Supplementary Figure 1

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Supplementary Figure 1"

Transcription

1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)! GTT WT-! KO-! min! * (ng/ml) 4! 3! 1! Serum insulin * 0 min 30 min c Liver p-akt Akt Epididymal fat p-akt Akt Muscle p-akt Akt WT Mincle KO Insulin p-akt/akt! (Arbitrary units) p-akt/akt! (Arbitrary units) Insulin (-) (+) (-) (+) 1 8! 6! 4! WT Liver * Muscle KO p-akt/akt! (Arbitrary units) 6! 4! Epididymal fat Insulin (-) (+) (-) (+) WT KO Insulin (-) (+) (-) (+) WT KO Supplementary Figure 1: Phenotypes of Mincle KO and wildtype mice fed a for 16 weeks. (a) Epididymal fat, subcutaneous fat, and liver weights normalized to the whole body weight. Values are mean ± SEM. The data are analyzed by ANOVA followed by Tukey-Kramer test. n = 11 to 13. # P < 0.05, P < 0.01 vs. WT-SD, *P < 0.05, **P < 0.01., not significant. (b) Glucose tolerance tests of Mincle KO and wildtype mice on a. Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 5. *P < 0.05., not significant. (c) Western blotting of Akt (Thr308) phosphorylation in the liver, epididymal fat tissue, and soleus muscle of the Mincle KO and wildtype (0.5 U/kg of body weight). p-akt, phosphorylated Akt; Akt, total Akt. Values are mean ± SEM. The data are analyzed by ANOVA followed by Tukey-Kramer test. n = 4 to 8. *P < 0.05.

2 Supplementary Figure 2 a (g) b d 90! 80! 70! 60! 50! 40! 30! 20! 10! 0! Body weight SD WT- (g) 3.5! 3.0! 2.5! 2.0! 1.5! 1.0! 0.5! 0.0! KO- Epididymal fat Liver 5.0! ** ** 4.0! 3.0! SD WT-SD KO-SD WT- KO- c (ng/ml)! 7! 6! 4! 3! 1! (g) 2.0! 1.0! 0.0! Serum insulin ** SD SD (mg/dl)! Blood glucose SD e Masson's Trichromepositive area (%) * WT KO Supplementary Figure 2: Phenotypes of Mincle KO and wildtype mice fed a or a SD for 50 weeks. (a) Body weight and epididymal fat and liver weights. Values are mean ± SEM. The data are analyzed by ANOVA followed by Tukey-Kramer test. n = 5 to 11. # P < 0.05, P < 0.01 vs. WT-SD, **P < 0.01., not significant. (b) Representative hematoxylin and eosin staining of the liver. Original magnification, 200; Scale bars, 50 µm. (c) Serum insulin and blood glucose concentrations under ad libitum conditions. Values are mean ± SEM. The data are analyzed by ANOVA followed by Tukey-Kramer test. n = 5 to 11. # P < 0.05, P < 0.01 vs. WT-SD, **P < (d,e) Representative Masson s trichrome staining (d) and quantification of the Masson s trichrome-positive area (e) in epididymal fat tissue. Original magnification, 200; Scale bars, 50 µm. Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 5 to 11. *P < 0.05.

3 Supplementary Figure 3 Body weight (g) Epididymal fat weight (g) Liver weight (g) WT! WT! WT! Supplementary Figure 3: Phenotypes of Mincle KO and wildtype mice fed a for 8 weeks. Body weight and epididymal fat and liver weights of Mincle KO and wildtype mice. Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 5., not significant.

4 Supplementary Figure 4 WT- KO- 0.0 Relative islet area/ pancreas area WT- 0.0 KO- KO- 3! 1! WT KO 0.2! 0.1! 0.0! WT KO 2.5! Ki67-positive β cells (%)! WT- 0.3! 4! c WT KO Insuliln-positive area (%) b 0.01! Glucagon-positive area (%) a 2.0! 1.5! 1.0! 0.5! 0.0! WT KO Supplementary Figure 4: Pancreas from Mincle KO and wildtype mice fed a for 16 weeks. (a) Representative hematoxylin and eosin staining. Original magnification, 200; Scale bars, 50 µm. (b) Representative immunofluorescent staining of insulin (red) and glucagon (green). 200; Scale bars, 50 µm. (c) Representative immunofluorescent staining of insulin (red) and Ki67 (green). 400; Scale bars, 50 µm. Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 5.

5 Supplementary Figure 5 mrna levels! (Arbitrary units) # * WT-SD KO-SD WT- KO- 0 Adipoq! Pparg! Fasn! Srebp1-c! Hsl! Pnpla Cpt1a! Supplementary Figure 5: mrna expression in epididymal fat tissue from Mincle KO and wildtype mice fed a for 16 weeks. mrna expression of genes related to adipogenesis, lipogenesis, lipolysis, and β-oxidation in epididymal fat tissue. Values are mean ± SEM. The data are analyzed by ANOVA followed by Tukey-Kramer test. n = 11 to 13. # P < 0.05, P < 0.01 vs. WT-SD, *P < 0.05.

