Supplementary Figure 1

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Supplementary Figure 1"

Transcription

1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)! GTT WT-! KO-! min! * (ng/ml) 4! 3! 1! Serum insulin * 0 min 30 min c Liver p-akt Akt Epididymal fat p-akt Akt Muscle p-akt Akt WT Mincle KO Insulin p-akt/akt! (Arbitrary units) p-akt/akt! (Arbitrary units) Insulin (-) (+) (-) (+) 1 8! 6! 4! WT Liver * Muscle KO p-akt/akt! (Arbitrary units) 6! 4! Epididymal fat Insulin (-) (+) (-) (+) WT KO Insulin (-) (+) (-) (+) WT KO Supplementary Figure 1: Phenotypes of Mincle KO and wildtype mice fed a for 16 weeks. (a) Epididymal fat, subcutaneous fat, and liver weights normalized to the whole body weight. Values are mean ± SEM. The data are analyzed by ANOVA followed by Tukey-Kramer test. n = 11 to 13. # P < 0.05, P < 0.01 vs. WT-SD, *P < 0.05, **P < 0.01., not significant. (b) Glucose tolerance tests of Mincle KO and wildtype mice on a. Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 5. *P < 0.05., not significant. (c) Western blotting of Akt (Thr308) phosphorylation in the liver, epididymal fat tissue, and soleus muscle of the Mincle KO and wildtype (0.5 U/kg of body weight). p-akt, phosphorylated Akt; Akt, total Akt. Values are mean ± SEM. The data are analyzed by ANOVA followed by Tukey-Kramer test. n = 4 to 8. *P < 0.05.

2 Supplementary Figure 2 a (g) b d 90! 80! 70! 60! 50! 40! 30! 20! 10! 0! Body weight SD WT- (g) 3.5! 3.0! 2.5! 2.0! 1.5! 1.0! 0.5! 0.0! KO- Epididymal fat Liver 5.0! ** ** 4.0! 3.0! SD WT-SD KO-SD WT- KO- c (ng/ml)! 7! 6! 4! 3! 1! (g) 2.0! 1.0! 0.0! Serum insulin ** SD SD (mg/dl)! Blood glucose SD e Masson's Trichromepositive area (%) * WT KO Supplementary Figure 2: Phenotypes of Mincle KO and wildtype mice fed a or a SD for 50 weeks. (a) Body weight and epididymal fat and liver weights. Values are mean ± SEM. The data are analyzed by ANOVA followed by Tukey-Kramer test. n = 5 to 11. # P < 0.05, P < 0.01 vs. WT-SD, **P < 0.01., not significant. (b) Representative hematoxylin and eosin staining of the liver. Original magnification, 200; Scale bars, 50 µm. (c) Serum insulin and blood glucose concentrations under ad libitum conditions. Values are mean ± SEM. The data are analyzed by ANOVA followed by Tukey-Kramer test. n = 5 to 11. # P < 0.05, P < 0.01 vs. WT-SD, **P < (d,e) Representative Masson s trichrome staining (d) and quantification of the Masson s trichrome-positive area (e) in epididymal fat tissue. Original magnification, 200; Scale bars, 50 µm. Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 5 to 11. *P < 0.05.

3 Supplementary Figure 3 Body weight (g) Epididymal fat weight (g) Liver weight (g) WT! WT! WT! Supplementary Figure 3: Phenotypes of Mincle KO and wildtype mice fed a for 8 weeks. Body weight and epididymal fat and liver weights of Mincle KO and wildtype mice. Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 5., not significant.

4 Supplementary Figure 4 WT- KO- 0.0 Relative islet area/ pancreas area WT- 0.0 KO- KO- 3! 1! WT KO 0.2! 0.1! 0.0! WT KO 2.5! Ki67-positive β cells (%)! WT- 0.3! 4! c WT KO Insuliln-positive area (%) b 0.01! Glucagon-positive area (%) a 2.0! 1.5! 1.0! 0.5! 0.0! WT KO Supplementary Figure 4: Pancreas from Mincle KO and wildtype mice fed a for 16 weeks. (a) Representative hematoxylin and eosin staining. Original magnification, 200; Scale bars, 50 µm. (b) Representative immunofluorescent staining of insulin (red) and glucagon (green). 200; Scale bars, 50 µm. (c) Representative immunofluorescent staining of insulin (red) and Ki67 (green). 400; Scale bars, 50 µm. Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 5.

