WT siz1-2 siz1-3. WT siz1-2 siz1-3. -Pi, 0.05 M IAA. -Pi, 2.5 M NPA

Transcription

1 A WT siz1-2 siz1-3 B WT siz1-2 siz1-3 -Pi C +Pi WT siz1-2 siz1-3 D WT siz1-2 siz1-3 E +Pi, 0.05 M IAA -Pi, 0.05 M IAA WT siz1-2 siz1-3 WT siz1-2 siz1-3 F +Pi, 2.5 M NPA -Pi, 2.5 M NPA Supplemental Figure S1. Wild-type seedlings treated with IAA in low Pi mimicked the siz1 phenotype in response to Pi deficiency, and treatment with NPA suppressed LR formation. Three-and-a-half-day-old seedlings grown on high Pi medium were transferred onto agar plates containing IAA or NPA. Photographs were taken 7 days after the transfer to the new medium. Wild-type and siz1 (siz1-2 and siz1- -Pi, 2.5 M BFA 3) seedlings were grown on agar containing 1.25 mm (A) or mm (B) KH 2 PO 4 without IAA or NPA. Seedlings grown under high Pi conditions were treated with 0.05 μm IAA (C) or 2.5 μm NPA (E). Low Pi-grown seedlings were treated with 0.05 μm IAA (D) or 2.5 μm NPA (F). Scale bar = 10 mm. +Pi, 2.5 M BFA

2 A PR growth (cm) B LR density (number/cm) Pi -Pi +Pi -Pi +Pi -Pi +Pi -Pi Col-0 siz1-2 YUCCA1 YUCCA6 +Pi -Pi +Pi -Pi +Pi -Pi +Pi -Pi Col-0 siz1-2 YUCCA1 YUCCA6 Supplemental Figure S2. Overexpression of YUCCA1 reduced PR elongation and enhanced LR density. Seedling were grown on a basal medium containing Pi for 3.5 days, then transferred onto medium containing high Pi (1.25 mm KH 2 PO 4, +Pi) or low Pi ( mm KH 2 PO 4, -Pi) and grown for 7 days. PR growth and LR density of wild-type, siz1-2, YUCCA1, and YUCCA6 seedlings were scored. All values represent the mean of 10 seedlings ±SE.

3 Supplemental Table S1. Genes with 3-hold or higher expression in siz1-2 that are also induced by NAA (Himanen et al., 2004; Vanestte et al., 2005) b c a siz1-2(+pi) siz1-2(-pi) AGI ID Gene Description WT(+Pi) WT(-Pi) At1g30760 At5g20230 At2g15480 At1g60730 At1g78110 At1g73260 At3g45140 At1g33600 At1g02850 At5g64240 At4g01630 At2g26530 At1g77120 At4g22530 At3g47540 At1g67810 At1g17170 At3g50970 At1g76680 At2g41380 At2g15490 At4g19880 At2g18210 At2g29480 At5g06860 At2g17500 FAD-linked oxidoreductase family blue copper binding protein putative glucosyltransferase auxin-induced protein, putative/ aldo/keto reductase family protein unknown protein putative trypsin inhibitor lipoxygenase AtLOX2 leucine rich repeat protein family glycosyl hydrolase family 1 latex-abundant family protein (AMC3) / caspase family protein expansin, putative (EXP17) putative yeast pheromone receptor protein AR781 alcohol dehydrogenase embryo-abundant protein-related glycosyl hydrolase family 19 (chitinase) Fe-S metabolism associated domain-containing protein glutathione transferase, putative dehydrin xero2 (XERO2) / low-temperature-induced protein LTI30 12-oxophytodienoate reductase (OPR1) putative embryo-abundant protein putative glucosyltransferase glutathione S-transferase-related unknown protein glutathione transferase, putative polygalacturonase inhibiting protein (PGIP1) auxin efflux carrier family protein a. Protein detabase AGI number. b. Fold mrna accumulation in siz1 versus wild type under phosphate sufficient condition. c. Fold mrna accumulation in siz1 versus wild type under phosphate deficient condition. d. Not applicable. Data could not be obtained because of low signal or high variation n.a. d 2.3 n.a. d

