Targeted Nano- Therapeutics for Drug Resistant Tumors
|
|
- Valentine Daniel Sparks
- 5 years ago
- Views:
Transcription
1 Invited Presentation at the 2016 American Association of Pharmaceutical Scientists National Biotechnology Conference. Boston, MA. Wednesday, May 18 th, 2016 Targeted Nano- Therapeutics for Drug Resistant Tumors Mansoor M. Amiji, PhD University Distinguished Professor and Director of the Laboratory of Biomaterials and Advanced Nano-Delivery Systems (BANDS) Department of Pharmaceutical Sciences Northeastern University 140 The Fenway Building Boston, MA Website:
2 The Tumor Microenvironment The Hallmarks of Cancer Cells of the TME Ref: D. Hanahan and R.A. Weinberg. Cell; 144: (2011). Ref. D. Leyva-Illades, et al., Transl Gastrointest Cancer; 1: (2012). Tumors are composite of many different cellular and non-cellular constituents that surround the malignant cancer cells harboring activating mutations in oncogenes or loss of tumor suppressors that drive tumor growth. A variety of infiltrating immune cells, cancerassociated fibroblasts, and angiogenic endothelial cells play expanding and critical functions in sustaining cell proliferation, evading growth suppressors, promoting survival, activating invasion and metastasis, and reprogramming energy metabolism.
3 Hypoxia, Glycolysis and Drug Resistance Ref. O. Trendan, et. al., J. Nat. Cancer. Inst. 99(19): (2007) Ref. M.G. Vander-Heiden, et al. Science 324 (5930): (2009)
4 Overcoming MDR by RNAi/Drug Therapy Circumventing antiapoptotic mechanisms (e.g., survivin and Bcl- 2 expression) Inhibiting ATPdependent drug efflux transporters (e.g., mdr-1 and mrp-1 genes) Inhibition of aerobic glycolysis (e.g., PKM-2, HK, and LDH-A genes) Affecting genes that regulate cell-cycle checkpoints (e.g., mad-2) Ref. M. Susa, et al., Pharm. Res., 28(2): (2011). Funded by NCI Alliance in Nanotechnology, Platform Partnership Grants
5 Targeting Module Combinatorial-Designed Nano-Assemblies Module Payloads Imaging Module Payload Encapsulation Pol-Lipid C 2-4 Pol-Lipid C 6-10 Pol-Lipid C Pol-Thiol Pol-PEG Peptide Fluorescence Radioactive Shanthi Ganesh Arun Iyer Amit Singh
6 Hyaluronic Acid Derivatives Hyaluronic acid (HA) is a natural, biocompatible, and biodegradable polymer 5 1 Long history of safe use in clinical applications (e.g., for viscosupplementation therapy in arthritis) 2 Intrinsic targeting to CD44 receptors over-expressed on tumor cells (e.g., cancer stem cells) and macrophages 4 Modular HA nanoparticle platform synthesized using different functional substitutions (EDC coupling or click chemical cojugation) Combinatorial library of formed nanoparticles by self-assembly of the constituents at specific weight ratios of each (i.e., LEGO blocks) sirna/mirna Duplexes OR Small Molecule Drug OR Targeted Self-Assembling Nano-system HA-PEG HA-Thiol HA-PEG-Peptide 3 EGFR Peptide
7 SKOV3 CD44 Expression Evaluation of Combination mdr-1 Silencing and Paclitaxel Co-Therapy in Resistant Ovarian Cancer CD44 expression in human ovarian tumor samples Platinum Refractory Tumor Sensitive Tumor 40X E Zhenfeng Duan, MGH HA shell for tumor targeting PEI for condensing mdr1 sirna PEG corona for prolonging circulation mdr-1 sirna payload CD44 Pgp CD44 Pgp β-actin SKOV-3 TR SKOV-3 Relative Expression CD44 Pgp SKOV-3TR SKOV-3 SKOV3 TR Encapsulation of mdr-1 sirna in HA-PEI/HA-PEG nanoparticles for CD44 targeted delivery in resistant SKOV3 TR human ovarian adenocarcioma model Ref. X. Yang, et al., Scientific Reports, 5(8509): 1-9 (2015).
