Functional Cell-Based Assays
|
|
|
- Alexandra Warren
- 6 years ago
- Views:
Transcription
1 2017 Page 1/8 Axxam S.p.A. (Italy) offers functional cell-based assays for protein targets of relevance to drug discovery research, including challenging targets such as multi subunit ion channels and current hot targets of interest. All assays are thoroughly QCed and validated for high throughput screening (HTS) applications using 96- and 384-well titer plates. We are continually developing new assays. If your target of interest is not listed in this catalogue please inquire for availability. Key Features Reliable, high quality assays optimal cell lines and detection systems stable expression over time validated using reference compounds ion channel assays validated for patch clamp Available as off-the-shelf products or as part of contract research projects at Axxam Expert technical support Assays details can be provided upon request Assay Portfolio (July 2017) Protein class No. Assays Page GPCRs Ion Channels Transporters 19 6 NHRs 5 7 Enzymes 7 7 Cytokine Receprtors 1 7 Exchangers 3 7 Toll-Like Receptors 3 8 mrna Post- Transcriptional Regulation 1 8 Tyrosine Kinase Receptor 2 8 Custom Assay Development Axxam undertakes custom assay development projects. Our highly experienced team has developed numerous cell-based assays using cutting-edge technologies, including difficult targets that other groups have found intractable. Axxam s proprietary technologies may help you to circumvent IP restrictions on your target of interest. Delivery time of a new assay in a 384-well plate-adapted format can be as little as 4 months.
2 Assay List Page 2/8 Target Class: GPCRs Adenosine receptors ADORA1 Adenosine A1 receptor 134 Adora1 NEW! Mouse adenosine A1 receptor Adora1 NEW! Rat adenosine A1 receptor ADORA2A Adenosine A2a receptor 135 Adora2a NEW! Mouse adenosine A2a receptor Adora2a NEW! Rat adenosine A2a receptor ADORA2B NEW! Adenosine A2b receptor 136 Adora2b NEW! Mouse adenosine A2b receptor Adora2b NEW! Rat adenosine A2b receptor ADORA3 NEW! Adenosine A3 receptor 140 Adora3 NEW! Mouse adenosine A3 receptor Adrenergic receptors ADRA2A Adrenergic, alpha-2a-, receptor 150 ADRA2C Adrenergic, alpha-2c-, receptor 152 Bile acids receptors GPBAR1 G protein coupled bile acid receptor 1 -TGR Bradykinin receptors BDKRB1 Bradykinin receptor B1 623 Bdkrb1 (rat) Rat bradykinin receptor BDKRB2 Bradykinin receptor B2 624 Cannabinoid receptors CNR1 Cannabinoid receptor CNR2 Cannabinoid receptor Chemokine (CXC) receptors CCR2 Chemokine (C-C motif) receptor CCR3 Chemokine (C-C motif) receptor CCRL1 NEW! Chemokine (C-C motif) receptor-like CCR5 NEW! Chemokine (C-C motif) receptor CX3CR1 Chemokine (C-X3-C motif) receptor Cx3cr1 (mouse) Mouse chemokine (C-X3-C motif) receptor Cx3cr1 (rat) Rat chemokine (C-X3-C motif) receptor CXCR1 Interleukin 8 receptor, alpha 3577 CXCR2 Interleukin 8 receptor, beta 3579 Chemokine (CXC) receptors CXCR3 CXC chemokine receptor CMKLR1 Chemokine-Like Receptor 1 - ChemR
3 Assay List Page 3/8 Target Class: GPCRs (continued) Cholinergic receptors CHRM2 Cholinergic receptor, muscarinic Class Frizzled GPCRs Smo (endogenous - mouse) NEW! Mouse smoothened homolog (Drosophila) Cholecystokinin receptors CCKAR Cholecystokinin A receptor 886 Complement component receptors C5aR1 Complement component 5a receptor Dopamine receptors DRD1 Dopamine receptor D DRD2 Dopamine receptor D DRD3 Dopamine receptor D Fatty acid receptors GPR119 G protein-coupled receptor FFAR1 Free fatty acid receptor 1,GPR FFAR2 Free fatty acid receptor 2, GPR Formyl peptide receptors FPRL1 FPRL1, formyl peptide receptor-like FPR1 Formyl peptide receptor Galanin receptors GALR2 Galanin Receptor Ghrelin GHSR Growth hormone secretagogue receptor 2693 Glucagon receptors GCGR Glucagon receptor 2642 GLP1R Glucagon-like peptide 1 receptor 2740 Glp1r (rat) Rat glucagon-like peptide 1 receptor Glutamate receptor GRM1 NEW! Glutamate receptor metabotropic Kynurenic acid receptor GPR35 G protein-coupled receptor Leukotriene receptors LTB4R Leukotriene B4 receptor 1241 Lysophosphatidic acid receptors LPAR5 Lysophosphatidic acid receptor 5, GPR Neuropeptides receptor NPY2R Neuropeptide Y receptor Prokineticin receptors PROKR1 (GPR/73) Prokinetycin receptor PROKR2 (GPR73L1) Prokineticin receptor Prostanoid receptors PTGDR2 GPR44, CRTH2, DP2, Prostaglandin D2 receptor Protease activated receptors F2RL3 PAR4, Coagulation factor II (thrombin) receptor-like 3 Serotonin receptor HTR2A Serotonin 5-HT-2A receptor 3356 Sphingosine-1 phosphate S1pr3 (mouse) Mus musculus Sphingosine-1-phosphate receptor