4 Supplemental Table S2. Genes 3.0 fold up-regulated in siz1-2 plants under the low-pi condition Locus Gene Description Fold a Fold a siz1(+pi) siz1(-pi) /WT(+Pi) /WT(-Pi) At4g27450 unknown protein 1.8 ± ±1.2 At1g30760 FAD-linked oxidoreductase family 1.5 ± ±1.0 At2g22860 phytosulfokines 2 (PSK2) 2.5 ± ±1.6 At5g54780 RabGAP/TBC domain-containing protein 5.8 ± ±1.1 At2g17850 senescence-associated protein 1.4 ± ±1.3 At5g50170 C2 and GRAM domain-containing protein 4.0 ± ±1.2 At3g59930 A defensin-like family protein 1.7 ± ±1.3 At5g20230 blue copper binding protein 3.2 ± ±1.4 At2g05540 putative glycine-rich protein 1.4 ± ±1.7 At2g15480 UDP-glucosyl transferase 6.0 ± ±1.1 At1g60730 putative auxin-induced aldo/keto reductase family 5.2 ± ±1.5 At2g02930 glutathione transferase, putative 3.5 ± ±1.1 At2g16005 MD-2-related lipid recognition domain-containing 2.8 ± ±1.3 At5g24780 vegetative storage protein Vsp1 4.8 ± ±1.2 At1g78110 unknown protein 1.6 ± ±1.5 At4g12850 far-red impaired responsive family protein 1.7 ± ±1.1 At1g43800 acyl-[acyl-carrier-protein] desaturase, putative 1.2 ± ±1.1 At1g02920 glutathione transferase, putative 3.4 ± ±1.2 At2g16060 class 1 non-symbiotic hemoglobin (AHB1) -1.1 ± ±1.3 At1g75830 plant defensin protein, putative (PDF1.1) 1.4 ± ±1.1 At1g55240 unknown protein 3.2 ± ±1.5 At1g73260 putative trypsin inhibitor 2.4 ± ±1.1 At1g47960 invertase/pectin methylesterase inhibitor family 2.6 ± ±1.3 At4g33560 putative protein 1.1 ± ±1.3 At3g45140 lipoxygenase AtLOX2 2.0 ± ±1.4 At2g30770 cytochrome P450 71A ± ±1.6 At1g33600 leucine rich repeat protein family 1.5 ± ±1.6 At2g25510 expressed protein 2.1 ± ±1.3

5 At5g64240 latex-abundant family protein, caspase family protein 1.4 ±1.1 ±1.5 At3g21720 putative isocitrate lyase 1.8 ±1.2 ±1.4 At5g17650 glycine/proline-rich protein 1.3 ±1.1 ±2.0 At4g01630 expansin (EXP17) 1.3 ±1.0 ±1.4 At2g26530 putative yeast pheromone receptor protein AR ±1.1 ±1.2 At1g02850 glycosyl hydrolase family ±1.4 ±1.2 At2g33830 dormancy/auxin associated family protein 2.0 ±1.1 ±1.1 At5g37990 S-adenosyl-L-methionine:carboxyl methyltransferase 5.2 ± ±1.2 At2g47600 magnesium/proton exchanger (MHX1) 1.6 ± ±1.6 At5g58820 subtilisin-like serine protease 1.3 ± ±1.1 At4g02520 glutathione S-transferase PM ± ±2.6 b At1g33055 expressed protein 1.4 ± ±1.1 At1g14250 nucleoside phosphatase family protein/gda1 2.1 ± ±1.1 At4g22530 embryo-abundant protein-related 2.4 ± ±1.2 At3g22231 Pathogen and circadian controlled ± ±1.5 At3g47540 glycosyl hydrolase family 19 (chitinase) 2.5 ± ±1.6 At1g OG-Fe(II) oxygenase family protein 2.7 ± ±1.6 At1g33670 leucine rich repeat protein family 1.9 ± ±1.7 At4g23600 coronatine-responsive tyrosine aminotransferase 1.0 ± ±1.2 At1g71692 agamous-like MADS box protein AGL ± ±1.3 At2g '-5' exonuclease domain-containing protein 1.3 ± ±1.2 At3g21950 S-adenosyl-L-methionine:carboxyl methyltransferase 2.6 ± ±1.7 At3g59270 syntaxin-related family protein 3.1 ± ±1.3 a Mean ± SD (n = 3). b p > 0.01 (t-test).