5 Supplementary Figure 5 mrna levels! (Arbitrary units) # * WT-SD KO-SD WT- KO- 0 Adipoq! Pparg! Fasn! Srebp1-c! Hsl! Pnpla Cpt1a! Supplementary Figure 5: mrna expression in epididymal fat tissue from Mincle KO and wildtype mice fed a for 16 weeks. mrna expression of genes related to adipogenesis, lipogenesis, lipolysis, and β-oxidation in epididymal fat tissue. Values are mean ± SEM. The data are analyzed by ANOVA followed by Tukey-Kramer test. n = 11 to 13. # P < 0.05, P < 0.01 vs. WT-SD, *P < 0.05.

6 Supplementary Figure 6 a CD11b + F4/80 + cells Gr1 + cells B220 + cells CD3 + cells Percentage in SVF (%) Percentage in SVF (%) 1 1 WT! KO! WT! KO! WT! KO! WT! Percentage in SVF (%) Percentage in SVF (%) KO! b Percentage in CD45 + CD11 + F4/80 + cells (%) CD11c + cells WT! KO! Percentage in CD45 + CD11 + F4/80 + cells (%) CD206 + cells WT! KO! Supplementary Figure 6: Flow cytometric analysis of SVF from epididymal tissue of Mincle KO and wildtype mice fed a for 16 weeks. (a) Various immune cells in SVF. (b) M1 (CD11c + ) and M2 (CD206 + ) macrophages in CD45 + CD11b + F4/80 + cells in SVF. Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 5., not significant.

7 Supplementary Figure 7 a Percentage of EGFP + cells in CD45 + cells 10 5 Substitution rate (%) EGFP- BM Mincle KO- BM b mrna levels! (Arbitrary units) 1.5! 1.0! 0.5! 0.0! EGFP- BM Mincle! ** Mincle KO- BM c EGFP-BM- Mincle KO-BM- Masson s Trichromepositive area (%) 1.0! 0.5! 0.0! EGFP- BM Mincle KO- BM Supplementary Figure 7: Analysis of bone marrow chimera mice fed a for 16 weeks. (a) Flow cytometric analysis of the substitution rate for bone marrow cells 4 weeks after the bone marrow transplantation. Bone marrow cells from Egfp Tg mice and Mincle KO-Egfp Tg mice were injected into lethally irradiated wildtype mice (EGFP-BM and Mincle KO-BM, respectively). Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 8. (b) Mincle mrna expression in epididymal fat tissue after 16 weeks of feeding. Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 8. **P < (c) Representative Masson s Trichrome staining and quantification of the Masson s Trichrome-positive area. Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 8.

8 Supplementary Figure 8 Receptor CXCR2 binds ligands CXCL1 to 7! Chemokine receptors bind chemokines! Regulation of protein ISGylation by ISG15 deconjugating enzyme USP18! Collagen type III degradation by MMP1,8,9,13! Immune System! Interferon alpha/beta signaling! Activation of Matrix Metalloproteinases! 1! 3! 4! 6! -log10 P Supplementary Figure 8: Pathway analysis of the clusters using the Reactome database. Peritoneal macrophages from wildtype mice were stimulated with TDM (10 µg/well) for 24 h. n = 3.

9 Supplementary Figure 9 Score 0 (none) Score 1 (weak) Score 2 (mild) Score 3 (moderate) Score 4 (severe) Supplementary Figure 9: Representative histological images for evaluating fibrosis score. Original magnification, 100; Scale bars, 100 µm.

10 Supplementary Figure 10 Fig. 2f Liver! p-akt! Akt! Fig. 2f Epididymal fat! p-akt! Akt! Fig. 2f Soleus muscle! p-akt! Akt! Supplementary Fig. 1c Liver! Insulin (+) p-akt! Insulin (+) Akt! Supplementary Fig. 1c Epididymal fat! Insulin (+) p-akt! Insulin (+) Akt! Supplementary Fig. 1c Soleus muscle! Insulin (+) Insulin (+) p-akt! Akt! Supplementary Figure 10: Full images of Western blots.