8 R e l a t i v e M D R 1 E x p r e s s i o n Down-regulation of mdr-1 in SKOV3 TR Cells using sirna- Encapsulation in HA-PEI/HA-PEG Nanoparticles Relative mdr-1 gene silencing after 24 h by qpcr 1. 2 S K O V - 3 T R c e l l o n l y H A - P E I / H A - P E G / n o n - s p e c i f i c s i R N A % L i p o f e c t a m i n e / M D R 1 s i R N A 9 0 n M H A - P E I / H A - P E G / M D R 1 s i R N A 4 5 n M H A - P E I / H A - P E G / M D R 1 s i R N A 9 0 n M H A - P E I / H A - P E G / M D R 1 s i R N A n M 0. 0 Pgp β-actin Relative Pgp Expression Relative P-gp expression after 24 h 1: SKOV-3TR cell only 2: HA-PEI/HA-PEG/non-specific sirna 45nM 3: HA-PEI/HA-PEG/non-specific sirna 90nM 4: HA-PEI/HA-PEG/non-specific sirna 180nM 5: MDR1 sirna alone 45nM 6: MDR1 sirna alone 90nM 7: MDR1 sirna alone 180nM 8: Lipofectamine /MDR1 90nM 9: HA-PEI/HA-PEG/MDR1 sirna 45nM 10: HA-PEI/HA-PEG/MDR1 sirna 90nM 11: HA-PEI/HA-PEG/MDR1 sirna 180nM Ref. X. Yang, et al., Scientific Reports, 5(8509): 1-9 (2015).
9 Evaluation of P-gp and CD44 Expression in Tumor Tissues upon Administration of mdr-1 sirna in HA Nanoparticles CD44 Pgp CD44 Pgp 1 β-actin Relative Expression CD Pgp : saline + paclitaxel 2: MDR1 sirna + paclitaxel 3: HA-PEI/HA-PEG/none specific sirna + paclitaxel 4: HA-PEI/HA-PEG/MDR1 sirna + paclitaxel Ref. X. Yang, et al., Scientific Reports, 5(8509): 1-9 (2015).
10 R e l a t i v e T u m o r V o l u m e Ref. X. Yang, et al., Scientific Reports, 5(8509): 1-9 (2015). In Vivo Anti-tumor Efficacy of Combination mdr-1 sirna/paclitaxel Therapy in SKOV3 TR Xenograft Model Group 4: HA-PEI/HA-PEG/mdr1 sirna Group 3: HA-PEI/HA-PEG/non-specific sirna Group 2: MDR1 sirna alone Group 1: saline Group 1-4: paclitaxel (20mg/kg) Tumors collection s a l i n e + p a c l i t a x e l M D R 1 s i R N A + p a c l i t a x e l H A - P E I / H A - P E G / n o n - s p e c i f i c s i R N A + p a c l i t a x e l H A - P E I / H A - P E G / M D R 1 s i R N A + p a c l i t a x e l Saline + paclitaxel mdr-1 sirna alone + paclitaxel HA-PEI/HA-PEG/ Non-pecific sirna + paclitaxel T i m e a f t e r i n j e c t i o n ( d a y s ) HA-PEI/HA-PEG/ mdr-1 sirna + paclitaxel
11 PKM-2/β-actin MDR-1/β-actin Combination mdr-1/pkm-2 Gene Silencing in SKOV3 Model with HA-PEI/HA-PEG Nanoparticles h 96 h mdr-1 Gene Silencing sirna Dose: 100 nm Time: 72 and 96 hours Michael Goldberg, DFCI h 96 h PKM-2 Gene Silencing Ref. R.A. Cairns, I.S. Harris, & TW. Mak. Nat Revs Cancer, 11: (2011) Partially Funded by DFCI/NU Grant Ref. M. Talekar, et al., Mol. Cancer Therap., 14(7): (2015). Meghna Talekar
12 Ref. M. Talekar, et al., Mol. Cancer Therap., 14(7): (2015). Biodistribution and Tumor-Specific Localization of sirna Upon Administration in HA-PEI/HA-PEG Nanoparticles Non-Targeted EGFR Targeted Whole body near-ir imaging of tumor targeted delivery with ICG-encapsulated control and EGFR targeted HA-PEI/HA-PEG nanoparticles and quantitative assessment of mdr-1 sirna accumulation as a function of time in plasma and various tissues.
