Hospital, University of British Columbia, Vancouver, Canada.

Transcription

1 OVEREXPRESSING MACROPHAGE ABCA1 BY BONE MARROW TRANSPLANTATION DOES NOT INDUCE ATHEROSCLEROTIC LESION REGRESSION IN LDL RECEPTOR KNOCKOUT MICE WITH ESTABLISHED LESIONS Dan Ye 1, Reeni B. Hildebrand 1, Roshni R. Singaraja 2, Michael R. Hayden 2, Theo J.C. Van Berkel 1, Miranda Van Eck 1 1 Division of Biopharmaceutics, LACDR, Leiden University, The Netherlands 2 Centre for Molecular Medicine and Therapeutics, Children s and Women s Hospital, University of British Columbia, Vancouver, Canada. ABSTRACT ATP-binding cassette transporter 1 (ABCA1) is a key regulator of cellular cholesterol and phospholipid transport. Recently, we have shown that specific up-regulation of macrophage ABCA1 inhibits atherosclerosis progression in LDL receptor knockout (LDLr -/- ) mice. However, the possibly therapeutic effect of macrophage ABCA1 overexpression on atherosclerosis regression is still unknown. In this study, chimeras that specifically overexpress both ABCA1 and EGFP on macrophages were created by transplantation of bone marrow from EGFP-human ABCA1 double transgenic mice to LDLr -/- mice with established atherosclerosis. All mice were fed a Western-type diet, containing.25% cholesterol and 15% fat during the course of this experiment. Specific up-regulation of macrophage ABCA1 in LDLr -/- mice with established atherosclerosis does inhibit the progression of small atherosclerotic lesions (fatty streaks) by 24%. In more advanced lesions, the infiltration of new bone marrow derived-macrophages appears to be limited, as analyzed by EGFP fluorescence and consequently the protective effect of macrophage ABCA1 overexpression was not found in the progression of more advanced lesions. In conclusion, macrophage ABCA1 overexpression did not induce regression of established atherosclerosis either in fatty streak lesions or in more advanced lesions. We propose that the dynamics of macrophage infiltration into lesions with different degrees of severity will largely influence the anti-atherogenic effect of macrophage ABCA1 overexpression on atherosclerosis development. 59

2 INTRODUCTION A hallmark of atherosclerotic cardiovascular disease (CVD) is the accumulation of cholesterol in arterial macrophages. Factors that modulate circulating and tissue cholesterol levels have major impacts on initiation, progression, and regression of CVD. There is an inverse relationship between plasma high-density lipoprotein (HDL) levels and CVD risk, 1 implying that HDL protects against atherosclerosis. Although there are multiple mechanisms by which HDL can be anti-atherogenic, one major function of HDL is its role in reverse cholesterol transport (RCT), a process by which excess cholesterol from peripheral tissues is transferred via the plasma to the liver for elimination via the bile. 2 The specific process involving cholesterol efflux from macrophage foam cells in the artery wall has been termed macrophage RCT. 3 The discovery that Tangier disease is caused by mutations in ATP-binding cassette transporter 1 (ABCA1) has provided a molecular key to understanding the mechanisms and regulation of macrophage RCT. Tangier disease, an autosomal recessive disorder, is characterized by severe HDL-deficiency, deposition of cholesteryl esters (CE) in tissue macrophages, and increased susceptibility to atherosclerosis. 4,5 ABCA1 knockout mice have a phenotype similar to that of Tangier disease patients, 6 while transgenic mice overexpressing ABCA1 showed an anti-atherogenic lipid profile with elevated levels of HDL cholesterol (HDL-C) and apoa-i, and significantly less aortic atherosclerosis. 7,8 Work from our laboratory has previously shown that mice lacking ABCA1 expression in macrophages developed accelerated atherosclerosis, 9 while specific up-regulation of macrophage ABCA1 inhibits atherosclerosis progression in mice. 1 No significant changes in HDL-C levels were observed in either study. These findings suggest that macrophage ABCA1 plays a crucial role in preventing atherosclerosis, independent of plasma HDL-C levels. In fact, the major cholesterol contribution to HDL generation presumably comes from ABCA1 in hepatocytes. 11 Atherosclerosis regression is an important clinical goal, since most patients enter the clinic with established atherosclerotic lesions. It is thus highly important not simply to delay development of atherosclerosis, but to treat this disease by regressing established atherosclerosis. The idea of lesion regression has met considerable resistance over the decades, which is strengthened by the fact that advanced atheromata in humans and in animal models contain components that give an impression of permanence, such as necrosis, calcification and fibrosis. 12,13 Nevertheless, data from both animal and human studies have indicated that atherosclerotic lesions at all stages of development can regress. In animal models, atherosclerosis regression can be achieved through HDL-based interventions such as apoa-i overexpression, 14 which has been shown to promote macrophage RCT. 15 In humans, a weekly infusion of recombinant apoa- I Milano /phospholipid complexes for 5 weeks appeared to induce regression of coronary atherosclerosis in a small study. 16 Regression of atherosclerosis has been expected to be accompanied by a loss of CE mass from foam cells. 3 In fact, ABCA1-dependent cholesterol efflux is a crucial factor in the prevention of excessive cholesterol accumulation in macrophages of the 6

