics in the clinical setting. Need for alternate therapeutics. Target multiple cancer pathways. Circumvent the genetic mutations Transcriptional factor Snail and MMP-9 signaling axis controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma Samar Abdulkhalek 1, Olivia Geen 1, Lacey Brodhagen

More information

Pancreatic intraepithelial

Pancreatic intraepithelial Pancreatic intraepithelial neoplasia (PanIN) Markéta Hermanová St. Anne s University Hospital Brno Faculty of Medicine, Masaryk University Precursor lesions of invasive pancreatic cancer Pancreatic intraepithelial

More information

BIO360 Fall 2013 Quiz 1

BIO360 Fall 2013 Quiz 1 BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.

More information

Development of Carcinoma Pathways

Development of Carcinoma Pathways The Construction of Genetic Pathway to Colorectal Cancer Moriah Wright, MD Clinical Fellow in Colorectal Surgery Creighton University School of Medicine Management of Colon and Diseases February 23, 2019

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta

More information

Virchow s Hypothesis lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation

Virchow s Hypothesis lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation Virchow s Hypothesis 1863 lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation Barrett s esophagus/ Esophageal adenocarcinoma PSC / Cholangiocarcinoma Viral hepatitis

More information

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Development of a Novel IL-12 DNA-based Immunotherapy in Combination with Chemotherapy for Treatment of Advanced Ovarian Cancer

Development of a Novel IL-12 DNA-based Immunotherapy in Combination with Chemotherapy for Treatment of Advanced Ovarian Cancer Development of a Novel IL-12 DNA-based Immunotherapy in Combination with Chemotherapy for Treatment of Advanced Ovarian Cancer Khursheed Anwer, Ph.D. Executive Vice President and CSO Molecular Medicine

More information

Early cell death (FGF) B No RunX transcription factor produced Yes No differentiation

Early cell death (FGF) B No RunX transcription factor produced Yes No differentiation Solution Key - Practice Questions Question 1 a) A recent publication has shown that the fat stem cells (FSC) can act as bone stem cells to repair cavities in the skull, when transplanted into immuno-compromised

More information

UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL. PhD THESIS

UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL. PhD THESIS UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL PhD THESIS THE IMPORTANCE OF TUMOR ANGIOGENESIS IN CEREBRAL TUMOR DIAGNOSIS AND THERAPY ABSTRACT PhD COORDINATOR: Prof. univ. dr. DRICU Anica PhD

More information

Immunologic Effects of Clinical Stage FAK & PI3K-Delta/Gamma Inhibitors

Immunologic Effects of Clinical Stage FAK & PI3K-Delta/Gamma Inhibitors 1 Immunologic Effects of Clinical Stage FAK & PI3K-Delta/Gamma Inhibitors Jonathan Pachter, Ph.D - Chief Scientific Officer 3rd Annual Immuno-Oncology Congress, May 24, 2018 Disclosures 2 I am an employee

More information

Molecular Biology of Cancer. Code: ECTS Credits: 6. Degree Type Year Semester

Molecular Biology of Cancer. Code: ECTS Credits: 6. Degree Type Year Semester 2018/2019 Molecular Biology of Cancer Code: 100863 ECTS Credits: 6 Degree Type Year Semester 2500252 Biochemistry OT 4 0 Contact Name: Carles Arús Caralto Email: Carles.Arus@uab.cat Other comments on languages

More information

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine 1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP

More information

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized

More information

MicroRNA-31 initiates lung tumorigenesis and promotes mutant KRAS-driven lung cancer

MicroRNA-31 initiates lung tumorigenesis and promotes mutant KRAS-driven lung cancer The Journal of Clinical Investigation Research article MicroRNA-31 initiates lung tumorigenesis and promotes mutant KRAS-driven lung cancer Mick D. Edmonds, 1 Kelli L. Boyd, 1 Tamara Moyo, 2 Ramkrishna

More information

Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit

Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit 15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional

More information

Molecular mechanisms of the T cellinflamed tumor microenvironment: Implications for cancer immunotherapy

Molecular mechanisms of the T cellinflamed tumor microenvironment: Implications for cancer immunotherapy Molecular mechanisms of the T cellinflamed tumor microenvironment: Implications for cancer immunotherapy Thomas F. Gajewski, M.D., Ph.D. Professor, Departments of Pathology and Medicine Program Leader,

More information

Supplementary Figure 1: Experimental design. DISCOVERY PHASE VALIDATION PHASE (N = 88) (N = 20) Healthy = 20. Healthy = 6. Endometriosis = 33

Supplementary Figure 1: Experimental design. DISCOVERY PHASE VALIDATION PHASE (N = 88) (N = 20) Healthy = 20. Healthy = 6. Endometriosis = 33 DISCOVERY PHASE (N = 20) Healthy = 6 Endometriosis = 7 EAOC = 7 Quantitative PCR (mirnas = 1113) a Quantitative PCR Verification of Candidate mirnas (N = 24) VALIDATION PHASE (N = 88) Healthy = 20 Endometriosis

More information

CANCER IMMUNOPATHOLOGY. Eryati Darwin Faculty of Medicine Andalas University

CANCER IMMUNOPATHOLOGY. Eryati Darwin Faculty of Medicine Andalas University CANCER IMMUNOPATHOLOGY Eryati Darwin Faculty of Medicine Andalas University Padang 18 Mei 2013 INTRODUCTION Tumor: cells that continue to replicate, fail to differentiate into specialized cells, and become