13 Ref. M. Talekar, et al., Mol. Cancer Therap., 14(7): (2015). Establishment of Resistant SKOV3 Model by Intravenous Paclitaxel Administration in Athymic Mice In vivo PTX resistance model development. SKOV-3 wild-type tumor bearing mice were injected with 20 mg/kg PTX every alternate day for 10 days. MDR-1 and PKM-2 expression levels were assessed using PCR (A) and immunohistofluorescence (B & C) and an increase in mdr- 1/P-gp expression was observed in animals treated with PTX. However no significant difference was observed following week 1 and week 3 post last dose of PTX. We are currently investigating the efficacy of combination therapy with sirna and PTX in this model. B A C
14 Gene of interest/β-actin Ref. M. Talekar, et al., Mol. Cancer Therap., 14(7): (2015). Tumor volume (mm 3 ) In Vivo mdr-1 and PKM-2 Gene Silencing and Anti-Tumor Efficacy with Combination Therapy in SKOV3 Model In Vivo Silencing Efficiency simdr-1 sipkm In Vivo Anti-Tumor Response PBS PTX solution simdr-1 sipkm-2 HA-PEI (NT) HA-PEI (T) HA-PEI-MDR-1+PTX(NT) HA-PEI-MDR-1+PTX(T) HA-PEI-MDR-1/PKM-2+PTX(NT) HA-PEI-MDR-1/PKM-2+PTX(T) PBS Scrambled sirna NP sirna (NT) NP sirna (T) Time (days) qpcr analysis of in vivo gene silencing efficacy in SKOV3 tumor xenograft model in female nu/nu (athymic) mice upon intravenous administration of mdr-1 and PKM2 silencing sirna (0.5 mg/kg) and the anti-tumor therapeutic response from single and combination sirna/paclitaxel (20 mg/kg) administration
15 Tumor-Associated Macrophages Ref. J.W. Pollard. Nat Revs Cancer, 4, (2004) Ref. T.L. Rogers and I. Holen. J Translational Med, 9:177 (2011) Tumor-associated macrophages (TAMs), which are predominantly M2 polarized, affect virtually all aspects of tumor growth and progression, including stem cells, metabolism, angiogenesis, invasion, metastasis, and therapeutic resistance. Communication between tumor cells and macrophages is critical for tumor malignancy.
16 TAM Repolarization from M2 to M1 Ref. S.K. Biswas & A. Montovani, Nat Immunol., 11: (2010). Ref. R.C. Chang, et al., Cells, 3(3): (2014). Reprogramming TAMs from a predominant M2 to M1 phenotype would provide an opportunity for anti-tumor response and potentially improve cancer immunotherapy. Several microrna s (e.g., mir-155 and mir-125b) have shown to change macrophage polarity from M2 to M1.
17 Exosome Transfer from Human Pancreatic Tumor Cells to Macrophages using a Co-Culture System Transwell Co-Culture System Tumor Cells Macrophages 6 h After treating LPS/IFN-γ Tumor Cells Macrophages Luciferase Expressing Panc-1 Cells 48h & 72h Mei-Ju Su Microscopy and RT-PCR Analysis of Exosome-Mediated Macrophage Polarization RT-PCR Analysis of M1/M2 Macrophage Polarization Markers TEM image of Panc-1 Exosomes Ref. M.J. Su, et al., Nature - Scientific Reports, (Submitted)
18 MicroRNAs 155 and 125b Transfection in Panc-1 Cells with HA-PEI/HA-PEG Nanoparticles Human pancreatic cancer cells (Panc-1) transfected with plasmid DNA expressing mir-155 and mir-125b and the levels of expression in cells relative to control were measured using PCR. The plasmid dose was 20 mg per 200,000 cells. Ref. M.J. Su, et al., Nature - Scientific Reports, (Submitted)
19 Change in Macrophage Polarization from M2 to M1 with Exosome-Mediated Transfer of MicroRNAs 155 and 125b Ref. M.J. Su, et al., Nature - Scientific Reports, (Submitted)
20 MicroRNA Profiling in Cytosol and Exosomes in SK-LU1 Non-Small Cell Lung Cancer Cells Malav Trivedi TEM image of SK-LU1 exosomes Ref. M. Trivedi, et al., Oncogenesis, (Submitted) Meghna Talekar
21 Changes in wt-p53 and mir-125b Levels in Cytosol and Exosomes upon Transfection with HA-Based Nanoparticles A Flag p53 Transcript Levels B mir-125b Transcript Levels (A) Quantitative qrt-pcr analysis of expression of wt-p53 in cells (p53/cells) and in exosomes (p53/exo) when transfected with wt-p53 expressing plasmid DNA alone or in combination with mirna-125b expressing plasmid DNA in cells (combi/cells) and in exosomes (combi/exo) after 18 hours of incubation. (B) Quantitative qrt-pcr analysis of expression of mir-125b expression in cells (mir-125b/cells) and in exosomes (mir-125b /exo) when transfected with mirna-125b expressing plasmid DNA alone or in combination with wt-p53 expressing plasmid DNA in cells (combi/cells) and in exosomes (combi/exo) after 18 hours of incubation. Ref. M. Trivedi, et al., Oncogenesis, (Submitted)
22 Establishment of KRAS/p53 Mutant Genetically-Engineered Mouse Model of Non-Small Cell Lung Cancer Wild type lungs Mutant 4 wks Mutant 10 wks* 6 weeks post AdeCre dosing variable viral dose Time course analysis of stages of tumor progression in Lox-K-ras-G12D mice Papillary adenoma 6 weeks Large adenoma 12 weeks Adenocarcinoma 16 weeks Atypical adenomatous hyperplasia 2 weeks Ref. M. Talekar, et al., Molecular Therapy, 24(4): (2016).