4 Assay List Page 4/8 Target Class: Ligand Gated Ion Channels Ligand gated cationic channels Chloride channels Transient receptor potential channels P2RX1 Purinergic receptor P2X, ligand-gated ion channel, P2rx1 (mouse) Mouse purinergic receptor P2X, ligand-gated ion channel, P2RX2/P2RX3 Heteromeric P2X2/P2X3 receptor P2RX3 Purinergic receptor P2X, ligand-gated ion channel, P2rx3 (rat) Rat purinergic receptor P2X, ligand-gated ion channel, P2RX4 Purinergic receptor P2X, ligand-gated ion channel, P2rx4 (mouse) Mouse purinergic receptor P2x ligand-gated ion channel, P2rx7 (rat) Rat purinergic receptor P2X, ligand-gated ion channel, P2rx7 (mouse) Mouse purinergic receptor P2X, ligand-gated ion channel, GABRA1-GABRB1- GABRG2 Gamma-aminobutyric acid (GABA) A receptor, alpha 1, beta 1, gamma GLRA1 Glycine receptor, alpha TRPA1 TRPC3 TRPC5 TRPC6 TRPC7 TRPM2 TRPM5 TRPM7 TRPM8 TRPV1 ANKTM1, Transient receptor potential cation channel subfamily A member 1 Transient receptor potential cation channel, subfamily C, member 3 Transient receptor potential cation channel, subfamily C, member 5 Transient receptor potential cation channel, subfamily C, member 6 Transient receptor potential cation channel, subfamily C, member 7 Transient receptor potential cation channel, subfamily M, member 2 Transient receptor potential cation channel, subfamily M, member 5 Transient receptor potential cation channel, subfamily M, member 7 Transient receptor potential cation channel, subfamily M, member 8 Transient receptor potential cation channel, subfamily V, member
5 Assay List Page 5/8 Target Class: Voltage-Gated Ion Channels Voltage gated Na + channels SCN5A (Nav 1.5) NEW! Na + channel, voltage-gated, type V, alpha subunit 6331 SCN9A (Nav1.7) Na + channel, voltage-gated, type IX, alpha subunit 6335 Voltage gated K + channels KCNA3 (Kv1.3) K + voltage-gated channel, Shaker-related subfamily A, member KCNA5 (Kv1.5) K + voltage-gated channel, Shaker-related subfamily A, member KCNB1 (Kv2.1) K + voltage-gated channel, Shab-related subfamily B, member KCNQ2/KCNQ3 (Kv7.2/Kv7.3) NEW! Heteromeric Potassium voltage-gated channel subfamily Q member 2; potassium voltage-gated channel subfamily Q member Inwardly rectifying K + channels KCNJ4 (Kir 2.3) K + inwardly-rectifiyng channel, subfamilyj, member Voltage gated Ca 2+ channels CACNA1C (Cav 1.2) Ca 2+ channel, voltage-dependent, L type, alpha 1C subunit 775 Store-operated Ca 2+ channels CACNA1D (Cav1.3) Ca 2+ channel, voltage-dependent, L type, alpha 1D subunit 776 CACNA1B (Cav 2.2) endogenous NEW! Ca 2+ channel, voltage-dependent, N type, alpha 1B subunit 774 CACNA1I (Cav 3.3) NEW! Ca 2+ channel, voltage-dependent, T type, alpha 1I subunit 8911 CRAC ORAI1( calcium release-activated calcium modulator 1) + STIM-1 (stromal interaction molecule 1) Calcium activated Cl - channels TMEM16A Trans-membrane protein 16A (Cl channel) Calcium activated K + channels K + /Na + hyperpolarizationactivated CNG channels KCNN3 KCNN4 KCNN4 (endogenous) HCN2 HCN4 Potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Potassium channel, calcium activated intermediate/small conductance subfamily N alpha, member 4 Potassium channel, calcium activated intermediate/small conductance subfamily N alpha, member 4 Hyperpolarization activated cyclic nucleotide-gated potassium channel 2 Hyperpolarization activated cyclic nucleotide-gated potassium channel