More information

Systemic RNAi Therapuetics for the Treatment of HIV-1 Prof. John J. Rossi

Systemic RNAi Therapuetics for the Treatment of HIV-1 Prof. John J. Rossi Systemic RNA Interference (RNAi) Therapeutics for the of HIV-1 John J. Rossi, Professor and chairman Department of Molecular and Cellular Biology, Beckman Research Institute of the City of Hope Duarte

More information

HDAC Inhibitors and PARP inhibitors. Suresh Ramalingam, MD Associate Professor Chief of Thoracic Oncology Emory University School of Medicine

HDAC Inhibitors and PARP inhibitors. Suresh Ramalingam, MD Associate Professor Chief of Thoracic Oncology Emory University School of Medicine HDAC Inhibitors and PARP inhibitors Suresh Ramalingam, MD Associate Professor Chief of Thoracic Oncology Emory University School of Medicine Histone Acetylation HAT Ac Ac Ac Ac HDAC Ac Ac Ac Ac mrna DACs

More information

Nano Immuno Chemotherapy to treat cancers

Nano Immuno Chemotherapy to treat cancers Nano Immuno Chemotherapy to treat cancers Dr. Giovanna Lollo, MiNT, France Dr. Ilaria Marigo, IOV, Italy University of Angers MiNt: Micro et Nanomedicines Biomimetiques France Instituto Oncologico Veneto

More information

Chapter 7 Conclusions

Chapter 7 Conclusions VII-1 Chapter 7 Conclusions VII-2 The development of cell-based therapies ranging from well-established practices such as bone marrow transplant to next-generation strategies such as adoptive T-cell therapy

More information

Specific Targeting and Delivery of Therapeutics to Cancer Cells Based on the Tumor Microenvironment

Specific Targeting and Delivery of Therapeutics to Cancer Cells Based on the Tumor Microenvironment Specific Targeting and Delivery of Therapeutics to Cancer Cells Based on the Tumor Microenvironment Damien Thévenin Department of Chemistry Bioscience in the 21st century (Sep. 14, 218) Anticancer Drugs

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors

The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors Department of Tumor Biology The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors cfdna Copenhagen April 6-7, 2017 Heidi Schwarzenbach, PhD Tumor

More information

Myelodysplastic Syndromes: Hematopathology. Analysis of SHIP1 as a potential biomarker of Disease Progression

Myelodysplastic Syndromes: Hematopathology. Analysis of SHIP1 as a potential biomarker of Disease Progression Myelodysplastic Syndromes: Hematopathology. Analysis of SHIP1 as a potential biomarker of Disease Progression Carlos E. Bueso-Ramos, M.D., Ph.D Department of Hematopathology The University of Texas M.

More information

Circular RNAs (circrnas) act a stable mirna sponges

Circular RNAs (circrnas) act a stable mirna sponges Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding

More information

PRESAGE CIVO: A NOVEL PLATFORM FOR PRECISION ONCOLOGY & DRUG DEVELOPMENT

PRESAGE CIVO: A NOVEL PLATFORM FOR PRECISION ONCOLOGY & DRUG DEVELOPMENT PRESAGE : A NOVEL PLATFORM FOR PRECISION ONCOLOGY & DRUG DEVELOPMENT DECEMBER 2017 Presage Biosciences, Inc. 2017. All rights reserved. Presage Proprietary Biosciences, information. Inc. 2017. All rights

More information

Molecular Biology of Cancer. Code: ECTS Credits: 6. Degree Type Year Semester

Molecular Biology of Cancer. Code: ECTS Credits: 6. Degree Type Year Semester 2017/2018 Molecular Biology of Cancer Code: 100863 ECTS Credits: 6 Degree Type Year Semester 2500252 Biochemistry OT 4 0 Contact Name: Carles Arús Caralto Email: Carles.Arus@uab.cat Other comments on languages

More information

In-San Kim, M.D., Ph.D. KIST InterMembrane Signaling Lab & KU-KIST, Korea University The 15 th Korea-US Forum on Nanotechnology,

In-San Kim, M.D., Ph.D. KIST InterMembrane Signaling Lab & KU-KIST, Korea University The 15 th Korea-US Forum on Nanotechnology, In-San Kim, M.D., Ph.D. KIST InterMembrane Signaling Lab & KU-KIST, Korea University The 15 th Korea-US Forum on Nanotechnology, 2018. 7. 12 Annals of Oncol. 2018 Tang et al., 2004 new IO agents : 940

More information

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence. Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression

More information

Mechanisms of Resistance to Antiangiogenic. Martin J. Edelman, MD University of Maryland Greenebaum Cancer Center Dresden, 2012

Mechanisms of Resistance to Antiangiogenic. Martin J. Edelman, MD University of Maryland Greenebaum Cancer Center Dresden, 2012 Mechanisms of Resistance to Antiangiogenic Agents Martin J. Edelman, MD University of Maryland Greenebaum Cancer Center Dresden, 2012 Angiogenesis: A fundamental attribute of cancer Premise of Anti-angiogenic

More information

Rath, N., and Olson, M. (2016) Regulation of pancreatic cancer aggressiveness by stromal stiffening. Nature Medicine, 22(5), pp. 462-463. There may be differences between this version and the published

More information

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz October 11, 2013

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz October 11, 2013 Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz October 11, 2013 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 200 180 160 140 120 100 80 60 40

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,

More information

Epigenetic reprogramming of tumor and stem cell genomes by exogenous delivery of Transcription Factors

Epigenetic reprogramming of tumor and stem cell genomes by exogenous delivery of Transcription Factors Pilar Blancafort Associate Professor School of Anatomy, Physiology and Human Biology UWA! Epigenetic reprogramming of tumor and stem cell genomes by exogenous delivery of Transcription Factors The University

More information