23 R a tio F la g -p 5 3 / -a c tin In Vivo wt-p53 and mir-125b Transfection in Lung Tumor Tissues in the KRAS/p53 GEM Models Relative p53 expression wt-p53 Transcript * AdCre Kras LSL-G12D /p53 fl/fl * * * Day 1 pdna- HA NP s Day 3 pdna- HA NP s Flag p53 β-actin 2.0 Day 5 pdna- HA NP s Day 7 Cisplatin solution Therapy on week 2, 4 and 6 0 PBS CD44 T p53 NP Dual T p53 NP CD44 T combo NP Dual T combo NP 1.5 Relative mir-125b expression mir-125b Transcript * * * PBS CD44 T 125b NP Dual T 125b NP CD44 T combo NP Dual T combo NP * P B S C D 4 4 T p 5 3 N P D u a l T p 5 3 N P C D 4 4 T c o m b o N P D u a l T c o m b o N P Ref. M. Talekar, et al., Molecular Therapy, 24(4): (2016).
24 Changes in the M1/M2 Macrophage Markers and Inflammatory Cytokine Levels in Tumor Tissues Ref. M. Talekar, et al., Molecular Therapy, 24(4): (2016).
25 Changes in the Ki-67 Expression Profile in Tumor Tissues upon Transfection with wt-p53 and mir-125b Ref. M. Talekar, et al., Molecular Therapy, 24(4): (2016).
26 Summary Poor drug delivery efficiency and the various soluble and insoluble tumor microenvironmental factors are critical in the development of drug resistance. Combinatorial-designed multifunctional polymeric nano-systems offer a versatile platform for tumor-targeted delivery of RNAi and small molecule therapeutics for modulation of drug resistance. Our RNAi approaches have relies on the hallmarks of cancer focusing on down-regulation of anti-apoptotic genes (e.g., bcl-2 and survivin), ATPdependant efflux transporters (e.g., mdr-1), glycolytic enzymes (e.g., PKM-2), and cell cycle checkpoint genes (e.g., mad-2). Further evaluation of the role of tumor microenvironment, especially through regulation of tumor cell communication, epigenetics, macrophage polarity, and inflammatory pathways, will be critical to overcome resistance. In all of the above nano-therapeutic strategies, our focus continues to be on the use of safe materials and scalable manufacturing processes that allow for rapid translation of these experimental approaches in clinically-viable therapeutic options for cancer patients.
