Orchiectomy and response to testosterone in the development of obesity in young Otsuka- Long-Evans-Tokushima Fatty (OLETF) rats

Size: px
Start display at page:

Download "Orchiectomy and response to testosterone in the development of obesity in young Otsuka- Long-Evans-Tokushima Fatty (OLETF) rats"

Transcription

1 International Journal of Obesity (1998) 22, 318±324 ß 1998 Stockton Press All rights reserved 0307±0565/98 $12.00 Orchiectomy and response to testosterone in the development of obesity in young Otsuka- Long-Evans-Tokushima Fatty (OLETF) rats H Shimizu 1, K-I Ohtani 1, Y Uehara 1, Y Abe 2, H Takahashi 1, T Tsuchiya 1, N Sato 1, Y Ibuki 2 and M Mori 1 1 The First Department of Internal Medicine and 2 Department of Obstetrics and Gynecology, Gunma University School of Medicine, Maebashi, Japan OBJECTIVE: Withdrawal of testosterone prevents the development of hyperglycaemia in male Otsuka-Long-Evans- Tokushima Fatty (OLETF) rats, a model of non-insulin-dependent diabetes mellitus (NIDDM), but the exact mechanism has not been established. The present studies were undertaken to examine a possible role of testosterone in the development of obesity in young OLETF rats who have not shown marked hyperphagia. METHODS: Body weight, food intake and circulating concentrations of metabolic factors including immunoreactive leptin (IRL) were measured at ve weeks of age in young male OLETF rats and their lean controls, Long-Evans- Tokushima-Otsuka (LETO) rats. At six weeks of age, both LETO and OLETF rats were bilaterally orchiectomized (Orchx) and half of each group implanted with a silastic tube containing testosterone. After a three week observation period, all animals were killed and circulating concentrations of metabolic factors and the ob gene expression in retroperitoneal white adipose tissues were measured. RESULTS: Body weight and 24 h food intake were already increased in OLETF rats at ve weeks of age. Serum testosterone concentrations were signi cantly lower in OLETF rats than in LETO rats. Expression of the ob gene was signi cantly decreased in the retroperitoneal white adipose tissue of OLETF rats, and their serum IRL concentrations were lower. Food intake and body weight gain for three weeks after the operation were signi cantly lower in the Orchx group of OLETF rats than in the sham-operated group. Hyperglycaemia, accompanied by hyperinsulinaemia, was attenuated by orchiectomy in OLETF rats. Circulating IRL concentrations were signi cantly higher in OLETF rats than in LETO rats and decreased by orchiectomy. Testosterone supplement reversed all of the changes caused by orchiectomy in OLETF rats. In contrast, the changes, which were observed after orchiectomy in OLETF rats, were not obvious in LETO rats. CONCLUSION: The present data indicate that testosterone plays a role in the development of obesity and NIDDM in young OLETF rats, but that changes of leptin production in white adipose tissue may not be important in the development of obesity in young OLETF rats. Keywords: leptin; obesity; Orchiectomy; Otsuka-Long-Evans-Tokushima Fatty (OLETF) rats; testosterone Introduction The Otsuka-Long-Evans-Tokushima Fatty (OLETF) rat is a model of non-insulin dependent diabetes mellitus (NIDDM), established by Kawano et al. 1 Peripheral insulin resistance precedes impairment of pancreatic b-cell function in OLETF rats, and insulin resistance seems closely related to fat deposition in the abdominal cavity of OLETF rats. 2 Caloric restriction and exercise training have been reported to be effective in preventing the development of NIDDM in OLETF rats, like other animal models of NIDDM. 3,4 On the other hand, testosterone has been found to reduce glucose intolerance. 5 Recent studies added new ndings that testosterone is involved in the Correspondence: Hiroyuki Shimizu, MD, PhD, 1st Department of Internal Medicine, Gunma University School of Medicine, Showa-machi, Maebashi Gunma 371, Japan. Received 17 July 1997; revised 14 November 1997; accepted 28 November 1997 glucose metabolism of rat skeletal muscle 6 and an increase in visceral fat accumulation. 7 Withdrawal of testosterone after orchiectomy has been reported to prevent the development of hyperglycaemia in OLETF rats, 8 indicating a possible role of testosterone in the establishment of NIDDM in this model. In contrast, ovariectomy increased the incidence of diabetes mellitus and estradiol supplement restored the incidence of diabetes mellitus in female OLETF rats. High incidences of diabetes mellitus in male rats have also been observed in Wistar Fatty rats (fa=fa) 9 and Zucker Fatty rats. 10 These data indicate that testosterone might be involved in the development of NIDDM in rodents. However, the exact mechanism by which testosterone promotes the development of hyperglycaemia has not been established in these animal models of NIDDM including OLETF rats. Recently, the ob gene has been cloned in genetically obese (ob=ob) mice, and a genetic abnormality in the ob gene resulting in low plasma leptin levels has been found to play a critical role in the development of obesity and NIDDM in this model. 11 In addition, a

2 mutation in the leptin receptor has been reported to be involved in the development of diabetes mellitus in genetically diabetic (db=db) mice and Fatty Zucker rats, 12,13 but the attempts to detect changes in ob gene expression and=or circulating leptin concentrations have not been made in OLETF rats. There is a gender difference in circulating leptin levels in humans, however. 14,15 We have recently demonstrated that estrogen increases the relative ob gene mrna levels and circulating leptin concentrations in ovariectomized Wistar rats, 16 and a signi cant difference between circulating leptin concentrations in males and postmenopausal women has been found in our study and another report, indicating the involvement of androgen in the gender difference of circulating leptin levels in humans. 15,16 ; Since testosterone is thought to be involved in the development of NIDDM in OLETF rats, there is a possibility that ob gene expression may be altered in these rats. The present studies were undertaken to examine a possible role of testosterone in the development of obesity in young OLETF rats which do not yet show clear hyperglycaemia. In addition, strain differences and the effects of orchiectomy and testosterone supplement on adipose tissue leptin production were investigated in this model of NIDDM. Materials and methods Animals Both OLETF rats and their lean controls, Long-Evans- Tokushima-Otsuka (LETO) rats, were kindly provided by Tokushima Research Institute (Otsuka Pharmaceutical, Tokushima, Japan). The LETO rats are lean controls which are obtained from the same colonies of Long-Evans rats, and therefore, have the same genetic backgrounds as OLETF rats. All animals were maintained in a temperature-controlled room (22 1 C). They were supplied with standard rat Purina chow pellets (Oriental Yeast, Osaka, Japan) and tap water ad libitum. Body weight and daily food intake were measured in young male LETO and OLETF rats at the age of ve weeks. After the measurement of daily food intake for three days, the animals were killed. Rightside subcutaneous, right-side whole retroperitoneal and total mesenteric white adipose tissues (SWAT, RWAT, MWAT) were immediately dissected according to the method of Krotkiewski and BjoÈrntorp. 17 The upper area of SWAT is the caudal border of the xiphoid process of the sternum and the lower, urological organ and side, the dorsal and ventral midline of the body. The weight of SWAT, RWAT, MWAT was measured after blood collection. A sample of fat mass was immediately dissected from right RWAT and used for the ob gene mrna determination, as Testosterone and obesity in young OLETF rats described below. After centrifugation, the obtained sera were frozen at 720 C until assayed. In the second experiment, both LETO and OLETF rats were sham-operated or bilaterally orchiectomized (Orchx) at six weeks of age and half of them were implanted with a silastic tube containing testosterone. Bilateral orchiectomy was performed through scrotal incision under light ether anaesthesia. In Orchx rats with testosterone supplement, 1 cm of the silastic tube (inner diameter 1.56 mm, outer diameter 3.15 mm; Dow Corning Corporation, Midland, MI, USA) containing 3 mg testosterone (Sigma Chemical Co, St Louis, MO, USA) was simultaneously implanted through a small incision in the skin over the back of anaesthetized rats, according to the method of Morin and Cummings. 18 Changes in body weight and daily food intake were observed for three weeks after the operation. Following three-week observation, all animals were killed and a piece of RWAT was immediately dissected and used for the determination of ob gene mrna expression. After centrifugation sera were also kept at 720 C before assay. Determination of ob gene mrna expression The fat mass sample was sonicated in 0.8 ml of Isogene (Nippon Gene, Tokyo, Japan) and centrifuged at rpm for 10 min. The supernatant containing total RNA was taken from each sample and total RNA was extracted according to the protocol supplied by the manufacturer. Then, ob gene and b-actin mrna expression were measured by the reverse transcription-polymerase chain reaction (RT-PCR) method, using the following primers for the ob gene: forward primer; 5 0 -TGTCGGTTCCTGTGGCTTTG-3 0, backward primer; 5 0 -AGGCTGGTGAGGACCTGTTGATAG- 3 0, according to the cdna sequence of rat ob gene. 19 First strand cdna was synthesized from the obtained total RNA as described in the Gene Amp EZ rtth RNA PCR kit (Perkin Elmer, Branchburg, NJ, USA) containing 1.0 U rtth DNA polymerase, 3 nmole of dctp, dgtp, dttt, datp, and 5 pmole of each primer in 10 ml volume overlaid with mineral oil. PCR was performed for 31 cycles using a 1-min denaturation step at 94 C, a 1-min annealing step at 50 C and a 1-min extension step at 72 C. An additional 7-min extension step at 72 C was added after 31 cycles which were selected according to our preliminary results con rming the linear increase of both ob gene and b-actin mrna. PCR products were electrophoresed on a 6% polyacrylamide gel and visualized by ultraviolet uorescence following ethidium bromide staining. The intensity of uorescence of the band was calculated by NIH image. Assays Serum immunoreactive leptin (IRL) concentrations were measured with a radioimmunoassay (RIA) kit 319