3 Macrophage ABCA1 overexpression does not induce atherosclerosis regression arterial wall and their transformation into foam cells. Macrophages from ABCA1 knockout mice have substantially reduced cholesterol efflux to lipidpoor apoa-i, 17 while overexpression of ABCA1 in macrophages resulted in a 6% increase in cholesterol efflux to apoa-i. 1 Therefore, the concept that promotion of macrophage RCT by up-regulating ABCA1 might prevent progression or even induce regression of atherosclerosis is remarkably attractive. Using the technique of bone marrow transplantation (BMT), ABCA1 can be selectively up-regulated in hematopoietic cells, including macrophages. Furthermore, BMT can be performed at any stage of atherosclerotic lesion development, allowing analysis of atherosclerotic lesions at any degree of complexity. Mice ubiquitously expressing enhanced green fluorescent protein (EGFP) have been generated, which are the ideal tool to follow infiltration of macrophages into established lesions. 18 In the current study, we aimed to assess the therapeutic potential of overexpressing macrophage ABCA1 to prevent progression or even induce regression of established atherosclerotic lesions. Chimeras that specifically overexpress both ABCA1 and EGFP on macrophages were created by transplantation of bone marrow from EGFP-human ABCA1 double transgenic mice into low-density lipoprotein (LDL) receptor knockout (LDLr -/- ) mice with established atherosclerosis. Our findings suggest that specific upregulation of macrophage ABCA1 in animals with established atherosclerotic lesions partly inhibits atherosclerosis progression, but it has minimal contribution to atherosclerosis regression. MATERIALS AND METHODS Mice C57BL/6 mice that express a transgene coding for enhanced green fluorescent protein (EGFP) under control of the human ubiquitin C promoter were obtained from the Jackson Laboratory (Bar Harbor, ME, USA). These mice, called UBC-EGFP/BL6, express GFP in all tissues examined, with high levels of GFP expression observed in hematopoetic cells. 18 The generation of human ABCA1 overexpressing bacterial artificial chromosome (BAC) transgenic mice has been described previously. 19 ABCA1 BAC transgenic mice hemizygous for the human ABCA1 gene on the C57BL/6J background were crossed with UBC-EGFP/BL6 mice. The BAC + GFP +/- offspring were selected and backcrossed once more to the UBC-EGFP/BL6 mice, generating BAC + GFP +/+ (henceforth called EGFP-hABCA1) and BAC - GFP +/+ control littermates (henceforth called EGFP-WT). All the mice were housed in sterilised filter-top cages and given unlimited access to food and water. They were maintained on sterilised regular chow, containing 4.3 % (w/w) fat and no cholesterol (RM3, Special Diet Services, Witham, UK), or were fed a semi-synthetic high cholesterol Western-type diet (WTD), containing 15% (w/w) fat and.25% (w/w) cholesterol (Diet W, Ab diets, Woerden, The Netherlands). During the course of BMT experiments, drinking water was supplied with antibiotics (83 mg/l ciprofloxacin and 67 mg/l polymyxin B sulphate) and 6.5 g/l sucrose. Animal experiments were performed at the Gorlaeus laboratories of the Leiden/Amsterdam Center for Drug Research in accordance with the National Laws. All experimental 61

4 protocols were approved by the Ethics Committee for Animal Experiments of Leiden University. Generation of chimeras by bone marrow transplantation Prior to transplantation, female LDLr -/- mice (C57BL/6J N5) were fed a high cholesterol Western-type diet for, 3, 6, and 9 weeks to induce atherosclerosis with different degrees of complexity. The recipient mice were subsequently lethally irradiated with a single dose of 9 Gy (.19 Gy/min, 2 kv, 4 ma), using an Andrex Smart 225 Röntgen source (YXLON International, Copenhagen, Denmark) with a 6-mm aluminium filter, one day before the transplantation. Bone marrow was harvested by flushing the femurs and tibias from female EGFP-WT mice with phosphatebuffered saline. Single-cell suspensions were prepared by passing the cells through a 3-µm nylon gauze. Irradiated recipients received.5 x 1 7 bone marrow cells by intravenous injection into the tail vein. In order to analyze the effect of macrophage ABCA1 overexpression on atherosclerosis regression, female LDLr -/- mice were fed the Western-type diet for 6 and 9 weeks in order to induce established fatty streaks and advanced lesions, respectively. Mice were subsequently transplanted with bone marrow from female EGFP-hABCA1 mice as mentioned above. Assessment of Chimerism and Flow Cytometry In transplanted mice with EGFP-hABCA1 bone marrow, the hematologic chimerism of the LDLr -/- mice was determined using genomic DNA from bone marrow by polymerase chain reaction (PCR) at 12 weeks after bone marrow transplantation. The forward and reverse primers 5 - GGCTGGATTAGCAGTCCTCA -3 and 5 -ATCCCCAACTCAAAACCACA-3 for human ABCA1 and 5 -TGGGAACTCCTAAAAT-3 and 5 - CCATGTGGTGTGTAGACA-3 for the mouse ABCA1 gene were used and resulted in 34bp and 75bp amplification products, respectively. Blood samples were collected and diluted into phosphate-buffered saline at different time points after transplantation. GFP fluorescence was analyzed by a FACSCalibur flow cytometer (Becton Dickinson, Heidelberg, Germany). 5, cells were counted for each sample. Data were subsequently analyzed using CELLQuest software (BD Biosciences). Serum Cholesterol Analyses After an overnight fast, blood was drawn from each mouse by tail bleeding. The concentration of serum total cholesterol was determined using enzymatic colorimetric assays, with.25 U/ml cholesterol oxidase (Sigma) and.65 U/ml peroxidase and 15 µg/ml cholesteryl esterase (Roche Diagnostics, Mannheim, Germany) in reaction buffer (1. KPi buffer, ph=7.7 containing.1 M phenol, 1 mm 4-amino-antipyrine, 1% polyoxyethylene-9- laurylether, and 7.5% methanol). Precipath I (Roche Diagnostics) was used as an internal standard. Absorbance was read at 49 nm. The distribution of cholesterol over the different lipoproteins in serum was determined by fractionation of 3 µl serum of each mouse using a Superose 6 column (3.2x3mm, Smart-system, Pharmacia, Uppsala, Sweden). Cholesterol content of the effluent was determined as indicated. 62

