Genome-wide association studies for understanding pathogen evolution. Samuel K. Sheppard

Transcription

1 Genome-wide association studies for understanding pathogen evolution Samuel K. Sheppard

2 Pathogenic bacteria Population genomics and evolution Sheppard et al. Science 2008; 11: Sheppard et al. Clinical Infectious Diseases 2009; 48: Raymond et al. Plos Pathogens 2010; 6: e

3 Staphylococcus Phenotypic variation

4 E. Coli Population genetic structure and phenotype D F B2 E A B1 Plant association index (PAi) high low Meric et al. (2012) Phylogenetic distribution of traits associated with plant colonization in Escherichia coli. Environmental Microbiology (in press)

5 Campylobacter Population structure Sheppard et al. (2009) Campylobacter Genotyping to Determine the Source of Human Infection. Clinical Infectious Diseases 48: Sheppard et al. (2010) Host Association of Campylobacter Genotypes Transcends Geographic Variation. Applied Environmental Microbiology 76,

6 Questions -How often do strains switch between niches/hosts? -Do the apparently generalist lineages have hostadapted sub-lineages? -Is there a signal of host specific genetic import? - What are the adaptations?

7 Identifying the genetic basis of phenotypes top-down and bottom-up approaches Bottom-up. Starts with DNA sequence (genes) and tests the effect on the phenotype. Top-down. Starts with phenotype and associates it with particular genomic elements.

8 Genome-wide association study old Vs. new Signals of adaptation Old signals: host associated clonal complexes New signals: host associated mobile elements

9 Words found in cattle Association study Method host associated words in the ST-45 complex number word host1(total=14)host2(total=9pvalue Info. Locus >388 GTTTAAAATTATTTAAATAGAAAGATATTT E-06 Partial match CAMP0030 >49 CCATCGATTAAATATAACTTACTTTATCAT E-05 Partial match CAMP0043 >6840 TAAAGCTTTAAAAAGTATTTTGTTTAAAAT E-05 Partial match CAMP0059 >1130 GATTTATGATTTCAAAAAATTTTCAATAAA E-05 Partial match CAMP0092 >1371 TATTTAAATAGAAAGATATTTTATGAAAAA E-06 Partial match CAMP0116 Expected by clonal decent Observed

10 There are 9034 host associated words in ST-45 complex number word host1(total=14) host2(total=9pvalue Info. Locus >388 GTTTAAAATTATTTAAATAGAAAGATATTT E-06 Partial match CAMP0030 >49 CCATCGATTAAATATAACTTACTTTATCAT E-05 Partial match CAMP0043 >6840 TAAAGCTTTAAAAAGTATTTTGTTTAAAAT E-05 Partial match CAMP0059 >1130 GATTTATGATTTCAAAAAATTTTCAATAAA E-05 Partial match CAMP0092 >1371 TATTTAAATAGAAAGATATTTTATGAAAAA E-06 Partial match CAMP Map to 99 genes in total but 76% of words map to 10 genes Sheppard et al. (2013) Genome-wide association study identifies vitamin B 5 biosynthesis as a host specificity factor in Campylobacter. PNAS (In Press)

11 Trees of cattle associated regions I II III IpxB sure Cj0294 Cj0295 pand panc panb Cj0299 Cj0309 Sheppard et al. (2013) Genome-wide association study identifies vitamin B 5 biosynthesis as a host specificity factor in Campylobacter. PNAS (In Press)

12 Pan genes are often absent in isolates from chickens cj0299 panb panc pand cj0295c j Sheppard et al. (2013) Genome-wide association study identifies vitamin B 5 biosynthesis as a host specificity factor in Campylobacter. PNAS (In Press)

13 Evidence for reduced allelic diversity Sheppard et al. (2013) Genome-wide association study identifies vitamin B 5 biosynthesis as a host specificity factor in Campylobacter. PNAS (In Press)

14 Function of adaptive genes Gene name Cj0072c Cj0144 Cj0262c Cj0286c grea (Cj0287c) lpxb (Cj0288c) sure (Cj0293) Description possible iron-binding protein pseudogene putative methyl-accepting chemotaxis signal transduction protein putative methyl-accepting chemotaxis signal transduction protein hypothetical protein transcription elongation factor; necessary for efficient RNA polymerase transcription elongation past template-encoded arresting sites; arresting sites in DNA have the property of trapping a certain fraction of elongating RNA polymerases that pass through, resulting in locked ternary complexes. Cleavage of the nascent transcript by cleavage factors such as GreA or GreB allows the resumption of elongation from the new 3'terminus lipid-a-disaccharide synthase; catalyzes the formation of lipid A disaccharide from UDP-2,3-diacylglucosamine and 2,3-diacylglucosamine- 1-phosphate, lipid A disaccharide is a precursor of lipid A that anchors LPS to the OM stationary phase survival protein; catalyzes the conversion of a phosphate monoester to an alcohol and a phosphate Cj0294 dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 1 Cj0295 pand (Cj0296c) panc (Cj0297c) panb (Cj0298c) Cj0299 Cj0309c Cj0310c Cj0419 recn (Cj0642) Cj0735 Cj0815 rpsf (Cj1070) ceta (Cj1190c) psee (Cj1337) maf7 (Cj1342c) Cj1344c Cj1345c putative acetyltransferase aspartate alpha-decarboxylase; converts L-aspartate to beta-alanine and provides the major route of beta-alanine production in bacteria. Betaalanine is essential for the biosynthesis of pantothenate (vitamin B5) pantoate--beta-alanine ligase; catalyzes the formation of (R)-pantothenate from pantoate and beta-alanine 3-methyl-2-oxobutanoate hydroxymethyltransferase; catalyzes the formation of tetrahydrofolate and 2-dehydropantoate from 5,10- methylenetetrahydrofolate and 3-methyl-2-oxobutanoate putative periplasmic beta-lactamase probable efflux protein putative efflux protein possible hydrolase or transferase ATPase involved in DNA repair putative periplasmic protein hypothetical protein ribosomal protein S6; binds cooperatively with S18 to the S15-16S complex, allowing platform assembly to continue with S11 and S21 bipartate energy taxis response protein ceta uncharacterized protein conserved in bacteria motility accessory factor (function unknown) putative DNA-binding/iron metalloprotein/ap endonuclease putative periplasmic protein ruvb (Cj1362) Holliday junction DNA helicase; promotes strand exchange during homologous recombination; RuvAB complex promotes branch migration; RuvABC complex scans the DNA during branch migration and resolves Holliday junctions at consensus sequences; forms hexameric rings around opposite DNA arms; requires ATP for branch migration and orientation of RuvAB complex determines direction of migration

15 Cell count Gene function and ecology pantothenic acid (Vitamin B 5 ) synthesis provides an advantage in the cow gut Sheppard et al. (2013) Genome-wide association study identifies vitamin B 5 biosynthesis as a host specificity factor in Campylobacter. PNAS (In Press)

16 Project X Didelot, D Falush Other P Carter, F Clifton-Hadley, AJ Cody, FM Colles, JF Dallas, KJ Forbes, N French, K Jolley, J Lawes, E Litrup, MCJ Maiden, SD Bentley, J Parkhill, G Meric, WG Miller, ID Ogden, R Owen, A Ridley, J Rodgers, NJC Strachan, A Vidal.