3 320 Testosterone and obesity in young OLETF rats for rat leptin (Linco Research; Inc, St Charles, MO, USA). 20 The limit of sensitivity for the rat IRL assay is 0.5 ng/ml. Within- and between-assay variations were 2.0±4.6%, 3.0±5.7%, respectively. Serum immunoreactive insulin (IRI) concentrations were assayed with a commercially available RIA kit (Phadeceph Insulin, Pharmacia Japan, Tokyo, Japan) using rat insulin (Novo Nordisk A=S, Gentofte, Denmark) as a standard. Serum glucose concentrations were analyzed with an automatic analyzer by the glucose oxidase method. Serum LH and FSH concentrations were assayed by RIA using immuno-reagents provided by the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK). Serum estradiol (E 2 ) concentrations were measured by RIA using an Estradiol Cortoria kit (CIS Diagnostic, Inc, Chiba, Japan). Serum corticosterone concentrations were measured by RIA using anti-corticosterone serum (corticosterone-3-cmo-3- SA). 21 Serum testosterone concentration was assayed by RIA using a DPC Total Testosterone Kit (Nippon DPC Corp, Tokyo, Japan). but the differences were not statistically signi cant between them. There was no difference in the MWAT=SWAT (M=S) ratio, indicating that both fat compartments were increased by the same percentage. The weight of the testis was slightly, but not signi cantly lower in OLETF rats. Table 2 shows changes of humoral factors in both strains. Blood glucose and serum IRI concentrations were not signi cantly higher in OLETF rats than in LETO rats. Serum testosterone concentrations were signi cantly lower in OLETF rats than in LETO rats. In contrast, serum estradiol (E 2 ) levels in OLETF rats were not different from those of LETO rats, indicating that the conversion of testosterone to E 2 may be enhanced in white adipose tissues of OLETF rats. The ratio of ob gene mrna levels to b-actin mrna levels was signi cantly decreased in RWAT of OLETF rats (LETO rats: arbitrary units, OLETF rats: arbitrary units, P < 0.01). Subsequently, serum IRL concentrations tended to be lower in OLETF rats than in LETO rats, as shown in Table 2. Statistics All data are expressed as means s.e.m. Statistical analysis was performed by the analysis of variance (ANOVA), followed by Duncan's multiple range test for individual comparisons of the means. Results i) Body weight, food intake and various metabolic factors at ve weeks of age As shown in Table 1, body weight and food intake for 24 h were already increased in OLETF rats at ve weeks of age. The weight of each white adipose tissue tended to be heavier in OLETF rats than in LETO rats, ii) Effect of orchiectomy on body weight gain, daily food intake for three weeks and changes in various metabolic factors Figure 1 and Figure 2 show chronological changes in daily food intake and body weight gain for three weeks after the operation. OLETF rats showed signi cant increases in daily food intake and body weight gain for those three weeks, compared to LETO rats. Orchiectomy signi cantly inhibited hyperphagia of OLETF rats, and subsequently, decreased body weight gain for the three weeks. Testosterone supplement reversed the effects of orchiectomy on daily food intake and body weight gain of OLETF rats. In contrast, the effects of orchiectomy on daily food intake and body weight gain were not observed in LETO rats. Table 1 Changes in body weight, food intake, weight of white adipose tissue, testicular weight in Long-Evans-Tokushima-Otsuka (LETO) and Otsuka-Long-Evans-Tokushima Fatty (OLETF) rats at the age of ve weeks n Food intake (g/d) Body weight (g) SWAT (mg) RWAT (mg) MWAT (mg) M/S Testis (mg) LETO OLETF Statistics P < 0.01 P < NS NS NS NS NS n ˆ number of rats in each group; SWAT ˆ subcutaneous white adipose tissue; RWAT ˆ retroperitoneal white adipose tissue; MWAT ˆ mesenteric white adipose tissue; M/S ˆ MWAT weight/swat weight; NS ˆ statistically not signi cant Table 2 Changes of humoral metabolic factor levels in Long-Evans-Tokushima-Otsuka (LETO) and Otsuka-Long-Evans-Tokushima- Fatty (OLETF) rats at ve weeks of age n BG (mmol/l) IRI (pmol/l) IRL (ng/ml) T (nmol/l) E 2 (pmol/l) E 2 /T Corticosterone (nmol/l) LETO OLETF Statistics NS NS NS P < 0.05 NS P < 0.01 NS n ˆ number of rats in each group; BG ˆ blood glucose; IRI ˆ immunorective insulin; IRL ˆ immunoreactive leptin; T ˆ testosterone; E 2 ˆ estradiol; NS ˆ statistically not signi cant