Nanotechnology applications in medical diagnosis, imaging, and therapy
Engineering Conferences International ECI Digital Archives Nanotechnology in Medicine: From Molecules to Humans Proceedings 7-4-2016 Nanotechnology applications in medical diagnosis, imaging, and therapy
More informationDepartment of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2
Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji
More informationMaster's Thesis Research. By, Megha Suresh. Advisor: Mansoor M. Amiji, PhD
In Vitro Model of Inflammatory Signaling and Cancer Stem Cell Signaling in Pancreatic Cancer using 3D Hetero-Cellular Spheroids and MicroRNA Delivery using Hyaluronic Acid-Based Nanoparticles Master's
More informationCancer Problems in Indonesia
mirna and Cancer : mirna as a Key Regulator in Cancer Sofia Mubarika 2 nd Symposium Biomolecular Update in Cancer PERABOI Padang 18 Mei 2013 Cancer Problems in Indonesia 1. Chemoresistency / recurrency
More informationNovel Approaches to CAR-T Cell Platform
Novel Approaches to CAR-T Cell Platform Vita Golubovskaya, Ph.D. Director, R&D Promab Biotechnologies 3 rd CAR-TCR Summit 2017 S E P T E M B E R 5-7 B O S T O N Novel Approaches To CAR-T Cell Platform
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationJoint Department of Biomedical Engineering
Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2018 Supplementary Data Systemic Delivery of CRISPR/Cas9 with PEG-PLGA Nanoparticles for
More informationmicrorna Presented for: Presented by: Date:
microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationEngineered Immune Cells for Cancer Therapy : Current Status and Prospects
When Engineering Meets Immunology Engineered Immune Cells for Cancer Therapy : Current Status and Prospects Yong Taik Lim, Ph.D. Nanomedical Systems Laboratory (http://www.nanomedicalsystems.org) SKKU
More informationDevelopment of Multifunctional Nanoparticles for Brain Tumor Imaging and Therapy
Development of Multifunctional Nanoparticles for Brain Tumor Imaging and Therapy Omid Veiseh, Ph.D. Professor Miqin Zhang s Nanomedicine and Biomaterials Lab Departments of Materials Science & Engineering
More informationHyaluronic Acid Based Self-Assembled Multifunctional Nanosystems to Overcome Drug Resistance in Lung Cancer
Hyaluronic Acid Based Self-Assembled Multifunctional Nanosystems to Overcome Drug Resistance in Lung Cancer Thesis Presented by Shanthi Ganesh to The Bouvé Graduate School of Health Sciences in Partial
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationSUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationCancer Biology Dynamical Cell Systems
The Institute of Cancer Research PHD STUDENTSHIP PROJECT PROPOSAL PROJECT DETAILS Project Title: SUPERVISORY TEAM Primary Supervisor: The forces behind pancreatic cancer; and changing them as a therapeutic
More informationMicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
More informationExperimental Therapeutics I
Experimental Therapeutics I Mary Hitt 5142 Katz Group Centre mhitt@ualberta.ca; or Mary.Hitt@albertahealthservices.ca 1 Specific Topics for Today Preclinical and clinical testing Gene therapy Nonviral
More informationThe nab Platform : From Bench to the Clinic and Beyond. Neil P. Desai, PhD Abraxis BioScience LLC
The nab Platform : From Bench to the Clinic and Beyond Neil P. Desai, PhD Abraxis BioScience LLC Policy Issues in Nanotechnology and Oncology, National Cancer Policy Forum Workshop, Institute of Medicine,
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationJohn Bell Centre for Innovative Cancer Therapeutics
Enhancing Oncolytic Virus Activity by Engineering of Artificial micrornas John Bell Centre for Innovative Cancer Therapeutics Affiliated with Affilié à 1 Oncolytic Viruses: A Therapy for Metastatic Cancers?
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More informationCancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz
Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz December 1, 2010 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 25 More mutations as 20 you get older
More informationCELL BIOLOGY - CLUTCH CH CANCER.
!! www.clutchprep.com CONCEPT: OVERVIEW OF CANCER Cancer is a disease which is primarily caused from misregulated cell division, which form There are two types of tumors - Benign tumors remain confined
More informationmir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
More informationProfiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
More informationInflammatory Cells and Metastasis
Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University
More informationSupporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationTherapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis
Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis Myron R. Szewczuk Dept. Biomedical and Molecular Sciences, Queen's University, Kingston, K7L 3N6 Ontario, Canada HIGHLIGHTS. An innovative