6 Assay List Page 6/8 Target Class: Transporters ATP binding cassette MRP4 (ABCC4) ATP-binding cassette, sub-family C (CFTR/MRP), member Glucose transporters Neurotransmitter transporters Sodium phosphate cotransporters Slc2a1 (GLUT1-rat) Slc2a2 (GLUT2-rat) Slc2a3 (GLUT3-rat) SLC2A1 (GLUT1-canine) SLC2A2 (GLUT2-canine) SLC2A3 (GLUT3-canine) Slc2a1 solute carrier family 2 (facilitated glucose transporter), member Slc2a2 solute carrier family 2 (facilitated glucose transporter), member Slc2a3 solute carrier family 2 (facilitated glucose transporter), member SLC2A1 solute carrier family 2 (facilitated glucose transporter), member SLC2A2 solute carrier family 2 (facilitated glucose transporter), member SLC2A2 solute carrier family 2 (facilitated glucose transporter), member SLC6A3 DAT, Dopamine transporter 6531 SLC6A1 GAT1, GABA transporter SLC6A11 GAT3, GABA transporter SLC6A9 GLYT1, Glycin transporter SLC6A5 GLYT2, Glycin transporter SLC6A2 NET, Norepinephrine transporter 6530 SLC34A1 (NPT2a) Solute carrier family 34 (sodium phosphate), member Slc34a1 (NPT2a rat) Solute carrier family 34 (sodium phosphate), member SLC34A1 (NPT2a dog) Solute carrier family 34 (sodium phosphate), member SLC34A2 (NPT2b) Solute carrier family 34 (sodium phosphate), member SLC34A3 (NPT2c mutant) Solute carrier family 34 (sodium phosphate), member SLC40A1 (FPN1) NEW! Solute carrier family
7 Assay List Page 7/8 Target Class: Nuclear Hormone Receptors Nuclear hormone receptors Nuclear hormone receptors NR3C1 GR, Glucocorticoid receptor, nuclear receptor subfamily 3, group C, member NR3C2 MR, mineralcorticoid receptor, nuclear receptor subfamily 3, group C, member PPARA PPAR-alpha, Peroxisome proliferator-activated receptor alpha 5465 PPARD PPAR-delta, Peroxisome proliferator-activated receptor delta 5467 PGR Progesteron receptor 5241 Target Class: Enzymes Adenylate cyclase ADCY5 NEW! Adenylate cyclase ADCY6 NEW! Adenylate cyclase Nitric oxide synthase NOS3 NEW! Nitric oxide synthase 3 (endothelial cell) 4846 NOS2 NEW! Inducible nitric oxide synthase (type II) 4843 Cysteine protease MALT1 NEW! Mucosa associated lymphoid tissue Lymphoma Translocation gene Synthase kinase GSK3β NEW! Human glycogen synthase kinase 3 beta 2932 GSK3β (endogenous) NEW! Human glycogen synthase kinase 3 beta 2932 Target Class: Cytokine Receptors Cytokine receptort TNFAR (endogenous) NEW! Tumor necrosis factor alpha receptor 7132 Target Class: Exchangers Na + /K + /Ca 2+ exchangers Na + /Ca 2+ exchangers SLC24A3 (NCKX3) SLC8A1 (NCX1) SLC8A2 (NCX2) Solute carrier family 24 (sodium/potassium/calcium exchanger), member Solute carrier family 8 (sodium/calcium exchanger), member Solute carrier family 8 (sodium/calcium exchanger), member
8 Assay List Page 8/8 Target Class: Toll-Like Receptors Toll-like receptor 4 TLR4 (endogenous) TOLL; CD284; htoll; ARMD Tlr4 (mouse-endogenous) Mouse toll-like receptor Toll-like receptor 9 TLR9 CD Target Class: mrna Post-Transcriptional Regulation mrna post-transcriptional regulation NOS3 NEW! Nitric oxide synthase 3 (endothelial cell) 4846 Target Class: Tyrosine Kinase Receptors Tyrosine kinase receptor Ntrk1 (endogenous - rat) NEW! Ntrk1 neurotrophic tyrosine kinase, receptor, type 1 (Rattus norvegicus) NTRK2 NEW! Neurotrophic tyrosine kinase, receptor, type
Biomarkers for Hypothesis Testing
Biomarkers for Hypothesis Testing Definition for Drug Development: Biomarker = Any Measure of a Drug Action Proximal to a Clinical Effect Biochemical (PET, MRS & CSF* for CNS drugs) Physiological EEG,
Receptors Families. Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia
Receptors Families Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia Receptor Families 1. Ligand-gated ion channels 2. G protein coupled receptors 3. Enzyme-linked
11/8/16. Cell Signaling Mechanisms. Dr. Abercrombie 11/8/2016. Principal Parts of Neurons A Signal Processing Computer
Cell Signaling Mechanisms Dr. Abercrombie 11/8/2016 Principal Parts of Neurons A Signal Processing Computer A Multitude of Synapses and Synaptic Actions Summation/Synaptic Integration 1 The Synapse Signal
MBG301. Class IV. Classification of GPCRs according to their effector function (according to Lodish)
MBG301 Class IV Classification of GPCRs according to their effector function (according to Lodish) 1. Adenylcyclase activation by GPCRs 2. Ion channel regulation by GPCRs 3. Phospholipase C (PLC) activation
Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)
Basics of Pharmacology
Basics of Pharmacology Pekka Rauhala Transmed 2013 What is pharmacology? Pharmacology may be defined as the study of the effects of drugs on the function of living systems Pharmacodynamics The mechanism(s)
Communication Between
Communication Between Neurons Bởi: OpenStaxCollege The electrical changes taking place within a neuron, as described in the previous section, are similar to a light switch being turned on. A stimulus starts
GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1
GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1 1. The endocrine system consists of glands that secrete chemical signals, called hormones, into the blood. In addition, other organs and cells
Supplementary Material for Pacholec, M. et al. manuscript SRT1720, SRT2183, SRT1460, and
Supplementary Material for Pacholec, M. et al. manuscript SRT1720, SRT2183, SRT1460, and resveratrol are not direct activators of SIRT1 Supplementary Figure Legends Figure S1. Determination of SIRT1 K
Supplementary Figure 1: GPCR profiling and G q signaling in murine brown adipocytes (BA). a, Number of GPCRs with 2-fold lower expression in mature
Supplementary Figure 1: GPCR profiling and G q signaling in murine brown adipocytes (BA). a, Number of GPCRs with 2-fold lower expression in mature BA vs. preadipocytes. b, Number of GPCRs with 2-fold
Receptors and Drug Action. Dr. Subasini Pharmacology Department Ishik University, Erbil
Receptors and Drug Action Dr. Subasini Pharmacology Department Ishik University, Erbil Receptors and Drug Action Receptor Receptor is defined as a macromolecule or binding site located on the surface or
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
Receptors Functions and Signal Transduction- L4- L5
Receptors Functions and Signal Transduction- L4- L5 Faisal I. Mohammed, MD, PhD University of Jordan 1 PKC Phosphorylates many substrates, can activate kinase pathway, gene regulation PLC- signaling pathway
Cellular Messengers. Intracellular Communication
Cellular Messengers Intracellular Communication Most common cellular communication is done through extracellular chemical messengers: Ligands Specific in function 1. Paracrines Local messengers (neighboring
Section: Chapter 5: Multiple Choice. 1. The structure of synapses is best viewed with a(n):
Section: Chapter 5: Multiple Choice 1. The structure of synapses is best viewed with a(n): p.155 electron microscope. light microscope. confocal microscope. nissle-stained microscopic procedure. 2. Electron
Physiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS
Physiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS In Physiology Today Cell Communication Homeostatic mechanisms maintain a normal balance of the body s internal environment
2013 W. H. Freeman and Company. 12 Signal Transduction
2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure
Cell Signaling (part 1)
15 Cell Signaling (part 1) Introduction Bacteria and unicellular eukaryotes respond to environmental signals and to signaling molecules secreted by other cells for mating and other communication. In multicellular
Sarah Jaar Marah Al-Darawsheh
22 Sarah Jaar Marah Al-Darawsheh Faisal Mohammad Receptors can be membrane proteins (for water-soluble hormones/ligands) or intracellular (found in the cytosol or nucleus and bind to DNA, for lipid-soluble
Principles of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
SUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
Psych 181: Dr. Anagnostaras
Psych 181: Dr. Anagnostaras Lecture 5 Synaptic Transmission Introduction to synaptic transmission Synapses (Gk., to clasp or join) Site of action of most psychoactive drugs 6.5 1 Synapses Know basic terminology:
Close to site of release (at synapse); binds to receptors in
Chapter 18: The Endocrine System Chemical Messengers 1. Neural 2. Endocrine 3. Neuroendocrine 4. Paracrine 5. Autocrine Endocrine System --Endocrine and nervous systems work together --Endocrine vs. Nervous
Ch. 45 Continues (Have You Read Ch. 45 yet?) u Central Nervous System Synapses - Synaptic functions of neurons - Information transmission via nerve
Ch. 45 Continues (Have You Read Ch. 45 yet?) u Central Nervous System Synapses - Synaptic functions of neurons - Information transmission via nerve impulses - Impulse may be blocked in its transmission
STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 16, PAGE
STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 16, 2017 -- PAGE 1 of 9 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There
STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 18, PAGE
STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 18, 2016 -- PAGE 1 of 8 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There
Elevated carbon dioxide alters neural signaling and anti-predator behaviors in ocean phase coho salmon (Oncorhynchus kisutch)