11 Supplementary Table 1: DNA microarray analysis using Mincle KO and WT peritoneal macrophages treated with TDM or control for 24 h. WT TDM vs. WT control KO TDM vs. KO control Up Down 77 0

12 Supplementary Table 2: Antibodies, dyes, incubation time, and concentration used in the present study. a. primary antibodies Vendor Collagen type I SouthernBiotech goat polyclonal incubation 1:300, 4, overnight GFP Invitrogen A11122 rabbit polyclonal 1:300, 4, overnight Glucagon Cell signaling #2760 rabbit polyclonal 1:100, 4, overnight Insulin Abcam ab7842 guinea pig polyclonal 1:200, 4, overnight Ki67 Abcam ab15580 rabbit polyclonal 1:100, 4, overnight Perilipin Fitzgerald 20R-PP04 guinea pig polyclonal 1:300, 4, overnight Sigma P1998 rabbit polyclonal 1:300, 4, overnight αsma Abcam ab5694 rabbit polyclonal 1:1000, 4, overnight b. secondary antibodies Vendor Conjugated incubation goat anti-guinea pig Invitrogen AlexaFluor 568 1:200, RT, 1 hr goat anti-rabbit Invitrogen AlexaFluor 488 1:300, RT, 1 hr goat anti-rat Invitrogen AlexaFluor 488 1:200, RT, 1 hr goat anti-rat Invitroge AlexaFluor 594 1:200, RT, 1 hr donkey anti-goat Invitrogen AlexaFluor 568 1:200, RT, 1 hr donkey anti-rabbit Invitrogen AlexaFluor 647 1:200, RT, 1 hr donkey anti-rat Invitrogen AlexaFluor 488 1:200, RT, 1 hr c. dye Vendor incubation Hoechst Invitrogen 20 µm, RT, 15 mins

13 Supplementary Table 3: Antibodies used in flow cytometric analyses. Vendor Clone Conjugated CD3 BioLegend 17A2 PE CD11b ebioscience M1/70 FITC, PE/Cy7 CD11c BD Biosciences HL3 PE, V450 CD19 BioLegend 6D5 PE/Cy7 CD45 BD Biosciences 30-F11 APC/Cy7 CD45R/B220 BioLegend RA3-6B2 APC, APC/Cy7 CD94 BioLegend 18d3 FITC CD205 (DEC-205) BioLegend NLDC-145 PE/Cy7 CD206 (MMR) BioLegend C068C2 APC CD244.2 BioLegend m2b4 (B6)458.1 Alexa 647 F4/80 Caltag BM8 R-PE BioLegend BM8 APC Gr-1 BD Biosciences RB6-8C5 PE

14 Supplementary Table 4: Primers used to detect mrnas. Acta2 Fw GTTCAGTGGTGCCTCTGTCA Rv ACTGGGACGACATGGAAAAG Adipoq Fw ATGGCAGAGATGGCACTCCT Rv CCTTCAGCTCCTGTCATTCCA Ccl2 Fw CCACTCACCTGCTGCTACTCAT Rv TGGTGATCCTCTTGTAGCTCTCC CD3e Fw AACACGTACTTGTACCTGAAAGC Rv GATGATTATGGCTACTGCTGTCA CD19 Fw TTCTGCCCCAAGCCACAGCTTTAGA Rv CTGGCCAGAGGTAAGATGTAGGAAGG Col1a1 Fw CCTCAGGGTATTGCTGGACAAC Rv ACCACTTGATCCAGAAGGACCTT Col3a1 Fw TAGAGGATGGCTGTACTAAACACA Rv CAAAGACTGTCTTGCTCCATTCC Cpt1a Fw CCTGCATTCCTTCCCATTTG Rv TGCCCATGTCCTTGTAATGTG Cxcl2 Fw GCTTCCTCGGGCACTCCAGAC Rv TTAGCCTTGCCTTTGTTCAGTAT Emr1 Fw CTTGGCTATGGGCTTCCAGTC Rv GCAAGGAGGACAGAGTTTATCGTG Fasn Fw CCTGGATAGCATTCCGAACCT Rv AGCACATCTCGAAGGCTACACA Hsl Fw GGCTTACTGGGCACAGATACCT Rv CTGAAGGCTCTGAGTTGCTCAA Itgax Fw GCCATTGAGGGCACAGAGA Rv GAAGCCCTCCTGGGACATCT Mincle Fw ACCAAATCGCCTGCATCC Rv CACTTGGGAGTTTTTGAAGCATC Mrc1 Fw CGGTGAACCAAATAATTACCAAAAT Rv GTGGAGCAGGTGTGGGCT Pdgfb Fw CCATCCGCTCCTTTGATGAT Rv TCAGCCCCATCTTCATCTACG Pnpla2 Fw ACTGTGGCCTCATTCCTCC Rv AACTGGATGCTGGTGTTGGT Pparg Fw ACAATGCCATCAGGTTTGGG Rv CCGCCAACAGCTTCTCCTT