4 Testosterone and obesity in young OLETF rats 321 Figure 1 Chronological changes of daily food intake after orchiectomy and testosterone supplement in Long-Evans-Tokushima- Otsuka (LETO) and Otsuka-Long-Evans-Tokushima Fatty (OLETF) rats. Sham: sham-operated. O: bilaterally orchiectomized, O T: testosterone supplemented with bilateral orchietomy. n ˆ 5 in each group. serum IRL levels in both strains. The relative ob gene mrna levels in RWAT of OLETF rats were no different from these in LETO rats at this age. Orchiectomy signi cantly decreased the relative ob gene mrna levels in OLETF rats and testosterone supplement reversed the reduction of the relative ob gene mrna levels by orchiectomy. Serum IRL levels were signi cantly higher in OLETF rats than in LETO rats. Serum IRL levels were signi cantly decreased by orchiectomy in OLETF rats and testosterone supplement completely reversed the reduction of serum IRL levels by orchiectomy. However, those changes on the relative ob gene mrna and serum IRL levels were not observed in LETO rats. Figure 2 Changes of body weight gain three weeks after orchietomy and testosterone supplement in Long-Evans-Tokushima- Otsuka (LETO) and Otsuka-Long-Evans-Tokushima Fatty (OLETF) rats. Sham: sham-operated, Orchx: bilaterally orchiectomized, Orchx T: bilaterally orchiectomized with testosterone supplement. n ˆ 5 in each group. Changes of circulating hormonal and metabolic factor levels in both strains after orchiectomy are shown in Table 3. OLETF rats had higher levels of serum glucose, IRI, LH and FSH than LETO rats. Serum testosterone levels were signi cantly lower in OLETF rats, but serum E 2 levels were signi cantly higher, suggesting that the conversion of testosterone to E 2 was enhanced in OLETF rats even at this age. Orchiectomy signi cantly lowered the increase in blood glucose and serum IRI concentrations of OLETF rats, and testosterone supplement restored these effects, but any signi cant effects of orchiectomy on blood glucose or serum IRI concentrations were not observed in LETO rats. Figure 3 demonstrated changes in the relative ratio of the ob gene mrna levels to b-actin mrna and Discussion The origin of obesity and peripheral insulin resistance in male OLETF rats is still unknown. There is a sexual dimorphism in the development of the obesity and peripheral insulin resistance in OLETF rats. 2 It has been reported that withdrawal of estrogen by ovariectomy, induced obesity and increased the incidence of diabetes mellitus in this animal model. Therefore, it is supposed that the induction of obesity may be related to peripheral insulin resistance in OLETF rats and that sex hormone may involve the development of peripheral insulin resistance, through modulating food intake and body weight gain. The present studies demonstrated that withdrawal of testosterone by orchiectomy prevented the development of obesity and glucose intolerance in young OLETF rats, whereas it had no signi cant effects in the control LETO rats. In the rst experiment, serum testosterone concentrations were signi cantly lower in OLETF rats than in LETO rats, and the weight of the testis was lower at ve weeks of age in OLETF rats.

5 Testosterone and obesity in young OLETF rats 322 Table 3 Changes in humoral metabolic factors concentrations at three weeks after orchiectomy (Orchx) and testosterone (T) supplement in Long-Evans-Tokushima-Otsuka (LETO) and Otsuka- Long-Evans-Tokushima Fatty (OLETF) rats n BG(mmol/l) IRI(pmol/l) LH(ng/ml) FSH(ng/ml) T(nmol/l) E 2 (pmol/l) E 2 /T Corticosterone (ng/ml) LETO Sham Orchx **** **** ND ND Orchx T **** * OLETF Sham ** ** ** ** ** Orchx **** *** **** ND ND Orchx T *** n ˆ number in each group; ND ˆ not detectable; BG ˆ blood glucose; IRI ˆ immunoreactive insulin; T ˆ testosterone; E 2 ˆ estradiol. * P < 0.05, ** P < 0.01 vs LETO rats, *** P < 0.05, **** P < 0.01 vs sham-operated rats in each strain. However, serum corticosterone concentrations were higher in OLETF rats. Since the E 2 /testosterone ratio was signi cantly increased in OLETF rats, the aromatase activity appears to be enhanced in adipose tissues of this strain. Serum testosterone levels in OLETF rats gradually increased with growth at 10 weeks of age (sham-operated rats in the second experiment), but were still lower than in LETO rats, and the reduction of circulating testosterone was accompanied by an increase of serum LH, FSH levels in OLETF rats. These ndings are indicative of reduced gonadal testosterone synthesis and=or secretion in young OLETF rats. In the second experiment, orchiectomy improved both hyperglycaemia and hyperinsulinaemia, indicating improved peripheral insulin resistance by orchiectomy in OLETF rats, in spite of the preceding hypogonadism. In general, castration in male rats is followed by insulin resistance in muscle, alleviated by testosterone substitution. 22 Our previous data have shown that withdrawal of testosterone by bilateral orchiectomy failed to affect body weight gain, hyperglycaemia, and hyperinsulinaemia in genetically obese (ob=ob) mice. 23 Therefore, an improvement of obesity and peripheral insulin resistance by orchiectomy might be speci c to OLETF rats. Taking into consideration our observations, it is proposed that the sensitivity to testosterone, regarding the development of peripheral insulin resistance perhaps in skeletal muscles and adipose tissues, may be enhanced in these obese rats and the complete withdrawal of testosterone should be necessary to improve peripheral insulin resistance in these rats. Adipose tissue ob gene mrna levels were decreased in young OLETF rats at ve weeks of age and gradually increased to the same level as in LETO rats at 10 weeks of age. Circulating IRL concentrations were lower at the age of ve weeks in young OLETF rats, but signi cantly increased by 10 weeks of age, as a result of increases in ob gene expression and total body fat mass in OLETF rats. Orchiectomy signi cantly decreased both the relative ob gene mrna levels and serum IRL concentrations, and testosterone supplement restored the effects of orchiectomy on the ob gene mrna levels and serum IRL concentrations in OLETF rats. The concentrations of E 2, which is involved in ob gene expression, 16 were unaffected by orchiectomy and testosterone supplement in OLETF rats. These observations indicate that changes in ob gene expression of OLETF rats can be attributable to testosterone. Leptin, the ob gene product, is thought to act on the central feeding center to inhibit food intake in rats. 24 The abnormalities in expression of the ob gene and the ob receptor gene have been reported in various models of obesity and NIDDM, 11±13,25 but the involvement of leptin has not been investigated in this model of NIDDM. While OLETF rats showed a hyperphagia with a decrease in circulating leptin concentrations at ve weeks of age, daily food intake of these rats

6 Testosterone and obesity in young OLETF rats 323 Figure 3 Changes of the ratio of ob gene mrna expression to b-actin mrna expression in retroperitoneal white adipose tissue (a) and serum immunoreactive leptin (IRL) levels (b) in Long-Evans-Tokushima-Otsuka (LETO) and Otsuka-Long-Evans-Tokushima Fatty (OLETF) rats at three weeks after orchiectomy (Orchx) and testosterone (T) supplement. n ˆ 5 in each group. was increased at the age of 10 weeks, with a signi cant increase in circulating leptin levels. In addition, orchiectomy, which improved hyperglycaemia and hyperinsulinaemia, decreased body weight in OLETF rats, and also both ob gene expression and serum IRL levels as a result. The reduction of body fat mass and the reduction of circulating leptin, leading to the diminished anorexigenic message, did not cause hyperphagia in OLETF rats. The changes observed in the relative ob gene mrna expression and circulating leptin levels did not parallel the changes of daily food consumption in OLETF rats. These observations indicate that the observed changes in ob gene expression and circulating leptin may not be important in the development of obesity in young OLETF rats. The data obtained herein indicate that testosterone plays an important role in the development of obesity and peripheral insulin resistance in young OLETF rats. However, changes in leptin production, from increased fat mass, may not be important in the development of obesity in this animal model of NIDDM. References 1 Kawano K, Hirashima T, Mori S, Saitoh Y, Kurosumi M, Natori T. Spontaneous long-term hyperglycemia rats with diabetic complications: Otsuka Long-Evans Tokushima Fatty (OLETF) strain. Diabetes 1992; 41: 1422± Ishida K, Mizuno A, Min Z, Sano T, Shima K. Which is the primary etiologic event in Otsuka Long-Evans Tokushima Fatty rats, a model of spontaneous non-insulin-dependent diabetes mellitus, insulin resistance, or impaired insulin secretion? Metabolism 1995; 44: 940± Okauchi N, Mizuno A, Yoshimoto S, Zhu M, Sano T, Shima K. Is caloric restriction effective in preventing diabetes mellitus in the Otsuka Long Evans Tokushima Fatty rat, a model of spontaneous non-insulin-dependent diabetes mellitus? Diab Res Clin Pract 1995; 27: 97± Shima K, Shi K, Sano T, Iwami T, Mizumo A, Noma Y. Is exercise training effective in preventing diabetes mellitus in the Otsuka Long Evans Tokushima Fatty rat, a model of spontaneous non-insulin-dependent diabetes mellitus? Metabolism 1993; 42: 971± Shoupe D, Lobo RA. The in uence of androgens on insulin resistance. Fertil Steril 1984; 41: 385± Rincon J, Holmang A, WahlstroÈm EO, Lonnroth P, BjoÈrntorp P, Zielrath JR, Wallberg-Henriksson H. Mechanism behind insulin resistance in rat skeletal muscle after oophorectomy and additional testosterone treatment. Diabetes 1996; 45: 615± Russell JC, Amy RM, Graham S, Wenzel LM, Dolphin PJ. Effect of castration on hyperlipidemic, insulin resistant JCR: LA-corpulent rats. Artherosclerosis 1993; 100: 113± Shi K, Mizuno A, Sano T, Ishida K, Shima K. Sexual difference in the incidence of diabetes mellitus in Otsuka- Long-Evans-Tokushima-Fatty rats: effects of castration and sex hormone replacement on its incidence. Metabolism 1994; 43: 1214± Ikeda H, Shino A, Mastuo T, Iwatsuka H, Suzuoki Z. A new genetically obese- hyperglycemic rat (Wistar Fatty). Diabetes 1981; 30: 1045± Clark JB, Palmer CJ, Shaw WN. The diabetic Zucker Fatty rat. Proc Soc Exp Biol Med 1983; 173: 68± Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM. Positional cloning of the mouse obese gene and its human homologue. Nature 1994; 372: 425± Chua SC Jr, Chung WK, Wu-Peng XS, Zhang Y, Liu S-M, Tartaglia L, Leibel RL. Phenotypes of mouse diabetes and rat Fatty due to mutations in the OB (leptin) receptor. Science 1996; 271: 994± Phillips MS, Liu Q, Hammond HA, Dugan V, Hey PJ, Caskey CT, Hess JF. Leptin receptor missense mutation in the Fatty Zucker rat. Nature Gen 1996; 13: 18± Havel PJ, Kasim-Karakas S, Dubuc GR, Mueller W, Phinney SD. Gender differences in plasma leptin concentrations. Nature Med 1996; 2: 949± Rosenbaum M, Nicolson M, Hirsch J, Heyms eld SB, Gallagher D, Chu F, Leibel RL. Effects of gender, body composition, and menopause on plasma concentrations of leptin. J Clin Endocrinol Metab 1996; 81: 3424± Shimizu H, Shimomura Y, Nakanishi Y, Futawatari T, Ohtani K, Sato N, Mori M. Estrogen increases in vivo leptin production in rats and human subjects. J Endocr 1997; 154: 285±292.