More informationPancreatic Adenocarcinoma: What`s hot
Pancreatic Adenocarcinoma: What`s hot Eva Karamitopoulou-Diamantis Institute of Pathology University of Bern 11.09.2018, 30th ECP, Bilbao Pancreatic Cancer and the Microbiome The Pancreatic Cancer Microbiome
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationHuman Lung Cancer Pathology and Cellular Biology Mouse Lung Tumor Workshop
Human Lung Cancer Pathology and Cellular Biology Mouse Lung Tumor Workshop Jan 7 th and 8 th, 2014 Brigitte Gomperts, MD University of California, Los Angeles Lung Structure and Function Airway Epithelial
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationDevelopment of Degradable Stealth Nanospheres for Controlled Delivery of Anticancer Drugs
Development of Degradable Stealth Nanospheres for Controlled Delivery of Anticancer Drugs Emmanuel. Akala, R.Ph., Ph.D. Department of Pharmaceutical Sciences School of Pharmacy First Generation Polymeric
More informationSpherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin
Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin Departments of Chemistry, Infectious Disease, Materials Science & Engineering, Chemical & Biological Engineering, and Biomedical
More informationFinal published version:
Tumor Penetrating Theranostic Nanoparticles for Enhancement of Targeted and Image-guided Drug Delivery into Peritoneal Tumors following Intraperitoneal Delivery Ning Gao, Emory University Erica N. Bozeman,
More informationTransformation of Normal HMECs (Human Mammary Epithelial Cells) into Metastatic Breast Cancer Cells: Introduction - The Broad Picture:
Transformation of Normal HMECs (Human Mammary Epithelial Cells) into Metastatic Breast Cancer Cells: Introduction - The Broad Picture: Spandana Baruah December, 2016 Cancer is defined as: «A disease caused
More informationOMICS Journals are welcoming Submissions
OMICS Journals are welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationNew therapies for pancreatic cancer treatment:
New therapies for pancreatic cancer treatment:! Targeting of surface proteins! Development of nanoparticles CRRET laboratory Growth factors and angiogenesis School of Sciences and Technologies University
More informationMacrophages and Exosomes Employ Brain Inflammation for CNS Delivery of Therapeutics A. Kabanov
Macrophages and Exosomes Employ Brain Inflammation for CNS Delivery of Therapeutics A. Kabanov Targeting Brain Inflammation in Disease Biochemical studies of brains from individuals with many neurologic
More informationGenetics and Cancer Ch 20
Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)
More informationChapter 1: Curcumin is excellent compound for various medicinal usages
Super-Curcumin Story Chapter 1: Curcumin is excellent compound for various medicinal usages Chapter 2: Discovery of Super-Curcumin analog Chapter 3: Anti-tumor activities of Super-Curcumin analog Chapter
More informationSmith Family Awards Program for Excellence in Biomedical Research 2017 Award Recipients
Smith Family Awards Program for Excellence in Biomedical Research 2017 Award Recipients Aaron Hata, M.D., Ph.D. Assistant Professor of Medicine at Harvard Medical School MGH Cancer Center Determining the
More informationMesenchymal stem cells release exosomes that transfer mirnas to endothelial cells and promote angiogenesis
Mesenchymal stem cells release exosomes that transfer mirnas to endothelial cells and promote angiogenesis Tanja Wagner 1 Introduction 2 Mesenchymal stem cells (MSCs) non-haematopoietic, multipotent stem
More informationSupplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer.
Supplemental Materials Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in Pancreatic Cancer Jun Zhao 1, Zhilan Xiao 2, 3, Tingting Li 1, 4, Huiqin Chen 5, Ying Yuan 5, Alan
More informationstability and tumor suppression
Supplementary information The stress kinase MKK7 couples oncogenic stress to p53 stability and tumor suppression Daniel Schramek 1, Athanassios Kotsinas 2, Arabella Meixner 1, Teiji Wada 1, Ulrich Elling
More informationmirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationExpanding its HDL strategy into Immuno-oncology and Chemotherapeutic drug delivery. Acquisition of LYPRO Biosciences
Expanding its HDL strategy into Immuno-oncology and Chemotherapeutic drug delivery Acquisition of LYPRO Biosciences CERENIS is well positioned to change the drug delivery paradigm Over a decade of experience
More informationSupplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
More informationIMMUNOTOOLS: EFFECT OF NOTCH-DEFICIENT MACROPHAGES TO AUTOIMMUNE DISEASE WIPAWEE WONGCHANA
IMMUNOTOOLS: EFFECT OF NOTCH-DEFICIENT MACROPHAGES TO AUTOIMMUNE DISEASE 22-02-2017 WIPAWEE WONGCHANA WHAT DO YOU SEE? Allergy Ref: http://carrington.edu/blog/medical/vaccines/smallpox-andsmallpox-vaccine/
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationHIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.
HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-10-1-1029 TITLE: PRINCIPAL INVESTIGATOR: Mu-Shui Dai, M.D., Ph.D. CONTRACTING ORGANIZATION: Oregon Health Science niversity, Portland, Oregon 97239 REPORT DATE: October 2013 TYPE
More informationOncology for Scientists RPN 530 Fall 2017 Cancer Cell Metabolism
Oncology for Scientists RPN 530 Fall 2017 Cancer Cell Metabolism Gokul Das, Ph.D. Department of Pharmacology & Therapeutics Center for Genetics & Pharmacology (CGP) Room 4-304 Tel: 845-8542 Email: gokul.das@roswellpark.org
More informationCancer therapeutics in the clinical setting. Need for alternate therapeutics. Target multiple cancer pathways. Circumvent the genetic mutations
Transcriptional factor Snail and MMP-9 signaling axis controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma Samar Abdulkhalek 1, Olivia Geen 1, Lacey Brodhagen
More informationPancreatic intraepithelial
Pancreatic intraepithelial neoplasia (PanIN) Markéta Hermanová St. Anne s University Hospital Brno Faculty of Medicine, Masaryk University Precursor lesions of invasive pancreatic cancer Pancreatic intraepithelial
More informationBIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
More informationDevelopment of Carcinoma Pathways
The Construction of Genetic Pathway to Colorectal Cancer Moriah Wright, MD Clinical Fellow in Colorectal Surgery Creighton University School of Medicine Management of Colon and Diseases February 23, 2019
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationVirchow s Hypothesis lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation
Virchow s Hypothesis 1863 lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation Barrett s esophagus/ Esophageal adenocarcinoma PSC / Cholangiocarcinoma Viral hepatitis
More informationX P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationDevelopment of a Novel IL-12 DNA-based Immunotherapy in Combination with Chemotherapy for Treatment of Advanced Ovarian Cancer
Development of a Novel IL-12 DNA-based Immunotherapy in Combination with Chemotherapy for Treatment of Advanced Ovarian Cancer Khursheed Anwer, Ph.D. Executive Vice President and CSO Molecular Medicine
More informationEarly cell death (FGF) B No RunX transcription factor produced Yes No differentiation
Solution Key - Practice Questions Question 1 a) A recent publication has shown that the fat stem cells (FSC) can act as bone stem cells to repair cavities in the skull, when transplanted into immuno-compromised
More informationUNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL. PhD THESIS
UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL PhD THESIS THE IMPORTANCE OF TUMOR ANGIOGENESIS IN CEREBRAL TUMOR DIAGNOSIS AND THERAPY ABSTRACT PhD COORDINATOR: Prof. univ. dr. DRICU Anica PhD
More informationImmunologic Effects of Clinical Stage FAK & PI3K-Delta/Gamma Inhibitors
1 Immunologic Effects of Clinical Stage FAK & PI3K-Delta/Gamma Inhibitors Jonathan Pachter, Ph.D - Chief Scientific Officer 3rd Annual Immuno-Oncology Congress, May 24, 2018 Disclosures 2 I am an employee
More informationMolecular Biology of Cancer. Code: ECTS Credits: 6. Degree Type Year Semester
2018/2019 Molecular Biology of Cancer Code: 100863 ECTS Credits: 6 Degree Type Year Semester 2500252 Biochemistry OT 4 0 Contact Name: Carles Arús Caralto Email: Carles.Arus@uab.cat Other comments on languages
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
More informationSupplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap
Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized
More informationMicroRNA-31 initiates lung tumorigenesis and promotes mutant KRAS-driven lung cancer
The Journal of Clinical Investigation Research article MicroRNA-31 initiates lung tumorigenesis and promotes mutant KRAS-driven lung cancer Mick D. Edmonds, 1 Kelli L. Boyd, 1 Tamara Moyo, 2 Ramkrishna
More informationChapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit
15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional
More informationMolecular mechanisms of the T cellinflamed tumor microenvironment: Implications for cancer immunotherapy
Molecular mechanisms of the T cellinflamed tumor microenvironment: Implications for cancer immunotherapy Thomas F. Gajewski, M.D., Ph.D. Professor, Departments of Pathology and Medicine Program Leader,
More informationSupplementary Figure 1: Experimental design. DISCOVERY PHASE VALIDATION PHASE (N = 88) (N = 20) Healthy = 20. Healthy = 6. Endometriosis = 33
DISCOVERY PHASE (N = 20) Healthy = 6 Endometriosis = 7 EAOC = 7 Quantitative PCR (mirnas = 1113) a Quantitative PCR Verification of Candidate mirnas (N = 24) VALIDATION PHASE (N = 88) Healthy = 20 Endometriosis