15 Srebp1-c Fw GGCACTAAGTGCCCTCAACCT Rv GCCACATAGATCTCTGCCAGTGT Tgfb1 Fw CCTGAGTGGCTGTCTTTTGACG Rv AGTGAGCGCTGAATCGAAAGC Timp1 Fw CATCACGGGCCGCCTA Rv AAGCTGCAGGCACTGATGTG Tnfa Fw ACCCTCACACTCAGATCATCTTC Rv TGGTGGTTTGCTACGACGT 36B4 Fw GGCCCTGCACTCTCGCTTTC Rv TGCCAGGACGCGCTTGT

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma

Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Immunity Supplemental Information Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Brian D. Hondowicz, Dowon An, Jason M. Schenkel, Karen S. Kim, Holly R. Steach, Akshay

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S.

This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S. This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S., Weiss, S. Neutrophils responsive to endogenous IFN-β

More information

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance Cell Metabolism, Volume 25 Supplemental Information b Cell Aging Markers Have Heterogeneous Distribution and Are Induced by Insulin Resistance Cristina Aguayo-Mazzucato, Mark van Haaren, Magdalena Mruk,

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Fisher et al. Supplemental Figure 1

Fisher et al. Supplemental Figure 1 Supplemental Figure 1 A TNF IL-1 IL-6 CCL2 CCL5 CXCL10 pg/mg total protein 50 30 10 4,000 3,000 2,000 1,000 n.d. 1 1 14,000 12,000 10,000 8,000 6,000 4,000 2,000 6,000,000 CT26 5,000 16,000 B16 4,000 12,000

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1

More information

SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression

SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression Received 1 Feb 215 Accepted 15 Oct 215 Published 24 Nov 215 DOI: 1.138/ncomms9917 SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression Lan Shao

More information

AMPK Activation by Metformin Suppresses Abnormal Extracellular Matrix Remodeling in Adipose Tissue and Ameliorates Insulin Resistance in Obesity

AMPK Activation by Metformin Suppresses Abnormal Extracellular Matrix Remodeling in Adipose Tissue and Ameliorates Insulin Resistance in Obesity Diabetes Volume 65, August 2016 2295 Ting Luo, 1,2 Allison Nocon, 1 Jessica Fry, 1 Alex Sherban, 1 Xianliang Rui, 1 Bingbing Jiang, 1 X. Julia Xu, 1 Jingyan Han, 1 Yun Yan, 3 Qin Yang, 4 Qifu Li, 2 and

More information

Supporting Information

Supporting Information Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells

More information

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen, Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance ORIGINAL ARTICLE Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance Yoshinaga Kawano, 1 Jun Nakae, 1 Nobuyuki Watanabe, 2 Shiho Fujisaka, 3

More information

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3

Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3 Yu et al: Rosuvastatin reduces aortic sinus and coronary artery atherosclerosis in SR-B1/apoE dko mice. Supplementary Tale i: Primers used for RT-PCR. References are provided under Source, except for primers

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung Transplant Function via Depletion of Donor Dendritic Cells Wolfgang Jungraithmayr, Laura Codarri, Gregory Bouchaud,Carsten Krieg,

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Research article MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Hajime Kanda, 1 Sanshiro Tateya, 1 Yoshikazu Tamori, 1 Ko Kotani,

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding

More information

TLR2- and Dectin 1 Associated Innate Immune Response Modulates T-Cell Response to Pancreatic b-cell Antigen and Prevents Type 1 Diabetes

TLR2- and Dectin 1 Associated Innate Immune Response Modulates T-Cell Response to Pancreatic b-cell Antigen and Prevents Type 1 Diabetes Diabetes Volume 64, April 2015 1341 Subha Karumuthil-Melethil, 1 M. Hanief Sofi, 2 Radhika Gudi, 3 Benjamin M. Johnson, 2 Nicolas Perez, 1 and Chenthamarakshan Vasu 2,3 TLR2- and Dectin 1 Associated Innate