7 324 Testosterone and obesity in young OLETF rats 17 Krotkiewski M, BjoÈrntorp P. The effect of progesterone and of insulin administration on regional adipose tissue cellularity in the rat. Acta Physiol Scand 1976; 96: 122± Morin LP, Cummings LA. Splitting of wheelrunning rhythms by castrated or steroid treated male and female hamsters. Physiol Behav 1982; 29: 665± Sivitz WI, Bailey HL, Donohoue P. Rat adipose ob mrna levels in states of altered circulating glucose and insulin. Biochem Biophys Res Commun 1996; 220: 520± Maffei M, Halaas J, Ravussin E, Pratley RE, Lee GH, Zhang Y, Fei H, Kim S, Lallone R, Ranganathan S, Kern PA, Friedman JM. Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Nature Med 1995; 1: 1155± Shimizu H, Uehara Y, Mori M. Probucol attenuates reduction of serum immunoreactive insulin levels by interleukin in adrenalectomized rats. Pharmacology 1992; 44: 344± BjoÈrntorp P. Insulin resistance: the consequence of a neuroendocrine disturbance? Int J Obes 19 (Suppl 1): S6±S Shimizu H, Ohshima K, Bray GA, Peterson M, Swerdloff RS. Adrenalectomy and castration in the genetically obese (OB/ OB) mouse. Obes Res 1993; 1: 377± Cusin I, Rohner-Jeanrenaud F, Stricker-Krongrad A, Jeanrenaud B. The weight-reducing effect of an intracerebroventricular bolus injection of leptin in genetically obese fa/fa rats. Reduced sensitivity compared with lean animals. Diabetes 1996; 45: 1446± Takaya K, Ogawa Y, Hiraoka J, Hosoda K, Yamori Y, Nakao K. Nonsense mutation of leptin receptor in the obese spontaneously hypertensive Koletsky rat. Nature Gen 1996; 14: 130±131.

Yiying Zhang, PhD Research Scientist. Research Summary:

Yiying Zhang, PhD Research Scientist. Research Summary: Yiying Zhang, PhD Research Scientist Research Summary: Address: Naomi Berrie Diabetes Center at Columbia University Medical Center Russ Berrie Medical Science Pavilion 1150 St. Nicholas Avenue New York,

More information

Serum leptin concentration is associated with total body fat mass, but not abdominal fat distribution

Serum leptin concentration is associated with total body fat mass, but not abdominal fat distribution International Journal of Obesity (1997) 21, 536±541 ß 1997 Stockton Press All rights reserved 0307±0565/97 $12.00 Serum leptin concentration is associated with total body fat mass, but not abdominal fat

More information

Plasma Leptin in Obese Subjects and Diabetics

Plasma Leptin in Obese Subjects and Diabetics Endocrine Journal 1997, 44(5), 671-676 Human Plasma Leptin in Obese Subjects and Diabetics YosHIMASA TASAKA, KEIKD YANAGISAWA, AND YASUHIKO IWAMOTO Diabetes Center, Tokyo Women's Medical College, Tokyo

More information

A High Biotin Diet Improves the Impaired Glucose Tolerance of Long-Term Spontaneously Hyperglycemic Rats with Non-Insulin-Dependent Diabetes Mellitus

A High Biotin Diet Improves the Impaired Glucose Tolerance of Long-Term Spontaneously Hyperglycemic Rats with Non-Insulin-Dependent Diabetes Mellitus J. Nutr. Sci. Vitaminol., 42, 517-526, 1996 A High Biotin Diet Improves the Impaired Glucose Tolerance of Long-Term Spontaneously Hyperglycemic Rats with Non-Insulin-Dependent Diabetes Mellitus Hong ZHANG,1,*

More information

Low ambient temperature lowers cholecystokinin and leptin plasma concentrations in adult men

Low ambient temperature lowers cholecystokinin and leptin plasma concentrations in adult men ISPUB.COM The Internet Journal of Gastroenterology Volume 7 Number 2 Low ambient temperature lowers cholecystokinin and leptin plasma concentrations in adult men M Pizon, P Tomasic, K Sztefko, Z Szafran

More information

Leptin levels and menstrual function in HIV-infected women in rural India

Leptin levels and menstrual function in HIV-infected women in rural India Leptin levels and menstrual function in HIV-infected women in rural India Annie Phoebe. K¹, Mini Jacob.S¹, Hemalatha.R², Sivakumar M.R¹ ¹Department of Experimental Medicine, The Tamil Nadu Dr. MGR Medical

More information

Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice

Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice Am J Physiol Regul Integr Comp Physiol 284: R87 R100, 2003; 10.1152/ajpregu.00431.2002. Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice HEATHER

More information

Metabolic changes in menopausal transition

Metabolic changes in menopausal transition Metabolic changes in menopausal transition Terhi T. Piltonen M.D., Associate Professor Consultant, Clinical Researcher for the Finnish Medical Foundation Department of Obstetrics and Gynecology PEDEGO

More information

Effect of Orchiectomy on Pituitary Secretion of ACTH MARY D. COYNE AND JULIAN I. KITAY

Effect of Orchiectomy on Pituitary Secretion of ACTH MARY D. COYNE AND JULIAN I. KITAY Excerpted from: Journal Title: Endocrinology. Volume: 89 Issue: 4 October 1971 Pages: 1024-8 Effect of Orchiectomy on Pituitary Secretion of ACTH MARY D. COYNE AND JULIAN I. KITAY Department of Physiology,