Western Washington University Western CEDAR Salish Sea Ecosystem Conference 2018 Salish Sea Ecosystem Conference (Seattle, Wash.) Apr 5th, 3:30 PM - 3:45 PM Elevated carbon dioxide alters neural signaling
Ion Channels Graphics are used with permission of: Pearson Education Inc., publishing as Benjamin Cummings (http://www.aw-bc.com)
Ion Channels Graphics are used with permission of: Pearson Education Inc., publishing as Benjamin Cummings (http://www.aw-bc.com) Page 1. Introduction At synapses, ions move across cell membranes through
Communication Between Neurons *
OpenStax-CNX module: m46503 1 Communication Between Neurons * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 15, PAGE
STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 15, 2018 -- PAGE 1 of 8 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There
INTERACTION DRUG BODY
INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase
IONOTROPIC RECEPTORS
BASICS OF NEUROBIOLOGY IONOTROPIC RECEPTORS ZSOLT LIPOSITS 1 NEURAL COMMUNICATION http://sciencecore.columbia.edu/s4.html 2 Post-synaptic mechanisms Receptors-signal transduction-messengers 3 TRANSMITTER
Cellular Physiology (PHSI3009) Contents:
Cellular Physiology (PHSI3009) Contents: Cell membranes and communication 2 nd messenger systems G-coupled protein signalling Calcium signalling Small G-protein signalling o RAS o MAPK o PI3K RHO GTPases
Membrane Structure and Function
BIOL1040 Page 1 Membrane Structure and Function Friday, 6 March 2015 2:58 PM Cellular Membranes Fluid mosaics of lipids and proteins Phospholipids - abundant Phospholipids are amphipathic molecules (has
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
Human SLC transporter Expression List (n= 71) 2014/9/19 Family No Official Symbol
SLC1: High affinity gltamate and 1 SLC1A2 solute carrier 1 (glial high affinity glutamate EAAT2, GLT-1 6506 neutral amino acid transporter), member 2 SLC2: Facilitative GLUT transporter 2 SLC2A6 solute
Action Potentials and Synaptic Transmission. BIO 219 Napa Valley College Dr. Adam Ross
Action Potentials and Synaptic Transmission BIO 219 Napa Valley College Dr. Adam Ross Review of action potentials Nodes of Ranvier Nucleus Dendrites Cell body In saltatory conduction, the nerve impulses
Dania Ahmad. Tamer Barakat + Dania Ahmad. Faisal I. Mohammed
16 Dania Ahmad Tamer Barakat + Dania Ahmad Faisal I. Mohammed Revision: What are the basic types of neurons? sensory (afferent), motor (efferent) and interneuron (equaled association neurons). We classified
Synaptic transmission
Outline Synaptic transmission Sompol Tapechum M.D., Ph.D. Department of Physiology Faculty of Medicine Siriraj Hospital, Bangkok, Thailand. sisth@mahidol.ac.th 2 Structure of synapse Modes of synaptic
Introduction to some interesting research questions: Molecular biology of the primary afferent nociceptor
Introduction to some interesting research questions: Molecular biology of the primary afferent nociceptor NOCICEPTORS ARE NOT IDENTICAL PEPTIDE SubP/CGRP Trk A NON-PEPTIDE IB4 P2X 3 c-ret Snider and McMahon
Supplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
Hormones and Signal Transduction. Dr. Kevin Ahern
Dr. Kevin Ahern Signaling Outline Signaling Outline Background Signaling Outline Background Membranes Signaling Outline Background Membranes Hormones & Receptors Signaling Outline Background Membranes
Session ID: 1001 June 14, 2012
It s Not Just Serotonin: Neurosignaling in Mental Illness Barbara J. Limandri, DNSc, APRN, BC Professor of Nursing Linfield College Learning Outcomes Distinguish between metabotropic and ionotropic neuroreceptors
It s Not Just Serotonin: Neurosignaling in Mental Illness
It s Not Just Serotonin: Neurosignaling in Mental Illness Barbara J. Limandri, DNSc, APRN, BC Professor of Nursing Linfield College Learning Outcomes Distinguish between metabotropic and ionotropic neuroreceptors
Cell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
Ion Channels (Part 2)
Ion Channels (Part 2) Graphics are used with permission of : adam.com (http://www.adam.com/) Benjamin/Cummings Publishing Co (http://www.awl.com/bc) -57- Quiz Question #2: Ion Channels This question asks
Gene annotation for heart rhythm. 1. Control of heart rate 2. Action Potential 3. Ion channels and transporters 4. Arrhythmia 5.