5 Macrophage ABCA1 overexpression does not induce atherosclerosis regression Histological and immunocytochemical analysis of the aortic root After sacrifice, the atherosclerotic lesion areas in Oil-Red-O-stained cryostat sections of the aortic roots were quantified. Mean lesion area (in µm 2 ) was calculated from 1 Oil-Red-O-stained sections, starting at the appearance of the tricuspid valves. In order to detect lesional macrophages, sections were immunolabeled with a primary rat-anti-mouse monoclonal antibody F4/8 (BMA Biomedicals, Basel, Switzerland) and a peroxidase-conjugated secondary antibody (Jackson ImmunoResearch Laboratories, Suffolk, UK). The amount of collagen in the lesions was determined using Masson s Trichrome Accustain according to manufacturer s instructions (Sigma Diagnostics). Images were obtained with a Leica image analysis system, consisting of a Leica DMRE microscope coupled to a camera and Leica Qwin Imaging software (Leica Ltd., Cambridge, UK). For the detection of bone marrow-derived macrophages, sections were double-immunolabeled with primary antibodies, including a macrophage marker F4/8 and a goat-anti-mouse monoclonal antibody JL-8 (anti-egfp) (CLONTECH Laboratories, Inc.). Secondary antibodies were conjugated to Cy3 (Jackson ImmunoResearch Laboratories, Suffolk, UK) and FITC (Jackson ImmunoResearch Laboratories, Suffolk, UK), respectively. Nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI) (Serva Feinbiochemica, Heidelberg, Germany). Photomicrographs were taken using a Bio-Rad Radiance 21 MP confocal laser scanning system equipped with a Nikon Eclipse TE2-U inverted fluorescence microscope (Melville, NY). All quantifications were done blinded by computer-aided morphometric analysis. Statistical Analyses Data were presented as means±sem. Statistical analyses were performed using one- and two-way ANOVA using Graphpad Prism Software (Graphpad Software, Inc.; The level of statistical significance was set at P<.5. RESULTS Diet-induced atherosclerosis development in LDLr -/- mice LDLr / mice, which represent an established model for the development of atherosclerosis, were fed a high cholesterol Western-type diet (WTD) for, 3, 6, and 9 weeks. During WTD feeding for 3 and 6 weeks, serum cholesterol levels increased ~3-fold (p<.1) and ~5-fold (p<.1), respectively (Fig. 1A). No significant differences in serum cholesterol levels were observed between 6 and 9 weeks, indicating that a steady-state serum cholesterol level was reached after 6 weeks WTD feeding. On regular chow diet, the majority of serum cholesterol in LDLr -/- mice is transported by LDL and HDL, whereas the WTD induced elevation in serum cholesterol levels was primarily caused by an increase in VLDL and LDL cholesterol (VLDL-C and LDL-C) (Fig. 1B). 63

6 A Serum cholesterol (mg/dl) * ** ** Time on diet (weeks) B Serum cholesterol (µg/ml) VLDL LDL Fraction number week week 3 week 6 week 9 HDL Fig. 1. Western-type diet induced hypercholesterolemia in LDLr / mice. Blood samples were drawn after an overnight fast after, 3, 6, and 9 weeks of feeding a high-cholesterol Western-type diet. A: Serum total cholesterol was determined. Values represent the mean of 6 mice. **p<.1 and ***p<.1 vs. on chow. B: Sera from individual mice were loaded onto a Superose 6 column, and fractions were collected. Fractions 3 7 represent VLDL; fractions 8 14, LDL; and fractions 15 19, HDL, respectively. Values represent the mean of 6 mice. SEM is shown only for fractions containing the top of the VLDL, LDL, and HDL peaks. Excessive cholesterol accumulation by the arterial wall macrophages and their transformation into foam cells plays an important role in the initiation of atherosclerosis. 19 Further progression of atherosclerosis is associated with an increase in macrophage infiltration, fibrous cap formation, and the development of a necrotic core consisting of pro-thrombogenic apoptotic bodies, cholesterol crystals and calcified material. 2 To examine the dietinduced lesion development in time, aortic roots of LDLr -/- mice were analyzed at different time points after initiation of the WTD challenge (Fig. 2). As shown, no lesions were formed in LDLr -/- mice on chow, and lesions at week 3 were very small. After 6 weeks WTD feeding, the mean lesion size in the aortic roots was 147±24x1 3 µm 2 (n=6) and the lesions progressed further to 54±42x1 3 µm 2 (n=6) after 9 weeks WTD feeding (Fig. 2A). At week 6 lesions were classified as fatty streaks primarily composed of macrophages (67.8±11.4% macrophage content), whereas at week 9 lesions were classified as advanced fibroatheroma lesions with markedly less macrophages (24.±2.6% macrophage content) (Fig. 2B). A 8 Lesion area (x1 3 µm 2 ) ** *** Time on diet (weeks) 64

7 Macrophage ABCA1 overexpression does not induce atherosclerosis regression B 3 weeks 6 weeks 9 weeks F4/8 Oil-red-O Fatty streak Advanced lesions Diet-induced atherosclerosis Fig. 2. Diet-induced atherosclerosis development in LDLr / mice. A: Formation of atherosclerotic lesions was determined after 3, 6, and 9 weeks of feeding a high cholesterol Western-type diet. The mean lesion area was calculated from Oil-red O-stained cross-sections of the aortic root at the level of the tricuspid valves. Values represent the mean of 6 mice. **p<.1 and ***p<.1 vs. on chow. B: Representative images for Oil-Red-O (top) and immunohistochemical staining with the macrophage marker F4/8 (bottom). Original magnification 5x. Macrophage Infiltration into Different Stages of Atherosclerotic Lesion Development To assess the dynamics of macrophage infiltration in different stages of established atherosclerosis, we performed a bone marrow transplantation (BMT) in which bone marrow from EGFP-WT mice was transplanted into LDLr -/- mice that had been fed WTD for 6 or 9 weeks. All mice were sacrificed after 15 weeks WTD feeding in total. Independently of the type of pre-existing lesions in the recipient, BMT induced a ~2-fold reduction in serum cholesterol levels, which was primarily due to a marked decrease in VLDL-C and LDL-C, as well as moderately decreased HDL-C (data not shown). The new steady-state serum cholesterol level was still high enough to induce atherosclerosis progression in these transplanted mice. Of note, this effect is specific for mice on WTD, as it was not observed in mice that had been transplanted while on regular chow diet in our previous studies. 1 Depending on the macrophage content, a key hallmark of instability, preexisting lesions were classified as fatty streaks and advanced lesions after 6 and 9 weeks WTD feeding, respectively. Upon transplantation after 9 weeks WTD feeding, the mean size of fatty streaks increased ~3-fold (p<.1) in size from 15±24x1 3 (n=8) µm 2 to 53±5x1 3 µm 2 (n=8), while after 6 weeks WTD feeding, established advanced lesions only slightly increased in size from 548±4x1 3 µm 2 (n=8) to 614±71x1 3 µm 2 (n=8). The lesion size did not significantly differ between transplanted mice with pre-existing fatty streaks and advanced lesions upon sacrifice after 15 weeks WTD feeding (Fig. 3A). 65