More information

Plasma Membrane Content of Glucose Transporter 4 in Skeletal Muscle and Visceral Fat in OLETF Rats Treated with Troglitazone

Plasma Membrane Content of Glucose Transporter 4 in Skeletal Muscle and Visceral Fat in OLETF Rats Treated with Troglitazone Journal of Health Science, 46(6) 441 446 (2000) 441 Plasma Membrane Content of Glucose Transporter 4 in Skeletal Muscle and Visceral Fat in OLETF Rats Treated with Troglitazone Yanjun Liu,*, a Jianzhong

More information

Introduction. Leptin secretion after a high-fat meal in normal-weight rats: strong predictor of long-term body fat accrual on a high-fat diet

Introduction. Leptin secretion after a high-fat meal in normal-weight rats: strong predictor of long-term body fat accrual on a high-fat diet Leptin secretion after a high-fat meal in normal-weight rats: strong predictor of long-term body fat accrual on a high-fat diet - Diet - Activity - Genetics etc. Introduction Obesity - Cardiovascular disease

More information

Leptin and Its Relation to Obesity and Insulin

Leptin and Its Relation to Obesity and Insulin Int. Jnl. Experimental Diab. Res., Vol. 2, pp. 217-223 Reprints available directly from the publisher Photocopying permitted by license only (C) 2001 OPA (Overseas Publishers Association) N.V. Published

More information

Chronic Stimulation of Leptin on Food Intake and Body Weight after Microinjection into the Ventromedial Hypothalamus of Conscious Rats

Chronic Stimulation of Leptin on Food Intake and Body Weight after Microinjection into the Ventromedial Hypothalamus of Conscious Rats TAJ December 2006; Volume 19 Number 2 ISSN 1019-8555 The Journal of Teachers Association RMC, Rajshahi Original Article Chronic Stimulation of Leptin on Food Intake and Body Weight after Micro into the

More information

WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH

WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State

More information

Metabolic responses to leptin in obese db/db mice are strain dependent

Metabolic responses to leptin in obese db/db mice are strain dependent Am J Physiol Regulatory Integrative Comp Physiol 281: R115 R132, 2001. Metabolic responses to leptin in obese db/db mice are strain dependent RUTH B. S. HARRIS, TIFFANY D. MITCHELL, XIAOLANG YAN, JACOB

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Figure 1: The leptin/melanocortin pathway Neuronal populations propagate the signaling of various molecules (leptin, insulin, ghrelin) to control

Figure 1: The leptin/melanocortin pathway Neuronal populations propagate the signaling of various molecules (leptin, insulin, ghrelin) to control Leptin Deficiency Introduction The leptin/melanocortin pathway plays a key role in the hypothalamic control of food intake. It is activated following the systemic release of the adipokine leptin (LEP)

More information

Regulation of serum leptin levels by gonadal function in rats

Regulation of serum leptin levels by gonadal function in rats European Journal of Endocrinology (1999) 140 468 473 ISSN 0804-4643 Regulation of serum leptin levels by gonadal function in rats L Pinilla 1, L M Seoane 2, L Gonzalez 1, E Carro 2, E Aguilar 1, F F Casanueva

More information

Original Research Article

Original Research Article IUBMB Life, 48: 109±113, 1999 Copyright c 1999 IUBMB 1521-6543/99 $12.00 +.00 Original Research Article Effects of Genetic and Diet-Induced Obesity on Lipid Metabolism Roksan Libinaki, Mark Heffernan,

More information

A Novel Adipocytokine, Visceral Adipose Tissue-derived Serine Protease Inhibitor (Vaspin), and Obesity

A Novel Adipocytokine, Visceral Adipose Tissue-derived Serine Protease Inhibitor (Vaspin), and Obesity The Journal of International Medical Research 2008; 36: 625 629 A Novel Adipocytokine, Visceral Adipose Tissue-derived Serine Protease Inhibitor (Vaspin), and Obesity Q LI 1,2, R CHEN 2,3, J MORIYA 2,

More information

Introduction. S Lin 1, TC Thomas 1, LH Storlien 1 and XF Huang 1 *

Introduction. S Lin 1, TC Thomas 1, LH Storlien 1 and XF Huang 1 * (2000) 24, 639±646 ß 2000 Macmillan Publishers Ltd All rights reserved 0307±0565/00 $15.00 www.nature.com/ijo Development of high fat diet-induced obesity and leptin resistance in C57Bl=6J mice S Lin 1,

More information

Leptin concentrations in the follicular phase of spontaneous cycles and cycles superovulated with follicle stimulating hormone

Leptin concentrations in the follicular phase of spontaneous cycles and cycles superovulated with follicle stimulating hormone Human Reproduction vol.13 no.5 pp.1152 1156, 1998 Leptin concentrations in the follicular phase of spontaneous cycles and cycles superovulated with follicle stimulating hormone I.E.Messinis 1,4, S.Milingos

More information

Effects of Starvation on Glycogen Contents of Heart, Skeletal Muscle and Liver in Several Mammals

Effects of Starvation on Glycogen Contents of Heart, Skeletal Muscle and Liver in Several Mammals Effects of Starvation on Glycogen Contents of Heart, Skeletal Muscle and Liver in Several Mammals Mitsuto MATSUMOTO and Tatsuo HAMADA National Institute of Animal Industry, Tsukuba Norindanchi P. O. Box

More information

Leptin Concentrations in Women in the San Antonio Heart Study: Effect of Menopausal Status and Postmenopausal Hormone Replacement Therapy

Leptin Concentrations in Women in the San Antonio Heart Study: Effect of Menopausal Status and Postmenopausal Hormone Replacement Therapy American Journal of EpWemtokagy Copyright O 1997 by The Johns Hopkins University School of Hygiene and Public Health All rights reserved Vol. 146, No. 7 Printed In USA. A BRIEF ORIGINAL CONTRIBUTION Leptin

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

Western Blot Analysis of Rat Pituitar Recognized by Human Antipituitary. y Antigens A. antibodies

Western Blot Analysis of Rat Pituitar Recognized by Human Antipituitary. y Antigens A. antibodies Endocrine Journal 1995, 42(1), 115-119 NOTE Western Blot Analysis of Rat Pituitar Recognized by Human Antipituitary y Antigens A ntibodies SHIGEKI YABE, MASAMI MURAKAMI*, KAYOKO MARUYAMA, HIDEKO MIWA,

More information

Corporate Medical Policy Testosterone Pellet Implantation for Androgen Deficiency

Corporate Medical Policy Testosterone Pellet Implantation for Androgen Deficiency Corporate Medical Policy Testosterone Pellet Implantation for Androgen Deficiency File Name: Origination: Last CAP Review: Next CAP Review: Last Review: testosterone_pellet_implantation_for_androgen_deficiency

More information

An Evidence-based Review of Clinical Trial Data

An Evidence-based Review of Clinical Trial Data An Evidence-based Review of Clinical Trial Data Karen K. Miller, MD Massachusetts General Hospital Harvard Medical School Boston, MA 1 Rationale for Investigating Androgen Administration in Women: Data

More information

Ruth B. S. Harris, Tiffany D. Mitchell, Xiaolang Yan, Jacob S. Simpson and Stephen M. Redmann, Jr.

Ruth B. S. Harris, Tiffany D. Mitchell, Xiaolang Yan, Jacob S. Simpson and Stephen M. Redmann, Jr. Metabolic responses to leptin in obesedb/db mice are strain dependent Ruth B. S. Harris, Tiffany D. Mitchell, Xiaolang Yan, Jacob S. Simpson and Stephen M. Redmann, Jr. Am J Physiol Regul Integr Comp Physiol

More information

The somatopause. What stops our growth and diminishes GH secretion?