Gene annotation for heart rhythm 1. Control of heart rate 2. Action Potential 3. Ion channels and transporters 4. Arrhythmia 5. EC coupling Control of heart rate Autonomic regulation of heart function
By the name of Allah
By the name of Allah Receptors function and signal transduction ( Hormones and receptors Types) We were talking about receptors of the neurotransmitters; we have 2 types of receptors: 1- Ionotropic receptors
Receptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
STEIN IN-TERM EXAM -- BIOLOGY APRIL 18, PAGE
STEIN IN-TERM EXAM -- BIOLOGY 3058 -- APRIL 18, 2019 -- PAGE 1 of 9 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There is
Chapter 11: Cell Communication
Name Period Chapter 11: Cell Communication The special challenge in Chapter 11 is not that the material is so difficult, but that most of the material will be completely new to you. Cell communication
The recruitment of leukocytes and plasma proteins from the blood to sites of infection and tissue injury is called inflammation
The migration of a particular type of leukocyte into a restricted type of tissue, or a tissue with an ongoing infection or injury, is often called leukocyte homing, and the general process of leukocyte
PHRM20001 NOTES PART 1 Lecture 1 History of Pharmacology- Key Principles
PHRM20001 NOTES PART 1 Lecture 1 History of Pharmacology- Key Principles Hippocrates (5 th century BCE):... benefit my patients according to my greatest ability and judgment, and I will do no harm or injustice
Signal Transduction Pathways. Part 2
Signal Transduction Pathways Part 2 GPCRs G-protein coupled receptors > 700 GPCRs in humans Mediate responses to senses taste, smell, sight ~ 1000 GPCRs mediate sense of smell in mouse Half of all known
Vets 111/Biov 111 Cell Signalling-2. Secondary messengers the cyclic AMP intracellular signalling system
Vets 111/Biov 111 Cell Signalling-2 Secondary messengers the cyclic AMP intracellular signalling system The classical secondary messenger model of intracellular signalling A cell surface receptor binds
Biosignals, Chapter 8, rearranged, Part I
Biosignals, Chapter 8, rearranged, Part I Nicotinic Acetylcholine Receptor: A Ligand-Binding Ion Channel Classes of Receptor Proteins in Eukaryotes, Heterotrimeric G Proteins Signaling View the Heterotrimeric
Lecture 15. Signal Transduction Pathways - Introduction
Lecture 15 Signal Transduction Pathways - Introduction So far.. Regulation of mrna synthesis Regulation of rrna synthesis Regulation of trna & 5S rrna synthesis Regulation of gene expression by signals
HORMONES (Biomedical Importance)
hormones HORMONES (Biomedical Importance) Hormones are the chemical messengers of the body. They are defined as organic substances secreted into blood stream to control the metabolic and biological activities.
MCB II MCDB 3451 Exam 1 Spring, minutes, close everything and be concise!
MCB II MCDB 3451 Exam 1 Spring, 2016 50 minutes, close everything and be concise! Name ID NOTE: QUESTIONS ARE NOT ALL WORTH THE SAME POINTS Total (100) Grade EXAM 1, 2016 MCBII Name 1. Which is UNIQUE
Leen Osama, Lujain Hamdan, Osama Mohd, Razi Kittaneh... Faisal Mohammad
23 Leen Osama, Lujain Hamdan, Osama Mohd, Razi Kittaneh... Faisal Mohammad Revision of previous lectures G-proteins coupled receptors mechanism: When a hormone binds to G-protein coupled receptor, GTP
1 Higher National Unit credit at SCQF level 8: (8 SCQF credit points at SCQF level 8)
Higher National Unit specification General information Unit code: H928 35 Superclass: PB Publication date: May 2015 Source: Scottish Qualifications Authority Version: 01 Unit purpose This Unit is designed
Neuroscience: Exploring the Brain, 3e. Chapter 4: The action potential
Neuroscience: Exploring the Brain, 3e Chapter 4: The action potential Introduction Action Potential in the Nervous System Conveys information over long distances Action potential Initiated in the axon
TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
Cell signaling. How do cells receive and respond to signals from their surroundings?