8 A Lesion area (x1 3 µm 2 ) *** N.S. N.S. 6+9 weeks 9+6 weeks Pre-existing Post BMT B plaque fibrous cap EGFP + F4/8 + Oil-red-O Fig. 3. Atherosclerotic lesion development in LDLr / mice with established atherosclerosis. A: Formation of atherosclerotic lesions was determined after 15 weeks of feeding a high cholesterol Western-type diet in EGFP-WT LDLr / mice with pre-existing fatty streaks and advanced lesions. The mean lesion area was calculated from Oil-red-Ostained cross-sections of the aortic roots at the level of the tricuspid valves. Values represent the mean of 8 mice. ***p<.1 vs. pre-existing lesions. N.S. = non-significant. B: Representative merged photomicrographs of EGFP (green), F4/8 (red) for macrophages and Dapi for nuclei (blue) in atherosclerotic lesions (bottom). Co-localization of macrophages with EGFP fluorescence is yellow-green (white arrows). The corresponding images for Oil-Red-Ostaining are displayed (top). The freshly infiltrated EGFP-positive donor-derived macrophages show massive lipid accumulation (black arrows). Original magnification 2x. Next, we distinguished between cells from the donor (EGFP + ) and those from the recipient origin (EGFP - ). As shown in Fig. 3B, the lesions have grown partly by forming a new layer of donor-derived macrophages (EGFP + F4/8 + ) on top of the pre-existing lesions and that only few donorderived macrophages have infiltrated into the pre-existing lesions. By quantifying the total amount of EGFP + F4/8 + macrophages in the lesions, we found significantly (p<.5) enhanced influx of donor-derived macrophages in the progressed established fatty streaks as compared to the established advanced lesions (data not shown), explaining the observed 66

9 Macrophage ABCA1 overexpression does not induce atherosclerosis regression significant increase in the size of the established fatty streaks as compared to the established advanced lesions (Fig. 3A). Furthermore, by localizing EGFP + F4/8 + macrophages that had infiltrated inside the EGFP - lesions, we were able to quantify the amount of donor-derived macrophages which had infiltrated into the pre-existing lesions. Interestingly, 2.3-fold (p<.5) higher macrophage infiltration inside the established fatty streaks was found (46±16x1 3 µm 2 vs. 2±7x1 3 µm 2 for the EGFP + F4/8 + area inside the preexisting fatty streaks vs. advanced lesions) (Fig. 4). Macrophage infiltration into the pre-existing advanced fibroatheroma lesions was largely blocked, based on the observation that only a thin layer of EGFP + F4/8 + macrophages was lying on the top of the fibrous cap with few macrophages infiltrated inside the established advanced lesions (Fig. 3B). Infiltrated macrophage area (x1 3 µm 2 ) * 6+9 weeks 9+6 weeks Fig. 4. Macrophage infiltration into established atherosclerotic lesions in LDLr / mice. The area of donor-derived macrophages (both EGFP and F4/8 positive, yellow arrow) that have infiltrated into the established fatty streaks (i.e., 6+9 weeks) and advanced lesions (i.e., 9+6 weeks) was quantified. Values represent the mean of 8 mice. *p<.5 vs. the established fatty streaks. Generation of LDLr -/- Mice with Established Atherosclerosis Overexpressing Macrophage ABCA1 To determine whether increasing macrophage ABCA1 could inhibit progression or even induce regression of atherosclerotic lesions in the arterial wall, we performed another BMT experiment to selectively upregulate ABCA1 in hematopoietic cells, including macrophages. Hereto, bone marrow from EGFP-hABCA1 double transgenic mice was transplanted into LDLr -/- mice that had been fed the high-cholesterol WTD for 6 and 9 weeks (EGFP-hABCA1 LDLr / ). Based on the fact that 15 weeks WTD feeding did not significantly affect lesion development in EGFP-WT LDLr / mice with pre-existing advanced lesions (Fig. 3A), in the current experiment we prolonged the total time of WTD feeding to 21 weeks (i.e., 15 and 12 weeks WTD feeding after transplantation, respectively). Genomic DNA isolated from the EGFP-hABCA1 LDLr / mice contained both the human and the murine ABCA1 transcript, whereas the control transplanted group contained only murine ABCA1, indicating that the bone marrow transfer was successful (Fig. 5A). Regardless of either type of donor bone marrow or established lesions in the recipient, blood cells are quantitatively replaced after transplantation by the donor EGFP + cells reaching a level of 99±.2% at 8 weeks posttransplant (Fig. 5B). 67