The somatopause. What stops our growth and diminishes GH secretion? The somatopause What stops our growth and diminishes GH secretion? What extends or stops statural growth? Statural growth is extended if the early growth rate is slowed underfed adolescents grow for a

More information

THE PHENOTYPE OF the ob/ob mouse is characterized by

THE PHENOTYPE OF the ob/ob mouse is characterized by 0013-7227/01/$03.00/0 Endocrinology 142(8):3421 3425 Printed in U.S.A. Copyright 2001 by The Endocrine Society Leptin-Deficient Mice Backcrossed to the BALB/cJ Genetic Background Have Reduced Adiposity,

More information

Leptin, the product of the ob gene (1), is a satiety

Leptin, the product of the ob gene (1), is a satiety The Weight-Reducing Effect of an Intracerebroventricular Bolus Injection of Leptin in Genetically fa/fa Rats Reduced Sensitivity Compared With Animals Isabelle Cusin, Franchise Rohner-Jeanrenaud, Alain

More information

Serum Leptin Levels in Women throughout Life; Relationship to Body Mass Index and Serum Estradiol Levels

Serum Leptin Levels in Women throughout Life; Relationship to Body Mass Index and Serum Estradiol Levels Serum Leptin Levels in Women throughout Life; Relationship to Body Mass Index and Serum Estradiol Levels Masayo YAMADA, Toshiya MATSUZAKI, Takeshi IWASA, Fumi SHIMIZU, Naoko TANAKA, Rie OGATA, Machiko

More information

Leptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph

Leptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Leptin Intro/Signaling ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Overview Intro to Leptin Definition & Sources Physiology Bound vs. Free Receptors Signaling JAK/STAT MAPK PI3K ACC Experimental findings

More information

CHANGES IN SERUM LEPTIN LEVELS DURING FASTING AND FOOD LIMITATION IN STELLER SEA LIONS

CHANGES IN SERUM LEPTIN LEVELS DURING FASTING AND FOOD LIMITATION IN STELLER SEA LIONS CHANGES IN SERUM LEPTIN LEVELS DURING FASTING AND FOOD LIMITATION IN STELLER SEA LIONS (EUMETOPIAS JUBATUS). Lorrie D. Rea * 1 Tim R. Nagy 2 1 Department of Biology, University of Central Florida, Orlando,

More information

Effect of Immune Challenge on Different Genotypes: How Sick Do They Get?

Effect of Immune Challenge on Different Genotypes: How Sick Do They Get? Introduction Effect of Immune Challenge on Different Genotypes: How Sick Do They Get? M.T. Leininger, C.P. Portocarrero, C.A. Bidwell, M.E. Spurlock, J.N. Nielsen, and K.L. Houseknecht Department of Animal

More information

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and

More information

Keywords OLETF, xylose, SGLT1, intestinal hypertrophy, glucose absorption, postprandial hyperglycaemia.

Keywords OLETF, xylose, SGLT1, intestinal hypertrophy, glucose absorption, postprandial hyperglycaemia. Diabetologia (1998) 41: 1459±1466 Ó Springer-Verlag 1998 Increased intestinal glucose absorption and postprandial hyperglycaemia at the early step of glucose intolerance in Otsuka Long-Evans Tokushima

More information

Relationship between bone resorption and adrenal sex steroids and their derivatives in oophorectomized women

Relationship between bone resorption and adrenal sex steroids and their derivatives in oophorectomized women FERTILITY AND STERILITY VOL. 82, NO. 6, DECEMBER 2004 Copyright 2004 American Society for Reproductive Medicine Published by Elsevier Inc. Printed on acid-free paper in U.S.A. Relationship between bone

More information

Hormones and the Endocrine System Chapter 45. Intercellular communication. Paracrine and Autocrine Signaling. Signaling by local regulators 11/26/2017

Hormones and the Endocrine System Chapter 45. Intercellular communication. Paracrine and Autocrine Signaling. Signaling by local regulators 11/26/2017 Hormones and the Endocrine System Chapter 45 Intercellular communication Endocrine signaling Local regulators Paracrine and autocrine signaling Neuron signaling Synaptic and neuroendocrine signaling Paracrine

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week

More information

TITLE: Adipose Estrogen and Increased Breast Cancer Risk in Obesity: Regulation by Leptin and Insulin

TITLE: Adipose Estrogen and Increased Breast Cancer Risk in Obesity: Regulation by Leptin and Insulin AD Award Number: W81XWH-05-1-0497 TITLE: Adipose Estrogen and Increased Breast Cancer Risk in Obesity: Regulation by Leptin and Insulin PRINCIPAL INVESTIGATOR: Fahumiya Samad CONTRACTING ORGANIZATION:

More information

Obesity in aging: Hormonal contribution

Obesity in aging: Hormonal contribution Obesity in aging: Hormonal contribution Hormonal issues in obesity and aging Hormonal role in regulation of energy balance Genetic component in hormonal regulation Life style contribution to hormonal changes

More information

Correlation between circulating leptin and luteinizing hormone during the menstrual cycle in normal-weight women

Correlation between circulating leptin and luteinizing hormone during the menstrual cycle in normal-weight women European Journal of Endocrinology (1998) 139 190 194 ISSN 0804-4643 Correlation between circulating leptin and luteinizing hormone during the menstrual cycle in normal-weight women Tomi Teirmaa, Virve

More information

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array

More information

Peripubertal, leptin-deficient ob/ob female mice were used in an investigation of

Peripubertal, leptin-deficient ob/ob female mice were used in an investigation of ESSICK-BROOKSHIRE, ELIZABETH ANN, M.S. The Effects of Peripherally Administered 17-β Estradiol and BIBP3226, a NPY Y1 Receptor Antagonist, on Food Intake, Body Mass, Reproductive Development and Behavior

More information

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)

More information

YK052 Mouse Leptin ELISA

YK052 Mouse Leptin ELISA YK052 Mouse Leptin ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA-SHI SHIZUOKA, JAPAN 418-0011 Contents Ⅰ. Introduction 2 Ⅱ. Characteristics 3 Ⅲ. Composition 4 Ⅳ. Method

More information

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1 Table 1. Oligonucleotides and RT-PCR conditions. Overview of PCR templates, gene accession number of sequences used as template, product size, annealing temperatures and optimal cycles, cdna and MgCl 2

More information

Human Physiology 6.6- Hormones, Homeostasis, and Reproduction

Human Physiology 6.6- Hormones, Homeostasis, and Reproduction Human Physiology 6.6- Hormones, Homeostasis, and Reproduction Essential idea: Hormones are used when signals need to be widely distributed. Application: William Harvey s investigation of sexual reproduction

More information

Page 1. Chapter 37: Chemical Control of the Animal Body - The Endocrine System

Page 1. Chapter 37: Chemical Control of the Animal Body - The Endocrine System Chapter 37: Chemical Control of the Animal Body - The Endocrine System Endocrine System: Hormones and the various cells that secrete and receive them Types of Glands: 1) Endocrine Glands: Release substances

More information

Page 1. Chapter 37: Chemical Control of the Animal Body - The Endocrine System. Target Cells: Cells specialized to respond to hormones

Page 1. Chapter 37: Chemical Control of the Animal Body - The Endocrine System. Target Cells: Cells specialized to respond to hormones Chapter 37: Chemical Control of the Animal Body - The Endocrine System Endocrine System: Hormones and the various cells that secrete and receive them Types of Glands: 1) Endocrine Glands: Release substances

More information

Adrenal Glands. Adrenal Glands. Adrenal Glands. Adrenal Glands. Adrenal Glands 4/12/2016. Controlled by both nerves and hormones.