6 Supplemental Table S3. Genes 3.0 fold up-regulated in siz1-2 plants under the high-pi condition, but < 3.0 fold up-regulated in siz1-2 plants under the low-pi condition Locus Gene Description Fold a Fold a siz1(+pi) siz1(-pi) /WT(+Pi) /WT(-Pi) At2g14610 pathogenesis-related PR-1 protein 8.4 ±1.2 n.a. b At5g26220 ChaC-like family protein 6.5 ±1.2 n.a. b At5g36140 cytochrome P450-related 6.2 ±1.1 n.a. b At4g33720 pathogenesis-related protein 1 precursor 6.1 ± ±1.3 At3g29970 germination protein-related 6.0 ±1.1 n.a. b At1g67810 Fe-S metabolism associated domain-containing 5.9 ± ±1.2 At5g48850 male sterility MS5 family protein 5.9 ±1.2 n.a. b At1g65340 cytochrome P450, putative 5.7 ±1.2 n.a. b At2g18050 histone H1 5.4 ± ±1.4 At5g52320 cytochrome P450, putative 5.0 ±1.0 n.a. b At2g39030 GCN5-related N-acetyltransferase (GNAT) family 4.6 ±1.2 n.a. b At5g59520 zinc transporter (ZIP2) 4.5 ± ±1.0 At3g54150 embryo-abundant protein -like 4.4 ±1.1 n.a. b At1g17170 glutathione transferase, putative 4.4 ± ±1.3 At2g26270 hypothetical protein 4.4 ±1.2 n.a. b At2g43590 putative endochitinase 4.3 ± ±1.1 At3g43180 zinc finger (C3HC4-type RING finger) family protein 4.2 ±1.3 n.a. b At2g18660 expansin-related protein 3 precursor 4.2 ± ±1.2 At5g13900 protease inhibitor/seed storage/lipid transfer protein 4.1 ±1.1 n.a. b At3g50970 dehydrin xero2/ low-temperature-induced protein LTI ± ±1.6 At3g08860 putative β-alanine aminotransferase 4.1 ± ±1.3 At3g32030 terpene synthase/cyclase family 4.0 ± ±1.2 At3g26740 light responsive protein-related 4.0 ±1.2 n.a. b At1g oxophytodienoate reductase (OPR1) 3.9 ± ±1.1 At2g02990 ribonuclease, RNS1 3.9 ± ±1.3 At1g oxophytodienoate reductase (OPR2) 3.8 ± ±1.3 At5g06870 polygalacturonase inhibiting protein 2 (PGIP2) 3.6 ±1.3 n.a. At5g09490 ribosomal protein S15-like 3.6 ±1.1 n.a.

7 At2g35380 peroxidase family 3.6 ± ±1.3 At2g41380 putative embryo-abundant protein 3.6 ± ±1.1 At3g12500 basic endochitinase 3.5 ± ±1.4 At5g59380 methyl-cpg-binding domain-containing protein 3.5 ± ±1.5 At1g63530 unknown protein 3.5 ±1.1 n.a. b At5g09520 surface protein PspC-related 3.5 ± ±1.1 At5g23190 cytochrome P450-like protein 3.5 ± ±1.3 At2g15490 putative glucosyltransferase 3.5 ±1.1 n.a. b At4g11650 osmotin-like protein (OSM34) 3.4 ± ±1.4 At4g19880 glutathione S-transferase-related ± ±1.2 At2g18210 unknown protein ±1.1 n.a. b At2g29480 glutathione transferase, putative ± ±1.2 At5g66170 senescence-associated protein ± ±1.2 At3g04210 disease resistance protein (TIR-NBS class), putative ± ±1.3 At5g06860 polygalacturonase inhibiting protein (PGIP1) ± ±1.2 At5g45380 sodium:solute symporter family protein ±1.3 n.a. b At1g18970 germin, putative 3.2 ± ±1.4 At2g43670 glycosyl hydrolase family ±1.3 n.a. b At2g14560 late upregulated in response to H.parastica 3.2 ± ±1.2 At3g15990 putative sulfate transporter 3.2 ± ±1.1 At2g48130 protease inhibitor/seed storage/lipid transfer protein 3.2 ± ±1.4 At2g39310 jacalin lectin family protein 3.2 ± ±1.3 At4g15610 integral membrane family protein 3.2 ± ±1.2 At1g64170 cation/hydrogen exchanger, putative (CHX16) 3.1 ±1.3 n.a. b At3g12820 myb family transcription factor (MYB10) 3.1 ±1.3 n.a. b At2g17500 auxin efflux carrier family protein 3.1 ± ±1.2 At5g24770 vegetative storage protein Vsp2 3.0 ±1.1 n.a. b a Mean ± SD (n = 3). b Not applicable. Data could not be obtained because of low signal or high variation.