10 A 1bp 4bp EGFP-hABCA1 LDLr -/- EGFP-WT LDLr -/- murine ABCA1 human ABCA1 B Blood cell replacement (%) >99.9% Time post-transplant (weeks) EGFP-WT EGFP-hABCA1 Fig. 5. Verification of success of bone marrow transplantation. A: Verification of successful reconstitution with donor hematopoietic cells by PCR at 12 weeks posttransplant using genomic DNA isolated from bone marrow. Amplification of the human ABCA1 gene resulted in a ~325bp PCR band, whereas the murine ABCA1 gene yielded a ~9bp band. B: The appearance of donor-derived EGFP-positive blood cells in the circulation determined by FACS analysis at different time points after transplantation. Effect of Macrophage ABCA1 Overexpression on Serum Cholesterol Levels During the course of the experiment, the effect of macrophage ABCA1 overexpression on serum cholesterol levels was carefully monitored. As shown in the Table, serum total cholesterol levels were dramatically increased after 6 or 9 weeks WTD feeding prior to BMT, which were mainly caused by an increase in VLDL-C and LDL-C levels (Fig. 6). Independently of the type of donor bone marrow, BMT induced a marked decrease in total cholesterol levels, which were mainly due to reduced VLDL-C and LDL-C levels. No significant effects of macrophage ABCA1 overexpression on serum cholesterol levels were found (Table). Table. Effect of macrophage ABCA1 overexpression on serum cholesterol levels in LDLr / mice with established atherosclerosis. A B Mice Time (week) Diet Total cholesterol (mg/dl) HDL cholesterol (mg/dl) EGFP-WT LDLr / Baseline Chow 48±15 ND 6 WTD 1296±89 8±2 21 WTD 139±43 44±8 EGFP-hABCA1 LDLr / Baseline Chow 453±19 ND 6 WTD 1542±143 79±3 21 WTD 111±17 51±5 Mice Time (week) Diet Total cholesterol (mg/dl) HDL cholesterol (mg/dl) EGFP-WT LDLr / Baseline Chow 331±5 ND 9 WTD 1789± ±11 21 WTD 913± ±4 EGFP-hABCA1 LDLr / Baseline Chow 327±48 ND 9 WTD 219± ±4 21 WTD 1173±86 95±9 Serum cholesterol levels were measured in LDLr / mice before transplantation (baseline: regular chow diet), after 6 weeks (A) or 9 weeks (B) of feeding a high-cholesterol Western-type diet (WTD) prior to transplantation, and after 21 weeks WTD feeding (15 and 12 weeks after transplantation with EGFP-WT or EGFP-hABCA1 bone marrow, respectively). Values represent mean±sem of at least 6 mice per group. ND indicates not determined. No 68

11 Macrophage ABCA1 overexpression does not induce atherosclerosis regression statistically significant differences were observed between the control transplanted group and the mice transplanted with EGFP-hABCA1 overexpressing bone marrow. The cholesterol distribution over the different lipoproteins of the control and experimental groups was essentially identical upon transplantation after 21 weeks WTD feeding (Fig. 6). Thus, in line with our previous studies, 9,1 no significant difference in HDL-C was observed when ABCA1 was overexpressed solely in macrophages, in contrast to the ABCA1 BAC transgenic mice that displayed mildly increased HDL-C levels. 19 A B Cholesterol (µg/ml) VLDL LDL HDL Before BMT: After BMT: Chow, week WTD, week 6 WTD, week 6 EGFP-WT, week 21 EGFP-hABCA1, week 21 Cholesterol (µg/ml) VLDL LDL HDL Before BMT: Chow, week WTD, week 9 WTD, week 9 After BMT: EGFP-WT, week 21 EGFP-hABCA1, week Fraction Fraction Fig. 6. Effect of macrophage ABCA1 overexpression on serum cholesterol distribution in LDLr / mice with established atherosclerosis. Blood samples were drawn after an overnight fast before transplantation: on regular chow diet (Chow, black circles) and after 6 weeks (A) or 9 weeks (B) of feeding a high-cholesterol Western-type diet (WTD), and upon transplantation after 21 weeks WTD feeding. Sera from individual mice were loaded onto a Superose 6 column, and fractions were collected. Fractions 3 to 7 represent VLDL; fraction 8 to 14, LDL; and fractions 15 to 19, HDL, respectively. The distribution of cholesterol over the different lipoproteins in EGFP-WT LDLr / (blue circles) and EGFP-hABCA1 LDLr / (red circles) chimeras is shown. Values represent the mean of 6 mice per group. SEM is shown only for fractions containing the top of the VLDL, LDL, and HDL peaks. No statistically significant differences were observed. Effect of macrophage ABCA1 overexpression on Atherosclerotic Lesion Development in LDLr -/- Mice with Established Atherosclerosis Prior to transplantation, the mean atherosclerotic lesion area was 162±33x1 3 µm 2 (n=6) after 6 weeks WTD feeding. Overexpression of macrophage ABCA1 in LDLr -/- mice with fatty streaks did not induce regression of atherosclerosis but resulted in a tendency to inhibition of lesion progression (558±36x1 3 µm 2 for EGFP-WT LDLr -/- mice [n=1] vs. 426±14x1 3 µm 2 for EGFP-hABCA1 LDLr -/- chimeras [n=8]; p=.52) (Fig. 7A). No significant differences were observed in lesion composition with respect to the macrophage content (22.6±2.4% and 26.9±1.5% for EGFP- WT and EGFP-hABCA1 transplanted mice, respectively) or the collagen content (12.7±1.3% and 11.8±1.7% for EGFP-WT and EGFP-hABCA1 transplanted mice, respectively). Interestingly, the area of newly formed EGFP + lesions was 1.5-fold (p<.5) smaller in mice transplanted with EGFP-hABCA1 overexpressing bone marrow, indicating less donor-derived macrophage influx in these transplanted animals. Furthermore, by quantifying the donor-derived macrophage area (EGFP + F4/8 + ) inside the progressed established fatty streaks, we found a significant reduction in the EGFP-hABCA1 transplanted mice as compared to controls (44.4±3.6x1 3 µm 2 vs. 18.2±1.9x1 3 µm 2 ; p<.1) (Fig. 7B). Thus, ABCA1 overexpression 69