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego

The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,

More information

Antibiotic effects on gut microbiota and metabolism are host dependent

Antibiotic effects on gut microbiota and metabolism are host dependent Antibiotic effects on gut microbiota and metabolism are host dependent Shiho Fujisaka, 1 Siegfried Ussar, 1,2 Clary Clish, 3 Suzanne Devkota, 4 Jonathan M. Dreyfuss, 5,6 Masaji Sakaguchi, 1 Marion Soto,

More information

Gladstone Institute of Cardiovascular Disease, San Francisco, California. 2 Diabetes Center, 3 Cardiovascular Research Institute, and 4

Gladstone Institute of Cardiovascular Disease, San Francisco, California. 2 Diabetes Center, 3 Cardiovascular Research Institute, and 4 Suneil K. Koliwad, 1,2,3,4 Ryan S. Streeper, 1 Mara Monetti, 1 Ivo Cornelissen, 3 Liana Chan, 1 Koji Terayama, 5 Stephen Naylor, 6 Meghana Rao, 1 Brian Hubbard, 7 and Robert V. Farese Jr. 1,2,3,4,8 1 Gladstone

More information

Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells

Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells Immunity, Volume 4 Supplemental Information Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells Steven J. Van Dyken, Alexander Mohapatra,

More information

Human tumors instigate granulin-expressing hematopoietic cells that promote malignancy by activating stromal fibroblasts in mice

Human tumors instigate granulin-expressing hematopoietic cells that promote malignancy by activating stromal fibroblasts in mice Human tumors instigate granulin-expressing hematopoietic cells that promote malignancy by activating stromal fibroblasts in mice Elkabets, Moshe; Gifford, Ann M.; Scheel, Christina; Nilsson, Bjorn; Reinhardt,

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

FAPESP Week /21/2017

FAPESP Week /21/2017 Texas Tech University Dr Naima Moustaid-Moussa Texas Tech University FAPESP Week 2017 09/21/2017 University of Sao Paulo Dr Sonia Jancar ICB-USP Theresa Ramalho MS PhD candidate, Immunology ICB-USP Dr

More information

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.) Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor

More information

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice SUPPLEMENTAL METHODS T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice Florian Wiede 1, Benjamin J. Shields 1, Sock Hui Chew 1, Konstantinos Kyparissoudis 2,

More information

Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway

Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway Roger J. Davis Metabolic Stress Signaling by the JNK Pathway Age-adjusted Percentage of U.S. Adults with Diagnosed Diabetes or Obesity Diabetes 1994 2000 2007 Obesity (BMI 30 kg/m 2 )

More information

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Probe. Hind III Q,!&#12?R'!! /0!!!!D1?R'! vector. Homologous recombination Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!&#1?R'!!

More information

Supplementary Material

Supplementary Material Supplementary Material Induction of myocardial infarction Mice were anesthetized by intraperitoneal injection of pentobarbital (7 mg/kg). In the supine position, endotracheal intubation was performed.

More information

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa

More information

Understanding Root Cause: Pathogenesis of Hepatic Fibrosis

Understanding Root Cause: Pathogenesis of Hepatic Fibrosis 10/1/12 Understanding Root Cause: Pathogenesis of Hepatic Fibrosis Hepatitis C Virus Mild inflammation Inflammation Fibrosis Cirrhosis 1 10/1/12 Non-alcoholic Fatty Liver Disease Steatosis Steatohepatitis

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Thrombin promotes diet-induced obesity through fibrin-driven inflammation

Thrombin promotes diet-induced obesity through fibrin-driven inflammation Thrombin promotes diet-induced obesity through fibrin-driven inflammation Anna K. Kopec, 1 Sara R. Abrahams, 2 Sherry Thornton, 3 Joseph S. Palumbo, 4 Eric S. Mullins, 4 Senad Divanovic, 5 Hartmut Weiler,

More information

Metabolic Disease drug discovery at Evotec

Metabolic Disease drug discovery at Evotec Metabolic Disease drug discovery at Evotec Evotec, Metabolic Disease Drug Discovery, 2016 Evotec, an ideal partner in metabolic disease drug discovery The different ways to work with us On your specific