Cell signaling How do cells receive and respond to signals from their surroundings? Prokaryotes and unicellular eukaryotes are largely independent and autonomous. In multicellular organisms there is a
UNIT 3: Signal transduction. Prof K Syed Department of Biochemistry & Microbiology University of Zululand Room no. 247
UNIT 3: Signal transduction Prof K Syed Department of Biochemistry & Microbiology University of Zululand Room no. 247 SyedK@unizulu.ac.za Topics Signal transduction Terminology G-protein signaling pathway
Chapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling
Chapter 20 Cell - Cell Signaling: Hormones and Receptors Three general types of extracellular signaling endocrine signaling paracrine signaling autocrine signaling Endocrine Signaling - signaling molecules
QUIZ/TEST REVIEW NOTES SECTION 7 NEUROPHYSIOLOGY [THE SYNAPSE AND PHARMACOLOGY]
![QUIZ/TEST REVIEW NOTES SECTION 7 NEUROPHYSIOLOGY [THE SYNAPSE AND PHARMACOLOGY]](/thumbs/86/94924826.jpg "QUIZ/TEST REVIEW NOTES SECTION 7 NEUROPHYSIOLOGY [THE SYNAPSE AND PHARMACOLOGY]")
QUIZ/TEST REVIEW NOTES SECTION 7 NEUROPHYSIOLOGY [THE SYNAPSE AND PHARMACOLOGY] Learning Objectives: Explain how neurons communicate stimulus intensity Explain how action potentials are conducted along
Chapter 9. Cellular Signaling
Chapter 9 Cellular Signaling Cellular Messaging Page 215 Cells can signal to each other and interpret the signals they receive from other cells and the environment Signals are most often chemicals The
Pharmacodynamics. OUTLINE Definition. Mechanisms of drug action. Receptors. Agonists. Types. Types Locations Effects. Definition
Pharmacodynamics OUTLINE Definition. Mechanisms of drug action. Receptors Types Locations Effects Agonists Definition Types Outlines of Pharmacodynamics Antagonists Definition Types Therapeutic Index Definition
Cell Communication CHAPTER 11
Cell Communication CHAPTER 11 What you should know: The 3 stages of cell communication: reception, transduction, and response. How a receptor protein recognizes signal molecules and starts transduction.
BL 424 Chapter 15: Cell Signaling; Signal Transduction
BL 424 Chapter 15: Cell Signaling; Signal Transduction All cells receive and respond to signals from their environments. The behavior of each individual cell in multicellular plants and animals must be
Receptors. Dr. Sanaa Bardaweel
Receptors Types and Theories Dr. Sanaa Bardaweel Some terms in receptor-drug interactions Agonists: drugs that mimic the natural messengers and activate receptors. Antagonist: drugs that block receptors.
Chapter 11. Cell Communication. Signal Transduction Pathways
Chapter 11 Cell Communication Signal Transduction Pathways Signal-Transduction Pathway Signal on a cell s surface is converted into a specific cellular response Local signaling (short distance) - Paracrine
Autonomic regulation of islet hormone secretion
Autonomic regulation of islet hormone secretion Implications for health and disease Billy & Bree Paper 1: Autonomic regulation of islet hormone secretion : Implications for health and disease By Team BBB
What effect would an AChE inhibitor have at the neuromuscular junction?
CASE 4 A 32-year-old woman presents to her primary care physician s office with difficulty chewing food. She states that when she eats certain foods that require a significant amount of chewing (meat),
Cell Communication. Local and Long Distance Signaling
Cell Communication Cell to cell communication is essential for multicellular organisms Some universal mechanisms of cellular regulation providing more evidence for the evolutionary relatedness of all life
BIOH111. o Cell Module o Tissue Module o Skeletal system o Muscle system o Nervous system o Endocrine system o Integumentary system
BIOH111 o Cell Module o Tissue Module o Skeletal system o Muscle system o Nervous system o Endocrine system o Integumentary system Endeavour College of Natural Health endeavour.edu.au 1 Textbook and required/recommended
Supplemental Table 1 Age and gender-specific cut-points used for MHO.
Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123
Nature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.
Supplementary Figure 1 IC261 inhibits a virus-induced type I interferon response. (a) HEK293T cells were cultured in 384 wells and transiently transfected with 50 ng of the IFN-β promoter-luc construct
Cell-Derived Inflammatory Mediators
Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,
University of Guelph Department of Chemistry and Biochemistry Structure and Function In Biochemistry
University of Guelph Department of Chemistry and Biochemistry 19-356 Structure and Function In Biochemistry Final Exam, April 21, 1997. Time allowed, 120 min. Answer questions 1-30 on the computer scoring
Chapter 6 Communication, Integration, and Homeostasis
Chapter 6 Communication, Integration, and Homeostasis About This Chapter Cell-to-cell communication Signal pathways Novel signal molecules Modulation of signal pathways Homeostatic reflex pathways Cell-to-Cell
Chapter 11 Guided Reading: Cell Communication
Name Chapter 11 Guided Reading: Cell Communication The special challenge in Chapter 11 is not that the material is so difficult, but that most of the material will be completely new to you. Cell communication
Evaluation only. Created with Aspose.PowerPoint. Copyright 2004 Aspose Pty Ltd.