More informationCANCER IMMUNOPATHOLOGY. Eryati Darwin Faculty of Medicine Andalas University
CANCER IMMUNOPATHOLOGY Eryati Darwin Faculty of Medicine Andalas University Padang 18 Mei 2013 INTRODUCTION Tumor: cells that continue to replicate, fail to differentiate into specialized cells, and become
More informationSystemic RNAi Therapuetics for the Treatment of HIV-1 Prof. John J. Rossi
Systemic RNA Interference (RNAi) Therapeutics for the of HIV-1 John J. Rossi, Professor and chairman Department of Molecular and Cellular Biology, Beckman Research Institute of the City of Hope Duarte
More informationHDAC Inhibitors and PARP inhibitors. Suresh Ramalingam, MD Associate Professor Chief of Thoracic Oncology Emory University School of Medicine
HDAC Inhibitors and PARP inhibitors Suresh Ramalingam, MD Associate Professor Chief of Thoracic Oncology Emory University School of Medicine Histone Acetylation HAT Ac Ac Ac Ac HDAC Ac Ac Ac Ac mrna DACs
More informationNano Immuno Chemotherapy to treat cancers
Nano Immuno Chemotherapy to treat cancers Dr. Giovanna Lollo, MiNT, France Dr. Ilaria Marigo, IOV, Italy University of Angers MiNt: Micro et Nanomedicines Biomimetiques France Instituto Oncologico Veneto
More informationChapter 7 Conclusions
VII-1 Chapter 7 Conclusions VII-2 The development of cell-based therapies ranging from well-established practices such as bone marrow transplant to next-generation strategies such as adoptive T-cell therapy
More informationSpecific Targeting and Delivery of Therapeutics to Cancer Cells Based on the Tumor Microenvironment
Specific Targeting and Delivery of Therapeutics to Cancer Cells Based on the Tumor Microenvironment Damien Thévenin Department of Chemistry Bioscience in the 21st century (Sep. 14, 218) Anticancer Drugs
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationThe clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors
Department of Tumor Biology The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors cfdna Copenhagen April 6-7, 2017 Heidi Schwarzenbach, PhD Tumor
More informationMyelodysplastic Syndromes: Hematopathology. Analysis of SHIP1 as a potential biomarker of Disease Progression
Myelodysplastic Syndromes: Hematopathology. Analysis of SHIP1 as a potential biomarker of Disease Progression Carlos E. Bueso-Ramos, M.D., Ph.D Department of Hematopathology The University of Texas M.
More informationCircular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
More informationPRESAGE CIVO: A NOVEL PLATFORM FOR PRECISION ONCOLOGY & DRUG DEVELOPMENT
PRESAGE : A NOVEL PLATFORM FOR PRECISION ONCOLOGY & DRUG DEVELOPMENT DECEMBER 2017 Presage Biosciences, Inc. 2017. All rights reserved. Presage Proprietary Biosciences, information. Inc. 2017. All rights
More informationMolecular Biology of Cancer. Code: ECTS Credits: 6. Degree Type Year Semester
2017/2018 Molecular Biology of Cancer Code: 100863 ECTS Credits: 6 Degree Type Year Semester 2500252 Biochemistry OT 4 0 Contact Name: Carles Arús Caralto Email: Carles.Arus@uab.cat Other comments on languages
More informationIn-San Kim, M.D., Ph.D. KIST InterMembrane Signaling Lab & KU-KIST, Korea University The 15 th Korea-US Forum on Nanotechnology,
In-San Kim, M.D., Ph.D. KIST InterMembrane Signaling Lab & KU-KIST, Korea University The 15 th Korea-US Forum on Nanotechnology, 2018. 7. 12 Annals of Oncol. 2018 Tang et al., 2004 new IO agents : 940
More informationSupplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
More informationMechanisms of Resistance to Antiangiogenic. Martin J. Edelman, MD University of Maryland Greenebaum Cancer Center Dresden, 2012
Mechanisms of Resistance to Antiangiogenic Agents Martin J. Edelman, MD University of Maryland Greenebaum Cancer Center Dresden, 2012 Angiogenesis: A fundamental attribute of cancer Premise of Anti-angiogenic
More informationRath, N., and Olson, M. (2016) Regulation of pancreatic cancer aggressiveness by stromal stiffening. Nature Medicine, 22(5), pp. 462-463. There may be differences between this version and the published
More informationCancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz October 11, 2013
Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz October 11, 2013 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 200 180 160 140 120 100 80 60 40
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationEpigenetic reprogramming of tumor and stem cell genomes by exogenous delivery of Transcription Factors
Pilar Blancafort Associate Professor School of Anatomy, Physiology and Human Biology UWA! Epigenetic reprogramming of tumor and stem cell genomes by exogenous delivery of Transcription Factors The University
More information