More information

Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation

Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation Research article Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation C. Andrew Stewart, 1 Hannah Metheny, 1 Noriho Iida, 1 Loretta Smith, 1 Miranda Hanson, 1 Folkert Steinhagen,

More information

Tumor cell-activated CARD9 signaling contributes to metastasis-associated macrophage polarization

Tumor cell-activated CARD9 signaling contributes to metastasis-associated macrophage polarization (2014) 21, 1290 1302 & 2014 Macmillan Publishers Limited All rights reserved 1350-9047/14 www.nature.com/cdd Tumor cell-activated CARD9 signaling contributes to metastasis-associated macrophage polarization

More information

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP-16-42496-T) Marianna Sciortino 1, Maria del Pilar Camacho Leal 1, Francesca Orso 1, Elena Grassi 1,

More information

Reporting Checklist for Nature Neuroscience

Reporting Checklist for Nature Neuroscience Corresponding Author: Manuscript Number: Manuscript Type: Alex Pouget NN-A46249B Article Reporting Checklist for Nature Neuroscience # Main Figures: 7 # Supplementary Figures: 3 # Supplementary Tables:

More information

Hsp90 regulation of fibroblast activation in pulmonary fibrosis

Hsp90 regulation of fibroblast activation in pulmonary fibrosis Downloaded from http:// on January 22, 2018. Hsp90 regulation of fibroblast activation in pulmonary fibrosis Vishwaraj Sontake, 1,4 Yunguan Wang, 2 Rajesh K. Kasam, 1,4 Debora Sinner, 3 Geereddy B. Reddy,

More information

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal

More information

Title Modified Western blotting for insulin and other diabetes-associated peptide hormones

Title Modified Western blotting for insulin and other diabetes-associated peptide hormones Supplemental Figures Title Modified Western blotting for insulin and other diabetes-associated peptide hormones Authors Naoyuki Okita, Yoshikazu Higami, Fumio Fukai, Masaki Kobayashi, Miku Mitarai, Takao

More information

Dioscin Exerts Protective Effects Against Crystalline Silica-induced Pulmonary Fibrosis in Mice

Dioscin Exerts Protective Effects Against Crystalline Silica-induced Pulmonary Fibrosis in Mice Ivyspring International Publisher 4255 Theranostics Research Paper 2017; 7(17): 4255-4275. doi: 10.7150/thno.20270 Dioscin Exerts Protective Effects Against Crystalline Silica-induced Pulmonary Fibrosis

More information

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Research article Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Gabriela Schiechl, 1 Bernhard Bauer, 1 Ivan Fuss, 2 Sven A.

More information

Topical nanocrystalline silver cream inhibits expression of matrix metalloproteinase-9 in animal models of allergic contact dermatitis.

Topical nanocrystalline silver cream inhibits expression of matrix metalloproteinase-9 in animal models of allergic contact dermatitis. Topical nanocrystalline silver cream inhibits expression of matrix metalloproteinase-9 in animal models of allergic contact dermatitis. K C Bhol, P J Schechter NUCRYST Pharmaceuticals Inc, Wakefield, MA

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Central insulin action regulates peripheral glucose and fat metabolism in mice

Central insulin action regulates peripheral glucose and fat metabolism in mice Research article Central insulin action regulates peripheral glucose and fat metabolism in mice Linda Koch, 1 F. Thomas Wunderlich, 1 Jost Seibler, 2 A. Christine Könner, 1 Brigitte Hampel, 1 Sigrid Irlenbusch,

More information

PKN2 in colon cancer cells inhibits M2 phenotype polarization of tumor-associated macrophages via regulating DUSP6-Erk1/2 pathway

PKN2 in colon cancer cells inhibits M2 phenotype polarization of tumor-associated macrophages via regulating DUSP6-Erk1/2 pathway Cheng et al. Molecular Cancer (2018) 17:13 DOI 10.1186/s12943-017-0747-z RESEARCH Open Access PKN2 in colon cancer cells inhibits M2 phenotype polarization of tumor-associated macrophages via regulating

More information

Desnutrin/ATGL Activates PPARd to Promote Mitochondrial Function for Insulin Secretion in Islet b Cells