12 in macrophages reduced infiltration of these macrophages into established fatty streak lesions. A 6 weeks WTD 21 weeks WTD (Before BMT) (15 weeks after BMT) LDLr -/- EGFP-WT EGFP-hABCA1 LDLr -/- LDLr -/- 1 B Lesion area ( 1 3 µm 2 ) pre-existing EGFP-WT p=.52 EGFP-hABCA1 Infiltrated macrophage area (x1 3 µm 2 ) EGFP-WT ** EGFP-hABCA1 Fig. 7. Effect of macrophage ABCA1 overexpression on atherosclerotic lesion development in LDLr / mice with established fatty streak lesions. Before transplantation, LDLr / mice were fed on a high-cholesterol Western-type diet (WTD) for 6 weeks, and then transplanted with EGFP-WT or EGFP-hABCA1 bone marrow. Formation of atherosclerotic lesions was determined in EGFP-hABCA1 LDLr / chimeras and EGFP- WT LDLr / controls with pre-existing fatty streaks after 21 weeks WTD feeding (15 weeks after transplantation). A: The mean lesion area was calculated from Oil-Red-O-stained cross sections of the aortic root at the level of the tricuspid valves. Values represent the mean of 8-1 mice per group. Original magnification 5x. B: Representative merged photomicrographs of EGFP (green), F4/8 (red) for macrophages and Dapi for nuclei (blue) in atherosclerotic lesions. The area of EGFP-positive donor-derived macrophages that have infiltrated inside the progressed established fatty streaks (yellow arrows) was quantified. **p<.1 vs. EGFP-WT transplanted controls. Original magnification 2x. The effects of macrophage ABCA1 overexpression on established advanced lesions was studied in LDLr -/- mice which had been fed the highcholesterol WTD for 9 weeks. Prior to transplantation, the mean atherosclerotic lesion size was 55±51x1 3 µm 2 (n=6). Overexpression of ABCA1 in these mice with advanced atherosclerotic lesions did not induce 7

13 Macrophage ABCA1 overexpression does not induce atherosclerosis regression lesion regression and did not affect lesion progression (65±65x1 3 µm 2 for control EGFP-WT LDLr -/- mice [n=1] vs. 669±37x1 3 µm 2 for EGFPhABCA1 LDLr -/- mice [n=8]) (Fig. 8A). Furthermore, no significant difference was observed in the macrophage content (17.8±5.8% and 17.9±3.1% for EGFP-WT and EGFP-hABCA1 transplanted mice, respectively). However, the collagen content was mildly increased in mice with EGFP-hABCA1 overexpressing bone marrow (14.5±1.4% vs. 1.7±1.1% in controls; p=.56). It has to be noted that the size of the EGFP - established advanced lesions did not significantly differ between EGFP-hABCA1 transplanted mice and controls (624±39x1 3 µm 2 in EGFPhABCA1 LDLr -/- chimeras [n=8] vs. 547±81x1 3 µm 2 in EGFP-WT LDLr -/- mice [n=1]). The size of the newly formed EGFP + lesions on top of the established EGFP - lesions was ~1 times smaller. However, we did find a moderate reduction in the size of these newly formed lesions in the EGFP-hABCA1 transplanted mice as compared to controls (45±4x1 3 µm 2 vs. 57±8x1 3 µm 2 ; p=.6), but the decrease was not sufficient to change the total lesion area. As compared to the established fatty streaks, macrophage infiltration into the established advanced lesions was markedly impaired both in EGFP-hABCA1 transplanted mice and controls. Again, by quantifying the EGFP + F4/8 + donor-derived macrophage area inside the established advanced lesions, a significant reduction was found in EGFPhABCA1 transplanted mice as compared to controls (8.4±1.7x1 3 µm 2 vs. 3.3±.6x1 3 µm 2 ; p<.5), supporting our hypotheses that ABCA1 overexpression in macrophages might reduce infiltration of these macrophages into established lesions (Fig. 8B). A B Lesion area ( 1 3 µm 2 ) pre-existing EGFP-WT N.S. EGFP-hABCA1 Infiltrated macrophage area (x1 3 µm 2 ) EGFP-WT * EGFP-hABCA1 Fig. 8. Effect of macrophage ABCA1 overexpression on atherosclerotic lesion development in LDLr / mice with established advanced lesions. Before transplantation, LDLr / mice were fed on a high-cholesterol Western-type diet (WTD) for 9 weeks, and then transplanted with EGFP-WT or EGFP-hABCA1 bone marrow. Formation of atherosclerotic lesions was determined in EGFP-hABCA1 LDLr / chimeras and EGFP-WT LDLr / controls with pre-existing more advanced lesions after 21 weeks WTD feeding (12 weeks after transplantation). A: The mean lesion area was calculated from Oil-Red-O-stained cross sections of the aortic root at the level of the tricuspid valves. Values represent the mean of 8-1 mice per group. N.S. = non-significant. B: The area of EGFP-positive donor-derived macrophages that have infiltrated inside the established advanced lesions was quantified. *p<.5 vs. EGFP-WT transplanted controls. 71

14 DISCUSSION Studies of human genetic HDL deficiencies and mouse models suggest that ABCA1 and, in particular, macrophage ABCA1 would have a major impact on atherogenesis. 4,5,9,1 ABCA1-dependent cholesterol efflux is one of the crucial factors in the prevention of excessive cholesterol accumulation in macrophages of the arterial wall and their transformation into foam cells. 7,8 Additionally, studies in patients with Tangier disease have suggested a dual function for macrophage ABCA1 in both lipid metabolism and inflammation 22, in line with our previous studies which identified ABCA1 as a leukocyte factor that controls the recruitment of inflammatory cells in mice. 9 In vitro studies also showed that ABCA1 knockout macrophages have an increased response to chemotactic factors. 23 Furthermore, several lines of evidence have suggested a role for ABCA1 in the engulfment of apoptotic cells Hence, in addition to its role in facilitating macrophage RCT, macrophage ABCA1 overexpression might exert anti-inflammatory effects. To study whether increasing ABCA1 would prevent progression or even induce regression of atherosclerosis, we determined atherosclerosis susceptibility of chimeras that specifically overexpress ABCA1 on macrophages, created by transplantation of bone marrow from EGFPhuman ABCA1 double transgenic mice into LDLr / mice with established atherosclerotic lesions. In this study, we show that overexpression of ABCA1 in macrophages inhibits the progression of small atherosclerotic lesions (fatty streaks), which may be due to the functional role of ABCA1 in facilitating macrophage RCT and/or exerting anti-inflammatory effects. This finding is in accordance with our previous studies, which indicated that ABCA1 overexpression does not inhibit initial lesion development, but it does inhibit the progression of the size of fatty streak lesions. 1 Upregulation of macrophage ABCA1 in mice with established advanced lesions, however, did not affect the atherosclerotic lesion maturation. After transplantation, the increase in the size of the established fatty streaks as compared to the established advanced lesions is mainly due to increased vascular macrophage infiltration into the established fatty streaks. Of note, macrophage infiltration into the established advanced fibroatheroma lesions is markedly impaired, as we observed that only a very thin layer of donorderived macrophages on the top of the fibrous cap and only a few macrophages had infiltrated into the pre-existing advanced lesions, even in control transplanted mice (EGFP-WT LDLr -/- ). The observed lower influx of macrophages could be due to the formation of fibrous caps in more advanced lesions, which may directly prevent further macrophage infiltration into these lesions. Alternatively, adhesion of leukocytes to endothelial surface via cell adhesion molecules (CAMS), such as vascular cellular adhesion molecule-1 (VCAM), intercellular cell adhesion molecule-1 (ICAM), P-selectin, and E-selectin, is thought to be pivotal in the initiation of atherosclerosis. 27 Whether endothelial activation via these CAMS will be altered during the progression of atherosclerotic lesions (i.e., from fatty streaks to more advanced lesions), and thus indirectly leads to impaired macrophage infiltration into the pre-existing advanced lesions, still needs to be clarified in our future studies. Therefore, dynamics of macrophage 72