Adrenal Glands. Adrenal Glands. Adrenal Glands. Adrenal Glands. Adrenal Glands 4/12/2016. Controlled by both nerves and hormones. Glands http://www.hawaiilife.com/articles/2012/03/good-news-vacation-rental-owners/ 70 Figure 10.14a gland Glands cortex Mineralocorticoids Gonadocorticoids Glucocorticoids medulla Epinephrine Norepinephrine

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

Hypogonadism 4/27/2018. Male Hypogonadism -- Definition. Epidemiology. Objectives HYPOGONADISM. Men with Hypogonadism. 95% untreated.

Hypogonadism 4/27/2018. Male Hypogonadism -- Definition. Epidemiology. Objectives HYPOGONADISM. Men with Hypogonadism. 95% untreated. Male Hypogonadism -- Definition - Low T, Low Testosterone Hypogonadism -...a clinical syndrome that results from failure of the testes to produce physiological concentrations of testosterone due to pathology

More information

Copyright : 2002, Blackwell Science Ltd

Copyright : 2002, Blackwell Science Ltd Deakin Research Online Deakin University s institutional research repository DDeakin Research Online Research Online This is the author s final peer reviewed version of the item published as: Sanigorski,

More information

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic

More information

LEPTIN, THE obese (ob) gene product, is a fat cell-derived

LEPTIN, THE obese (ob) gene product, is a fat cell-derived 0021-972X/97/$03.00/0 Vol. 82, No. 8 Journal of Clinical Endocrinology and Metabolism Printed in U.S.A. Copyright 1997 by The Endocrine Society Glucocorticoid Regulation of Leptin Synthesis and Secretion

More information

The uses of animal models in the evaluation of functional foods

The uses of animal models in the evaluation of functional foods The uses of animal models in the evaluation of functional foods Jane Chao, Ph.D. Taipei Medical University School of Nutrition and Health Sciences November 30, 2006 1 Content Assessments for health claims

More information

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC Published in "" which should be cited to refer to this work. mrna extraction and RT-PCR Total RNA from 5 15 mg of crushed white adipose tissue was isolated using the technique described by Chomczynski

More information

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising

More information

Evaluation and Management of Pituitary Failure. Dr S. Ali Imran MBBS, FRCP (Edin), FRCPC Professor of Medicine Dalhousie University, Halifax, NS

Evaluation and Management of Pituitary Failure. Dr S. Ali Imran MBBS, FRCP (Edin), FRCPC Professor of Medicine Dalhousie University, Halifax, NS Evaluation and Management of Pituitary Failure Dr S. Ali Imran MBBS, FRCP (Edin), FRCPC Professor of Medicine Dalhousie University, Halifax, NS Conflict of Interest None Objectives Diagnostic approach

More information

25 mg oestradiol implants--the dosage of first choice for subcutaneous oestrogen replacement therapy?

25 mg oestradiol implants--the dosage of first choice for subcutaneous oestrogen replacement therapy? Research Subcutaneous estrogen replacement therapy. Jones SC. Journal of Reproductive Medicine March, 2004; 49(3):139-142. Department of Obstetrics and Gynecology, Keesler Medical Center, Keesler Air Force

More information

Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes

Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu

More information

LEPTIN, the obese (ob) gene product, is a 16-kDa peptide

LEPTIN, the obese (ob) gene product, is a 16-kDa peptide 0021-972X/97/$03.00/0 Vol. 82, No. 2 Journal of Clinical Endocrinology and Metabolism Printed in U.S.A. Copyright 1997 by The Endocrine Society Sexual Dimorphism in Plasma Leptin Concentration* MOHAMMED

More information

RELATIONSHIP BETWEEN BMI, TOTAL TESTOSTERONE, SEX HORMONE-BINDING-GLOBULIN, LEPTIN, INSULIN AND INSULIN RESISTANCE IN OBESE MEN

RELATIONSHIP BETWEEN BMI, TOTAL TESTOSTERONE, SEX HORMONE-BINDING-GLOBULIN, LEPTIN, INSULIN AND INSULIN RESISTANCE IN OBESE MEN Archives of Andrology, 52:355 361, 2006 Copyright # Informa Healthcare ISSN: 0148-5016 print/1521-0375 online DOI: 10.1080/01485010600692017 RELATIONSHIP BETWEEN BMI, TOTAL TESTOSTERONE, SEX HORMONE-BINDING-GLOBULIN,

More information

University of California, San Diego La Jolla CA 92093

University of California, San Diego La Jolla CA 92093 AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University

More information

Mouse Leptin ELISA Kit (mleptin-elisa)

Mouse Leptin ELISA Kit (mleptin-elisa) Mouse Leptin ELISA Kit (mleptin-elisa) Cat. No. EK0438 96 Tests in 8 x 12 divisible strips Background Leptin (or obese, OB) is a circulating hormone that is expressed abundantly and specifically in the

More information

Rat Leptin ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN

Rat Leptin ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN YK050 Rat Leptin ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN 418-0011 Contents Introduction 2 Characteristics 3 Composition 4 Method 5-6 Notes

More information

Update on diagnosis and complications of adult and elderly male hypogonadism

Update on diagnosis and complications of adult and elderly male hypogonadism Hypoandrogenism in the elderly: to treat or not to treat? 12 th Italian AME Meeting; 6 th joint Meeting with AAC Bari november 10th Update on diagnosis and complications of adult and elderly male hypogonadism

More information

Effect of high-fat diet feeding on leptin receptor expression in white adipose tissue in rats: depot- and sex-related differential response

Effect of high-fat diet feeding on leptin receptor expression in white adipose tissue in rats: depot- and sex-related differential response Genes Nutr (29) 4:151 156 DOI 1.7/s12263-9-114-9 RESEARCH PAPER Effect of high-fat diet feeding on leptin receptor expression in white adipose tissue in rats: depot- and sex-related differential response

More information

But Why Bone? Gerard Karsenty MD, PhD Department of Genetics and Development Columbia University medical Center

But Why Bone? Gerard Karsenty MD, PhD Department of Genetics and Development Columbia University medical Center But Why Bone? Gerard Karsenty MD, PhD Department of Genetics and Development Columbia University medical Center The evolution of bone biology Then: a walking and running tool i.e., A SURVIVAL TOOL The

More information

Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN

Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN YK051 Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN 418 0011 Contents Introduction 2 Characteristics 3 Composition 4 Method 5-6 Notes

More information

Effect of Resistin on Granulosa and Theca Cell Function in Cattle

Effect of Resistin on Granulosa and Theca Cell Function in Cattle 1 Effect of Resistin on Granulosa and Theca Cell Function in Cattle D.V. Lagaly, P.Y. Aad, L.B. Hulsey, J.A. Grado-Ahuir and L.J. Spicer Story in Brief Resistin is an adipokine that has not been extensively

More information

Spontaneously Diabetic Torii Lepr fa (SDT Fatty) Rat: A Novel Model of Obese Type 2 Diabetes

Spontaneously Diabetic Torii Lepr fa (SDT Fatty) Rat: A Novel Model of Obese Type 2 Diabetes 30 The Open Diabetes Journal, 2011, 4, 30-36 Open Access Spontaneously Diabetic Torii Lepr fa (SDT Fatty) Rat: A Novel Model of Obese Type 2 Diabetes Sumiaki Fukuda, Katsuhiro Miyajima, Tomohiko Sasase

More information

Appeal decision. Appeal No USA HILL'S PET NUTRITION, INC. Osaka, Japan

Appeal decision. Appeal No USA HILL'S PET NUTRITION, INC. Osaka, Japan Appeal decision Appeal No. 2015-17056 USA Appellant HILL'S PET NUTRITION, INC. Osaka, Japan Patent Attorney MURAI, Koji The case of appeal against the examiner's decision of refusal of Japanese Patent

More information

The effects of high-fat diet feeding over generations on body fat accumulation associated with lipoprotein lipase and leptin in rat adipose tissues

The effects of high-fat diet feeding over generations on body fat accumulation associated with lipoprotein lipase and leptin in rat adipose tissues 46 Asia Pacific J Clin Nutr (1999) 8(1): 46 52 Original Article OA 81 EN The effects of high-fat diet feeding over generations on body fat accumulation associated with lipoprotein lipase and leptin in