6 Supplementary Figure 6 a CD11b + F4/80 + cells Gr1 + cells B220 + cells CD3 + cells Percentage in SVF (%) Percentage in SVF (%) 1 1 WT! KO! WT! KO! WT! KO! WT! Percentage in SVF (%) Percentage in SVF (%) KO! b Percentage in CD45 + CD11 + F4/80 + cells (%) CD11c + cells WT! KO! Percentage in CD45 + CD11 + F4/80 + cells (%) CD206 + cells WT! KO! Supplementary Figure 6: Flow cytometric analysis of SVF from epididymal tissue of Mincle KO and wildtype mice fed a for 16 weeks. (a) Various immune cells in SVF. (b) M1 (CD11c + ) and M2 (CD206 + ) macrophages in CD45 + CD11b + F4/80 + cells in SVF. Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 5., not significant.

7 Supplementary Figure 7 a Percentage of EGFP + cells in CD45 + cells 10 5 Substitution rate (%) EGFP- BM Mincle KO- BM b mrna levels! (Arbitrary units) 1.5! 1.0! 0.5! 0.0! EGFP- BM Mincle! ** Mincle KO- BM c EGFP-BM- Mincle KO-BM- Masson s Trichromepositive area (%) 1.0! 0.5! 0.0! EGFP- BM Mincle KO- BM Supplementary Figure 7: Analysis of bone marrow chimera mice fed a for 16 weeks. (a) Flow cytometric analysis of the substitution rate for bone marrow cells 4 weeks after the bone marrow transplantation. Bone marrow cells from Egfp Tg mice and Mincle KO-Egfp Tg mice were injected into lethally irradiated wildtype mice (EGFP-BM and Mincle KO-BM, respectively). Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 8. (b) Mincle mrna expression in epididymal fat tissue after 16 weeks of feeding. Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 8. **P < (c) Representative Masson s Trichrome staining and quantification of the Masson s Trichrome-positive area. Values are mean ± SEM. The data are analyzed by unpaired t-test. n = 8.

8 Supplementary Figure 8 Receptor CXCR2 binds ligands CXCL1 to 7! Chemokine receptors bind chemokines! Regulation of protein ISGylation by ISG15 deconjugating enzyme USP18! Collagen type III degradation by MMP1,8,9,13! Immune System! Interferon alpha/beta signaling! Activation of Matrix Metalloproteinases! 1! 3! 4! 6! -log10 P Supplementary Figure 8: Pathway analysis of the clusters using the Reactome database. Peritoneal macrophages from wildtype mice were stimulated with TDM (10 µg/well) for 24 h. n = 3.

9 Supplementary Figure 9 Score 0 (none) Score 1 (weak) Score 2 (mild) Score 3 (moderate) Score 4 (severe) Supplementary Figure 9: Representative histological images for evaluating fibrosis score. Original magnification, 100; Scale bars, 100 µm.

10 Supplementary Figure 10 Fig. 2f Liver! p-akt! Akt! Fig. 2f Epididymal fat! p-akt! Akt! Fig. 2f Soleus muscle! p-akt! Akt! Supplementary Fig. 1c Liver! Insulin (+) p-akt! Insulin (+) Akt! Supplementary Fig. 1c Epididymal fat! Insulin (+) p-akt! Insulin (+) Akt! Supplementary Fig. 1c Soleus muscle! Insulin (+) Insulin (+) p-akt! Akt! Supplementary Figure 10: Full images of Western blots.

11 Supplementary Table 1: DNA microarray analysis using Mincle KO and WT peritoneal macrophages treated with TDM or control for 24 h. WT TDM vs. WT control KO TDM vs. KO control Up Down 77 0

12 Supplementary Table 2: Antibodies, dyes, incubation time, and concentration used in the present study. a. primary antibodies Vendor Collagen type I SouthernBiotech goat polyclonal incubation 1:300, 4, overnight GFP Invitrogen A11122 rabbit polyclonal 1:300, 4, overnight Glucagon Cell signaling #2760 rabbit polyclonal 1:100, 4, overnight Insulin Abcam ab7842 guinea pig polyclonal 1:200, 4, overnight Ki67 Abcam ab15580 rabbit polyclonal 1:100, 4, overnight Perilipin Fitzgerald 20R-PP04 guinea pig polyclonal 1:300, 4, overnight Sigma P1998 rabbit polyclonal 1:300, 4, overnight αsma Abcam ab5694 rabbit polyclonal 1:1000, 4, overnight b. secondary antibodies Vendor Conjugated incubation goat anti-guinea pig Invitrogen AlexaFluor 568 1:200, RT, 1 hr goat anti-rabbit Invitrogen AlexaFluor 488 1:300, RT, 1 hr goat anti-rat Invitrogen AlexaFluor 488 1:200, RT, 1 hr goat anti-rat Invitroge AlexaFluor 594 1:200, RT, 1 hr donkey anti-goat Invitrogen AlexaFluor 568 1:200, RT, 1 hr donkey anti-rabbit Invitrogen AlexaFluor 647 1:200, RT, 1 hr donkey anti-rat Invitrogen AlexaFluor 488 1:200, RT, 1 hr c. dye Vendor incubation Hoechst Invitrogen 20 µm, RT, 15 mins