15 Macrophage ABCA1 overexpression does not induce atherosclerosis regression infiltration into the later stages of atherosclerosis has clearly changed as compared to that in small atherosclerotic lesions. It is thus conceivable that up-regulation of macrophage ABCA1 in the later stages of atherosclerosis, in which influx of ABCA1 overexpressing macrophages into the established lesions is extremely low, would not effectively prevent the progression of atherosclerosis. Furthermore, macrophage ABCA1 overexpression did not induce the regression of established lesions either in the early or in the later stages. Apparently, the induced lowering in VLDL/LDL cholesterol levels after BMT (independently of ABCA1), together with the increased expression of ABCA1 in the newly formed lesions is not sufficient to release cholesterol from the established plaques. It must be realized that only the newly infiltrated macrophages do overexpress ABCA1 and thus the pre-existing macrophages, which have already formed the majority of macrophages inside established lesions, are expressing normal levels of ABCA1. A therapeutic strategy to up-regulate ABCA1 in macrophages in atherosclerotic lesions is the pharmacological activation of the liver X receptor (LXR) Recently, systemic administration of a LXR agonist (T91317) was reported to cause atherosclerotic lesion regression in LDLr-/- mice. 32 Furthermore, BMT studies have demonstrated that macrophage LXR activation plays an important role in the process. 32,33 The capability of LXR to induce regression of atherosclerotic lesions may at least in part be due to the fact that LXR can promote macrophage RCT by up-regulating macrophage ABCA1 and ABCG1 that is already expressed in established plaques. 34 In conclusion, macrophage ABCA1 overexpression did not induce regression of established atherosclerotic lesions either in the early or in the later stages. We propose that the dynamics of macrophage infiltration into lesions with different degrees of severity is an important parameter to influence the anti-atherogenic effect of macrophage ABCA1 overexpression on atherosclerosis development. SOURCES OF FUNDING This work was supported by the Chinese Scholarship Council (Scholarship to D.Y.), the Netherlands Organization for Scientific Research (VIDI Grant to M.V.E.), and the Netherlands Heart Foundation (Grants 21T41 to M.V.E.). M. Van Eck is an Established Investigator of the Netherlands Heart Foundation (Grant 27T56). REFERENCES 1. Gordon DJ, Knoke J, Probstfield JL, Superko R, Tyroler HA. High-density lipoprotein cholesterol and coronary heart disease in hypercholesterolemic men: the Lipid Research Clinics Coronary Primary Prevention Trial. Circulation. 1986; 74: Von Eckardstein A, Nofer JR, Assmann G. High density lipoproteins and arteriosclerosis. Role of cholesterol efflux and reverse cholesterol transport. Arterioscler Thromb Vasc Biol. 21; 21:

16 3. Cuchel M, Rader DJ. Macrophage reverse cholesterol transport: key to the regression of atherosclerosis? Circulation. 26; 113: Francis GA, Knopp RH, Oram JF. Defective removal of cellular cholesterol and phospholipids by apolipoprotein A-I in Tangier Disease. J Clin Invest. 1995; 96: Schaefer EJ, Zech LA, Schwartz DE, Brewer HB Jr. Coronary heart disease prevalence and other clinical features in familial high-density lipoprotein deficiency (Tangier disease). Ann Intern Med. 198; 93: McNeish J, Aiello RJ, Guyot D, Turi T, Gabel C, Aldinger C, Hoppe KL, Roach ML, Royer LJ, de Wet J, Broccardo C, Chimini G, Francone OL. High density lipoprotein deficiency and foam cell accumulation in mice with targeted disruption of ATPbinding cassette transporter-1. Proc Natl Acad Sci USA. 2; 97: Vaisman BL, Lambert G, Amar M. ABCA1 overexpression leads to hyperalphalipoproteinemia and increased biliary cholesterol excretion in transgenic mice. J Clin Invest. 21; 18: Joyce CW, Amar MJ, Lambert G. The ATP binding cassette transporter A1 (ABCA1) modulates the development of aortic atherosclerosis in C57BL/6 and apoe-knockout mice. Proc Natl Acad Sci USA. 22; 99: van Eck M, Bos IS, Kaminski WE. Leukocyte ABCA1 controls susceptibility to atherosclerosis and macrophage recruitment into tissues. Proc Natl Acad Sci USA. 22; 99: Van Eck M, Singaraja RR, Ye D, Hildebrand RB, James ER, Hayden MR, Van Berkel TJ. Macrophage ATP-binding cassette transporter A1 overexpression inhibits atherosclerotic lesion progression in low-density lipoprotein receptor knockout mice. Arterioscler Thromb Vasc Biol. 26; 26(4): Daisy Sahoo, Timothy C. Trischuk, Teddy Chan, Victor A.B. Drover, Samuel Ho, Giovanna Chimini, Luis B. Agellon, Ricky Agnihotri, Gordon A. Francis, and Richard Lehner. ABCA1-dependent lipid efflux to apolipoprotein A-I mediates HDL particle formation and decreases VLDL secretion from primary rat and mouse hepatocytes. J Lipid Res. 24; 45(6): Blankenhorn DH and Hodis HN. George Lyman Duff Memorial Lecture: arterial imaging and atherosclerosis reversal. Arterioscler Thromb Vasc Biol. 1994; 14: Stein Y and Stein O. Does therapeutic intervention achieve slowing of progression or bona fide regression of atherosclerotic lesions? Arterioscler Thromb Vasc Biol. 21; 21: Tangirala RK, Tsukamoto K, Chun SH, Usher D, Pure E, Rader DJ. Regression of atherosclerosis induced by liver-directed gene transfer of apolipoprotein A-I in mice. Circulation. 1999; 1: Zhang Y, Zanotti I, Reilly MP, Glick JM, Rothblat GH, Rader DJ. Overexpression of apolipoprotein A-I promotes reverse transport of cholesterol from macrophages to feces in vivo. Circulation. 23; 18: Nissen SE, Tsunoda T, Tuzcu EM, Schoenhagen P, Cooper CJ, Yasin M, Eaton GM, Lauer MA, Sheldon WS, Grines CL, Halpern S, Crowe T, Blankenship JC, Kerensky R. Effect of recombinant ApoA-I Milano on coronary atherosclerosis in patients with acute coronary syndromes: a randomized controlled trial. JAMA. 23; 29: Bortnick AE, Rothblat GH, Stoudt G, Hoppe KL, Royer LJ, McNeish J, Francone OL. The correlation of ABC1 mrna levels with cholesterol efflux from various cell lines. J Biol Chem. 2; 275: Schaefer BC, Schaefer ML, Kappler JW, Marrack P, Kedl RM. Observation of antigen-dependent CD8+ T-cell/ dendritic cell interactions in vivo. Cell Immunol. 21; 214(2): Singaraja RR, Bocher V, James ER, Clee SM, Zhang LH, Leavitt BR, Tan B, Brooks-Wilson A, Kwok A, Bissada N, Yang YZ, Liu G, Tafuri SR, Fievet C, Wellington CL, Staels B, Hayden MR. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and ApoA I-dependent efflux stimulated by an internal promoter containing liver X receptor response elements in intron 1. J Biol Chem : Ross R. Atherosclerosis-an inflammatory disease. N. Engl. J. Med. 1999; 34:

17 Macrophage ABCA1 overexpression does not induce atherosclerosis regression 21. Wolfrum C, Poy MN, Stoffel M. Apolipoprotein M is required for preβ-hdl formation and cholesterol efflux to HDL and protects against atherosclerosis. Nat Med. 25; 11: Schmitz G, Kaminski W E, Porsch-Ozcurumez M, Klucken J, Orsó E, Bodzioch M, Buchler C, Drobnik W. ATP-binding cassette transporter A1 (ABCA1) in macrophages: a dual function in inflammation and lipid metabolism? Pathobiology. 1999; 67: Francone OL, Royer L, Boucher G, Haghpassand M, Freeman A, Brees D, Aiello RJ. Increased cholesterol deposition, expression of scavenger receptors, and response to chemotactic factors in Abca1-deficient macrophages. Arterioscler Thromb Vasc Biol. 25; 25: Hamon Y, Chambenoit O, Chimini G. ABCA1 and the engulfment of apoptotic cells. Biochim Biophys Acta. 22; 1585: Luciani MF, Chimini G. The ATP binding cassette transporter ABC1, is required for the engulfment of corpses generated by apoptotic cell death. EMBO J. 1996; 15: Hamon Y, Broccardo C, Chambenoit O, Luciani MF, Toti F, Chaslin S, Freyssinet JM, Devaux PF, McNeish J, Marguet D, Chimini G. ABC1 promotes engulfment of apoptotic cells and transbilayer redistribution of phosphatidylserine. Nat Cell Biol. 2; 2: Demerath E, Towne B, Blangero J and Siervogel RM. The relationship of soluble ICAM-1, VCAM-1, P-selectin and E-selectin to cardiovascular disease risk factors in healthy men and women. Ann Hum Biol. 21; 28: Costet, P., Luo, Y., Wang, N., and Tall, A. R. Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J. Biol. Chem. 2; 275: Venkateswaran, A., Laffitte, B. A., Joseph, S. B., Mak, P. A., Wilpitz, D. C., Edwards, P. A., and Tontonoz, P. Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR alpha.. Proc. Natl. Acad. Sci. U. S. A. 2; 97: Repa, J. J., Turley, S. D., Lobaccaro, J. A., Medina, J., Li, L., Lustig, K., Shan, B., Heyman, R. A., Dietschy, J. M., and Mangelsdorf, D. J. Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers. Science. 2; 289: Schwartz, K., Lawn, R. M., and Wade, D. P. ABC1 Gene Expression and ApoA-Imediated Cholesterol Efflux are regulated by LXR. Biochem. Biophys. Res. Commun. 2; 274: Levin N, Bisschoff ED, Daige CL. Macrophage liver X receptor is required for antiatherogenic activity of LXR agonists. Arterioscler Thromb Vasc Biol. 25; 25: Tangirala RK, Bischoff ED, Joseph SB, et al. Identification of macrophage liver X receptors as inhibitors of atherosclerosis. Proc Nat Acad Sci USA. 22; 99: Beyea MM, Heslop CL, Sawyez CG, Edwards JY, Markle JG, Hegele RA, Huff MW. Selective up-regulation of LXR-regulated genes ABCA1, ABCG1, and APOE in macrophages through increased endogenous synthesis of 24(S),25- epoxycholesterol. J Biol Chem. 27; 282(8):

18 76