8 Supplemental Table S4. Genes 3.0 fold down-regulated in siz1-2 plants under the low -Pi condition Locus Gene Description Fold a Fold a siz1(+pi) siz1(-pi) /WT(+Pi) /WT(-Pi) At1g03170 expressed protein - ± ±1.8 At1g52400 glycosyl hydrolase family 1, beta-glucosidase (BG1) -1.1 ± ±1.3 At4g22520 protease inhibitor/seed storage/lipid transfer protein -1.5 ± ±1.7 At5g02220 expressed protein -1.1 ± ±1.3 At3g28990 unknown protein n.a. b -3.1 ±1.3 At1g50320 thioredoxin, putative -2.2 ± ±1.6 At5g41440 zinc finger (C3HC4-type RING finger) family protein -1.5 ± ±1.7 At5g39760 zinc finger homeobox protein-related -2.0 ± ±1.5 a Mean ± SD (n = 3). b Not applicable. Data could not be obtained because of low signal or high variation.

9 Supplemental Table S5. Genes 3.0 fold down-regulated in siz1-2 plants under the high -Pi condition, but < 3.0 fold down-regulated in siz1-2 plants under the low-pi condi tion Locus Gene Description Fold a Fold a siz1(+pi) siz1(-pi) /WT(+Pi) /WT(-Pi) At5g20630 germin-like protein (GER3) -6.0 ± ±1.3 At3g61530 ketopantoate hydroxymethyltransferase family -4.8 ± ±1.7 At1g67090 ribulose-bisphosphate carboxylase small unit -4.6 ± ±1.4 At5g58370 putative GTP-binding protein CGPA -4.4 ± ±2.1 At2g45180 protease inhibitor/seed storage/lipid transfer -4.3 ± ±1.3 At1g18120 putative myrosinase-associated protein -4.2 ±1.2 n.a. b At3g14210 myrosinase-associated protein, putative -4.1 ± ±1.2 At1g62780 unknown protein -3.9 ± ±1.7 At3g43290 putative protein -3.8 ±1.1 n.a. b At5g14740 carbonic anhydrase ± ±1.1 At1g72610 germin-like protein -3.8 ± ±1.2 At5g34839 unknown protein -3.6 ±1.3 n.a. b At5g38940 unknown protein -3.6 ±1.2 n.a. b At5g36900 hypothetical protein -3.5 ±1.2 n.a. b At4g27520 putative protein -3.5 ± ±1.8 At3g13470 chaperonin 60 beta, putative - ± ±1.2 At4g25050 acyl carrier family protein -3.1 ±1.3 n.a. b At4g37360 cytochrome p450 family -3.1 ± ±2.0 At2g32540 cellulose synthase -3.1 ±1.3 n.a. b At5g28500 unknown protein -3.1 ± ±1.7 At5g40590 DC1 domain-containing protein -3.0 ±1.2 n.a. b At1g73600 phosphoethanolamine N-methyltransferase -3.0 ± ±1.1 At1g74970 ribosomal protein S9, putative -3.0 ± ±1.3 a Mean ± SD (n = 3). b Not applicable. Data could not be obtained because of low signal or high variation.

10 Supplemental Table S6. Primers used for quantitative RT-PCR analysis Gene name Primer sequence ACT2 (For) 5 - TAACAGGGAGAAGATGACTCAGATCA -3 ; (Rev) 5 - AAGATCAAGACGAAGGATAGCATGAG -3 EXP17 (For) 5 - CGCAATGATCTTCTCCACAA -3 ; (Rev) 5 - GGTTTCCATAACCACAAGCTC -3 GLH (For) 5 - TGGGTCTAGATTGCCAGCTT -3 (Rev) 5 - GCATATGATGGATGGTGCAG -3 UGT73B4 (For) 5 - GAATGCCTAAAATGGCTGGA -3 (Rev) 5 - GAGGACCCTCCTTCTTCCAG -3