13 Supplementary Table 3: Antibodies used in flow cytometric analyses. Vendor Clone Conjugated CD3 BioLegend 17A2 PE CD11b ebioscience M1/70 FITC, PE/Cy7 CD11c BD Biosciences HL3 PE, V450 CD19 BioLegend 6D5 PE/Cy7 CD45 BD Biosciences 30-F11 APC/Cy7 CD45R/B220 BioLegend RA3-6B2 APC, APC/Cy7 CD94 BioLegend 18d3 FITC CD205 (DEC-205) BioLegend NLDC-145 PE/Cy7 CD206 (MMR) BioLegend C068C2 APC CD244.2 BioLegend m2b4 (B6)458.1 Alexa 647 F4/80 Caltag BM8 R-PE BioLegend BM8 APC Gr-1 BD Biosciences RB6-8C5 PE

14 Supplementary Table 4: Primers used to detect mrnas. Acta2 Fw GTTCAGTGGTGCCTCTGTCA Rv ACTGGGACGACATGGAAAAG Adipoq Fw ATGGCAGAGATGGCACTCCT Rv CCTTCAGCTCCTGTCATTCCA Ccl2 Fw CCACTCACCTGCTGCTACTCAT Rv TGGTGATCCTCTTGTAGCTCTCC CD3e Fw AACACGTACTTGTACCTGAAAGC Rv GATGATTATGGCTACTGCTGTCA CD19 Fw TTCTGCCCCAAGCCACAGCTTTAGA Rv CTGGCCAGAGGTAAGATGTAGGAAGG Col1a1 Fw CCTCAGGGTATTGCTGGACAAC Rv ACCACTTGATCCAGAAGGACCTT Col3a1 Fw TAGAGGATGGCTGTACTAAACACA Rv CAAAGACTGTCTTGCTCCATTCC Cpt1a Fw CCTGCATTCCTTCCCATTTG Rv TGCCCATGTCCTTGTAATGTG Cxcl2 Fw GCTTCCTCGGGCACTCCAGAC Rv TTAGCCTTGCCTTTGTTCAGTAT Emr1 Fw CTTGGCTATGGGCTTCCAGTC Rv GCAAGGAGGACAGAGTTTATCGTG Fasn Fw CCTGGATAGCATTCCGAACCT Rv AGCACATCTCGAAGGCTACACA Hsl Fw GGCTTACTGGGCACAGATACCT Rv CTGAAGGCTCTGAGTTGCTCAA Itgax Fw GCCATTGAGGGCACAGAGA Rv GAAGCCCTCCTGGGACATCT Mincle Fw ACCAAATCGCCTGCATCC Rv CACTTGGGAGTTTTTGAAGCATC Mrc1 Fw CGGTGAACCAAATAATTACCAAAAT Rv GTGGAGCAGGTGTGGGCT Pdgfb Fw CCATCCGCTCCTTTGATGAT Rv TCAGCCCCATCTTCATCTACG Pnpla2 Fw ACTGTGGCCTCATTCCTCC Rv AACTGGATGCTGGTGTTGGT Pparg Fw ACAATGCCATCAGGTTTGGG Rv CCGCCAACAGCTTCTCCTT

15 Srebp1-c Fw GGCACTAAGTGCCCTCAACCT Rv GCCACATAGATCTCTGCCAGTGT Tgfb1 Fw CCTGAGTGGCTGTCTTTTGACG Rv AGTGAGCGCTGAATCGAAAGC Timp1 Fw CATCACGGGCCGCCTA Rv AAGCTGCAGGCACTGATGTG Tnfa Fw ACCCTCACACTCAGATCATCTTC Rv TGGTGGTTTGCTACGACGT 36B4 Fw GGCCCTGCACTCTCGCTTTC Rv TGCCAGGACGCGCTTGT

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

Title. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL)

Title. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL) Title Toll-like receptor 3 signal augments radiation-induc Yoshida, Sumito; Shime, Hiroaki; Takeda, Yohei; Nam, Author(s) Hiroki; Kasahara, Masanori; Seya, Tsukasa CitationCancer science, 19(): 956-965