Da: Cell Signalling Biology - Michael J. Berridge - www.cellsignallingbiology.org - 2009 Evaluation only. Created with Aspose.PowerPoint. Copyright 2004 Aspose Pty Ltd. Nella comunicazione chimica il recettore
Cellular Signaling Pathways. Signaling Overview
Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the
Comprehensive and Easy Course Notes for BIOL1040 Exams and Assessment
Comprehensive and Easy Course Notes for BIOL1040 Exams and Assessment MODULE 1: PRINCIPLES OF CELL FUNCTION Membrane Structure & Function Cellular membranes are fluid mosaics of lipids and proteins Phospholipids
Cellular Communication
(a) Communicating cell junctions. by direct cell-cell contact lasma membranes 1. Direct cell contact. Vesicle-mediated 3. Chemical messengers (b) Cell-cell recognition. Gap junctions between animal cells
Plasma membranes. Plasmodesmata between plant cells. Gap junctions between animal cells Cell junctions. Cell-cell recognition
Cell Communication Cell Signaling Cell-to-cell communication is essential for multicellular organisms Communicate by chemical messengers Animal and plant cells have cell junctions that directly connect
Neurotransmitters acting on G-protein coupled receptors
Neurotransmitters acting on G-protein coupled receptors Part 1: Dopamine and Norepinephrine BIOGENIC AMINES Monoamines Diamine Overview of Neurotransmitters and Their Receptors Criteria for defining a
Channelopathies. Review article Korean J Pediatr 2014;57(1):1-18. Introduction
Review article Korean J Pediatr 2014;57(1):1-18 pissn 1738-1061 eissn 2092-7258 Korean J Pediatr Channelopathies June-Bum Kim, MD, PhD Department of Pediatrics, Seoul Children s Hospital, Seoul, Korea
Warm-Up. Warm-Up. Warm-Up. Cell Communication. Cell Signaling 03/06/2018. Do bacteria communicate?
Warm-Up 1. Why do you communicate? 2. How do you communicate? 3. How do you think cells communicate? 4. Do you think bacteria can communicate? Explain. Warm-Up 1. Why are scientists studying how bacteria
Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system
Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system Basic Elements of cell signaling: Signal or signaling molecule (ligand, first messenger) o Small molecules (epinephrine,
Neuropharmacology NOTES
Neuropharmacology NOTES Contents Topic Page # Lecture 1- Intro to Neurochemical Transmission & Neuromodulation 2 Lecture 2- Serotonin & Noradrenaline 7 Lecture 3- Acetylcholine & Dopamine 14 Lecture 4-
Pharmacology Unit 1 Page 1 of 12. Learning goals for this file:
Pharmacology Unit 1 Page 1 of 12 Learning goals for this file: 1) Review receptor theory affinity, antagonists, agonists 2) Upregulation & downregulation; spare receptors 3) Types of Ligands and Receptor
Cell Communication. Cell Communication. Communication between cells requires: ligand: the signaling molecule
Cell Communication Cell Communication Communication between cells requires: ligand: the signaling molecule receptor protein: the molecule to which the ligand binds (may be on the plasma membrane or within
3.D- Cell Communication
3.D- Cell Communication Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. EU 3.A: Heritable information provides for continuity of life. EU 3.B:
2401 : Anatomy/Physiology
Dr. Chris Doumen Week 11 2401 : Anatomy/Physiology Autonomic Nervous System TextBook Readings Pages 533 through 552 Make use of the figures in your textbook ; a picture is worth a thousand words! Work
Neurological channelopathies: new insights into disease mechanisms and ion channel function
Neurologicalchannelopathies:newinsightsintodiseasemechanismsand ionchannelfunction DimitriMKullmann 1 andstephengwaxman 2 1 InstituteofNeurology,UniversityCollegeLondon,London,UK 2 DepartmentofNeurology,YaleUniversitySchoolofMedicine,NewHaven,
Cellular Communication
Cellular Communication But before we get into that What have we learned about so far? Energy and Matter Why do living things need energy? Grow Reproduce Maintain homeostasis Cellular signaling Cells communicate
Advanced Neurotransmitters & Neuroglia
Advanced Neurotransmitters & Neuroglia Otsuka Pharmaceutical Development & Commercialization, Inc. 2017 Otsuka Pharmaceutical Development & Commercialization, Inc., Rockville, MD Lundbeck, LLC. February