More information

Serum leptin in obesity is related to gender and body fat topography but does not predict successful weight loss

Serum leptin in obesity is related to gender and body fat topography but does not predict successful weight loss European Journal of Endocrinology (1997) 137 61 67 ISSN 0804-4643 Serum leptin in obesity is related to gender and body fat topography but does not predict successful weight loss Leo K Niskanen 1,2, Steven

More information

Obese Type 2 Diabetic Model. Rat Model with Early Onset of Diabetic Complications. SDT fatty rats. SDT fatty rats

Obese Type 2 Diabetic Model. Rat Model with Early Onset of Diabetic Complications. SDT fatty rats. SDT fatty rats Obese Type 2 Diabetic Model rats Rat Model with Early Onset of Diabetic Complications rats Background and Origin In 24, Dr. Masuyama and Dr. Shinohara (Research Laboratories of Torii Pharmaceutical Co.,

More information

Severe erectile dysfunction is a marker for hyperprolactinemia

Severe erectile dysfunction is a marker for hyperprolactinemia (2001) 13, 176±182 ß 2001 Nature Publishing Group All rights reserved 0955-9930/01 $15.00 www.nature.com/ijir Severe erectile dysfunction is a marker for hyperprolactinemia AM Johri 1, JPW Heaton 1 * and

More information

INFLUENCE OF NEONATAL CASTRATION OR NEONATAL ANTI-GONADOTROPIN TREATMENT ON FERTILITY, PHALLUS DEVELOPMENT, AND MALE SEXUAL BEHAVIOR IN THE MOUSE*

INFLUENCE OF NEONATAL CASTRATION OR NEONATAL ANTI-GONADOTROPIN TREATMENT ON FERTILITY, PHALLUS DEVELOPMENT, AND MALE SEXUAL BEHAVIOR IN THE MOUSE* FERTILITY AND STERILITY Copyright 1975 The American Fertility Society Vol. 26, No.9. September 1975 Printed in U.SA. INFLUENCE OF NEONATAL CASTRATION OR NEONATAL ANTI-GONADOTROPIN TREATMENT ON FERTILITY,

More information

I. Introduction. II. Characteristics

I. Introduction. II. Characteristics YK050 Rat Leptin ELISA I. Introduction Leptin, which is a product of ob gene, is a protein consisting of 167 amino acids and it is secreted from white adipose tissue. It is known that leptin acts on hypothalamus

More information

Mechanisms of precocious puberty induced in male rats by

Mechanisms of precocious puberty induced in male rats by Mechanisms of precocious puberty induced in male rats by pituitary grafts R. Aguilar, C. Bellido, J. E. S\l=a'\nchez-Criadoand E. Aguilar Department of Physiology, Faculty of Medicine, Cordoba University,

More information

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko

More information

Experimental and Clinical Studies on Plasma Leptin in Obese Dogs

Experimental and Clinical Studies on Plasma Leptin in Obese Dogs FULL PAPER Biochemistry Experimental and Clinical Studies on Plasma Leptin in Obese Dogs Katsumi ISHIOKA 1), Mohamed M. SOLIMAN 1), Mayumi SAGAWA 2), Fumio NAKADOMO 3), Haruki SHIBATA 4), Tsutomu HONJOH

More information

Rat Primary Pre-adipocytes Culture Kit

Rat Primary Pre-adipocytes Culture Kit Primary Cell Co., Ltd Rat Primary Pre-adipocytes Culture Kit Primary Cells from rat mesenteric, epididymal, and subcutaneous adipose tissues. Catalog # PMC-VAC01-COS, PMC-EAC01-COS, PMC-SAC01-COS Notice

More information

GUIDELINES: This is an investigative study with no applicable guidelines.

GUIDELINES: This is an investigative study with no applicable guidelines. CITATION: Handa R, 2014. Terbuthylazine: An oral (gavage) study to assess the effects on the hormoneinduced luteinizing hormone surge in ovariectomized female Wistar rats. College of Medicine, The University

More information

Association of poorly controlled diabetes with low serum leptin in morbid obesity

Association of poorly controlled diabetes with low serum leptin in morbid obesity International Journal of Obesity (1997) 21, 556±561 ß 1997 Stockton Press All rights reserved 0307±0565/97 $12.00 Association of poorly controlled diabetes with low serum leptin in morbid obesity K CleÂment

More information

Sunghyen Lee 1, Youngmin Lee 2, Sungjoon Lee 3, Haejeung Lee 4, Hyun Lillehoj 5

Sunghyen Lee 1, Youngmin Lee 2, Sungjoon Lee 3, Haejeung Lee 4, Hyun Lillehoj 5 Dec 8, 2015 Sunghyen Lee 1, Youngmin Lee 2, Sungjoon Lee 3, Haejeung Lee 4, Hyun Lillehoj 5 1 Functional Food & Nutrition Division, National Institute of Agricultural Science, 2 Seoul Women s Univ, 3 Eulji

More information

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according

More information

CYP19 gene polymorphisms and the susceptibility to breast cancer in Xinjiang Uigur women

CYP19 gene polymorphisms and the susceptibility to breast cancer in Xinjiang Uigur women CYP19 gene polymorphisms and the susceptibility to breast cancer in Xinjiang Uigur women L. Yang, X.Y. Wang, Y.T. Li, H.L. Wang, T. Wu, B. Wang, Q. Zhao, D. Jinsihan and L.P. Zhu The Department of Mammary

More information

GUIDELINES ON. Introduction. G.R. Dohle, S. Arver, C. Bettocchi, S. Kliesch, M. Punab, W. de Ronde

GUIDELINES ON. Introduction. G.R. Dohle, S. Arver, C. Bettocchi, S. Kliesch, M. Punab, W. de Ronde GUIDELINES ON Male Hypogonadism G.R. Dohle, S. Arver,. Bettocchi, S. Kliesch, M. Punab, W. de Ronde Introduction Male hypogonadism is a clinical syndrome caused by androgen deficiency. It may adversely

More information

Reproductive outcome in women with body weight disturbances

Reproductive outcome in women with body weight disturbances Reproductive outcome in women with body weight disturbances Zeev Shoham M.D. Dep. Of OB/GYN Kaplan Hospital, Rehovot, Israel Weight Status BMI (kg/m 2 ) Underweight

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.

The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D. The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D. What can happen to our gene(s) that would cause obesity? Modification via Epigenetic alterations C

More information

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1] ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology

More information

SAMPLE REPORT. Order Number: PATIENT. Age: 40 Sex: F MRN:

SAMPLE REPORT. Order Number: PATIENT. Age: 40 Sex: F MRN: Patient: Age: 40 Sex: F MRN: SAMPLE PATIENT Order Number: Completed: Received: Collected: SAMPLE REPORT Progesterone ng/ml 0.34 0.95 21.00 DHEA-S mcg/dl Testosterone ng/ml 48 35 0.10 0.54 0.80 430 Sex

More information

Leptin and energy expenditure Chris J. Hukshorn and Wim H.M. Saris

Leptin and energy expenditure Chris J. Hukshorn and Wim H.M. Saris Leptin and energy expenditure Chris J Hukshorn and Wim HM Saris Purpose of review A fundamental advance in our understanding of endocrine control of energy balance and body weight came with the discovery

More information

Academic Script Surgical Techniques Like Ovariectomy, Orchidectomy, Adrenalectomy, Etc

Academic Script Surgical Techniques Like Ovariectomy, Orchidectomy, Adrenalectomy, Etc Academic Script Surgical Techniques Like Ovariectomy, Orchidectomy, Adrenalectomy, Etc Aim: To Study the Surgical Techniques like Ovariectomy, Orchidectomy, Adrenalectomy, Tubectomy and Vasectomy in Rodents

More information