Desnutrin/ATGL Activates PPARd to Promote Mitochondrial Function for Insulin Secretion in Islet b Cells Article Desnutrin/ATGL Activates PPARd to Promote Mitochondrial Function for Insulin Secretion in Islet b Cells Tianyi Tang,,3 Marcia J. Abbott,,3 Maryam Ahmadian,,5 Andressa B. Lopes,,4 Yuhui Wang, and

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

SUPPLEMENTARY MATERIALS

SUPPLEMENTARY MATERIALS SUPPLEMENTARY MATERIALS Supplementary Methods Reverse transcription/quantitative-pcr (RT/qPCR) The Efnb1, Efnb2 Efnb3, Ephb1, Ephb2, Ephb3, Ephb4, Ephb6, and ɑ1-adrenoreceptor and inos mrna levels in VSMCs

More information

Differential Response of Respiratory Dendritic Cell Subsets to Influenza Virus Infection

Differential Response of Respiratory Dendritic Cell Subsets to Influenza Virus Infection JOURNAL OF VIROLOGY, May 2008, p. 4908 4919 Vol. 82, No. 10 0022-538X/08/$08.00 0 doi:10.1128/jvi.02367-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Differential Response

More information

Supplemental Information. Dual Function of p38α MAPK in Colon Cancer: Suppression of Colitis-Associated Tumor Initiation

Supplemental Information. Dual Function of p38α MAPK in Colon Cancer: Suppression of Colitis-Associated Tumor Initiation Cancer Cell, Volume 25 Supplemental Information Dual Function of p38α MAPK in Colon Cancer: Suppression of Colitis-Associated Tumor Initiation but Requirement for Cancer Cell Survival Jalaj Gupta, Ivan

More information

Clinical question. Screening tube. Diagnostic panel MRD. Clinical question

Clinical question. Screening tube. Diagnostic panel MRD. Clinical question OW CYTOMETRY UPDATES IN LYMPHOPROLIFERATIVE DISORDERS CANCER RESEARCH CENTER IBSAL UNIVERSITY & UNIVERSITY HOSPITAL, SALAMANCA (SPAIN) DISCLOSURES The EuroFlow Scientific Consortium Iamco-chairof receives

More information

Small Molecule Inhibitor of the Wnt Pathway (SM04755) as a Potential Topical Scleroderma Treatment

Small Molecule Inhibitor of the Wnt Pathway (SM04755) as a Potential Topical Scleroderma Treatment Small Molecule Inhibitor of the Wnt Pathway (SM755) as a Potential Topical Scleroderma Treatment Vishal Deshmukh, PhD, Allison Hood, Yusuf Yazici, MD Disclosures Vishal Deshmukh, Ph.D. o Financial disclosure:

More information

Acidic extracellular ph of tumors induces octamerbinding transcription factor 4 expression in murine fibroblasts in vitro and in vivo

Acidic extracellular ph of tumors induces octamerbinding transcription factor 4 expression in murine fibroblasts in vitro and in vivo Washington University School of Medicine Digital Commons@Becker Open Access Publications 2016 Acidic extracellular ph of tumors induces octamerbinding transcription factor 4 expression in murine fibroblasts

More information

Endothelial Tube Formation Assay (In Vitro Angiogenesis)

Endothelial Tube Formation Assay (In Vitro Angiogenesis) Product Manual Endothelial Tube Formation Assay (In Vitro Angiogenesis) Catalog Number CBA-200 50 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Angiogenesis, or neovascularization,

More information

The Beneficial Effects of n-3 Polyunsaturated Fatty Acids on Diet Induced Obesity and Impaired Glucose Control Do Not Require Gpr120

The Beneficial Effects of n-3 Polyunsaturated Fatty Acids on Diet Induced Obesity and Impaired Glucose Control Do Not Require Gpr120 RESEARCH ARTICLE The Beneficial Effects of n-3 Polyunsaturated Fatty Acids on Diet Induced Obesity and Impaired Glucose Control Do Not Require Gpr120 Mikael Bjursell 1 *, Xiufeng Xu 1, Therése Admyre 1,

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,

More information

APOLs with low ph dependence can kill all African trypanosomes

APOLs with low ph dependence can kill all African trypanosomes SUPPLEMENTARY INFORMATION Letters DOI: 1.138/s41564-17-34-1 In the format provided by the authors and unedited. APOLs with low ph dependence can kill all African trypanosomes Frédéric Fontaine 1, Laurence

More information