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Table 1. Primer sequences for transcript analysis Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD) SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence. Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION -. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17

More information

Alternatively Activated Macrophages Determine the Repair of the Infarcted

Alternatively Activated Macrophages Determine the Repair of the Infarcted Alternatively Activated Macrophages Determine the Repair of the Infarcted Adult Murine Heart (Shiraishi et al.) List of Supplemental Materials Supplemental Methods Supplemental Figure 1. Cardiac CD206

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly, 1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of

More information

Pathologic Stage. Lymph node Stage

Pathologic Stage. Lymph node Stage ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)

More information

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow diet (n = 7 per genotype). Body weight and fed blood glucose

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study

Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study Antigen Species Clone Source Dilution Insulin Guinea pig - Dako, Carpinteria, 1:200 Glucagon Rabbit - Dako, Carpinteria,

More information

Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E

Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance

More information

Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained

Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained 1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in

Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in 9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade

More information

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/- Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80 a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2

More information

We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan

We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan Supplementary Methods Animal models We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan or Jackson Laboratories. All mice were housed under a 12-h light-dark cycle and allowed

More information

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β

More information

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Pleiotrophin Regulates the Expansion and Regeneration of Hematopoietic Stem Cells Heather A Himburg 1, Garrett G Muramoto 1 *, Pamela Daher 1*, Sarah K Meadows 1, J. Lauren Russell

More information

SUPPORTING INFORMATIONS

SUPPORTING INFORMATIONS SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor

More information

Supplemental Data. Epithelial-Macrophage Interactions Determine Pulmonary Fibrosis Susceptibility in. Hermansky-Pudlak Syndrome

Supplemental Data. Epithelial-Macrophage Interactions Determine Pulmonary Fibrosis Susceptibility in. Hermansky-Pudlak Syndrome Page 1 Supplemental Data Epithelial-Macrophage Interactions Determine Pulmonary Fibrosis Susceptibility in Hermansky-Pudlak Syndrome Lisa R. Young, Peter M. Gulleman, Chelsi W. Short, Harikrishna Tanjore,

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,

More information

Supplementary Figures

Supplementary Figures Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined

More information

Supplementary Materials

Supplementary Materials Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

More information

Mitosis. Single Nano Micro Milli Macro. Primary. PCNA expression

Mitosis. Single Nano Micro Milli Macro. Primary. PCNA expression a b c DAPI YFP CC3 DAPI YFP PCNA DAPI YFP ph3 DAPI YFP KI67 e 6 Mitosis f 1 PCNA expression %ph3 + /YFP + n= 63 87 61 3 13 8 n= 15 3 9 1 5 %PCNA+/YFP+ 8 6 Supplementary Figure 1. Proliferation/apoptosis

More information

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification. Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA

More information

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21

More information

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1). Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.

Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol. Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171 SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed

More information

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA

More information

Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice

Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice Shinichi Hosokawa 1,3,Kenichiro Furuyama 1,3, Masashi Horiguchi 1,3,Yoshiki

More information

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

Tissue factor-par2 signaling promotes diet-induced obesity and adipose Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya

More information

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G

More information

Protein extraction and western blot analysis Protein extraction was performed as

Protein extraction and western blot analysis Protein extraction was performed as ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1,

More information

Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.

Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo. T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used

More information

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95

More information

Supplementary Data Table of Contents:

Supplementary Data Table of Contents: Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary

More information

Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease

Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease Interferon γ regulates idiopathic pneumonia syndrome, a Th17 + CD4 + T-cell-mediated GvH disease Nora Mauermann, Julia Burian, Christophe von Garnier, Stefan Dirnhofer, Davide Germano, Christine Schuett,

More information

Transplantation of Human Pancreatic Endoderm Cells Reverses Diabetes. Post Transplantation in a Prevascularized Subcutaneous Site

Transplantation of Human Pancreatic Endoderm Cells Reverses Diabetes. Post Transplantation in a Prevascularized Subcutaneous Site Stem Cell Reports, Volume 8 Supplemental Information Transplantation of Human Pancreatic Endoderm Cells Reverses Diabetes Post Transplantation in a Prevascularized Subcutaneous Site Andrew R. Pepper, Rena

More information

Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical

Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical adenomatous hyperplasia/epithelial hyperplasia (AAH/EH),

More information

Supplementary Information Titles

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Article Title: Corresponding Author: Authors: An inhibitor of the protein kinases /ε improves obesity- related metabolic dysfunctions Alan Saltiel

More information

Nature Medicine: doi: /nm.4324

Nature Medicine: doi: /nm.4324 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression

More information

Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature

Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida,

More information

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the

More information

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g) Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number

More information

Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma

Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Immunity Supplemental Information Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Brian D. Hondowicz, Dowon An, Jason M. Schenkel, Karen S. Kim, Holly R. Steach, Akshay

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±

More information