Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Size: px
Start display at page:

Download "Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents"

Transcription

1 Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko Stefanovski, Richard N Bergman 5, Hong T Nguyen 1, Mauricio D Dorfman 1, Louise Lantier, David H Wasserman, Zaman Mirzadeh 7, Terry G Unterman,9, Gregory J Morton 1 & Michael W Schwartz 1 SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE 1 Effect of i.c.v. on glucoregulatory hormones in diabetic mice. (a) Plasma levels of insulin (left) and glucagon (right) in h fasted ob/ob (B) mice 1 weeks after a single i.c.v. injection of either 3 µg of m (n = 9) or veh (n = ). (b) Time course of blood glucose levels (left), food intake (middle) and body weight (right) from adlib-fed ob/ob (B) mice following a single injection of m (3 µg; n = 1) or veh (n = ) into the 3 rd ventricle. Throughout, data are the mean ± s.e.m. (a) P = n.s., i.c.v. m versus veh as determined by two-tailed Student s t-test. (b) P <.1 for group (veh versus ) by repeated measures designs by linear mixed-model analyses. P <.5, icv m versus veh by mixed factorial analyses. SUPPLEMENTARY FIGURE Effect of i.c.v. on plasma corticosterone levels in diabetic mice. Plasma levels of corticosterone obtained h after injection of m (3 µg) or veh into either (a) the 3 rd ventricle (veh, n = ;, n = 1) or (b) the lateral ventricle (veh, n = 1;, n = 1) from ob/ob (B) mice. (c) Plasma levels of corticosterone levels in ob/ob (B) mice 1 weeks after a single i.c.v. injection of either m (3 µg; n = 9) or veh (n = ). In all Nature Medicine: doi:1.13/nm.11

2 instances, plasma was obtained during mid-light cycle following a h fast. Throughout, data are mean ± s.e.m. P = n.s., i.c.v. m versus veh as determined by two-tailed Student s t-test. SUPPLEMENTARY FIGURE 3 Effect of i.c.v. on food intake and body weight across multiple rodent models of TD. (a) Time course of food intake (left) and body weight (right) from ad-lib-fed db/db mice following i.c.v. injection of either 3 µg of m (n = ) or veh (n = 9). (b) Time course of food intake (left) and body weight (right) from ad-lib-fed DIO WT mice in which hyperglycemia was induced with low-dose STZ (DIO-LD STZ) following i.c.v. injection of either m (3 µg; n = ) or veh (n = ). (c) Time course of food intake (left) and body weight (right) from ad-lib-fed ob/ob (B) mice following a single i.c.v. injection of either h (3 µg; n=), m (3 µg; n = ) or veh (n = ). (d) Time course of food intake (left), body weight (middle), and fat mass (right) from ad-lib-fed ZDF rats following a single i.c.v. injection of either r (3 µg; n = 1) or veh (n = 1). Throughout, data are the mean ± s.e.m. (a c) P <.5, i.c.v. m versus veh; # P <.5, i.c.v. h versus veh by mixed factorial analyses. (d) Significant main effects in (left) (P <.1) and (middle) (P =.) reflected group differences at earlier time points (treatment by day interaction is significant (P <.1). P-values for group (veh versus ) by repeated measures designs by linear mixed-model analyses. SUPPLEMENTARY FIGURE Effect of i.c.v. on BAT Ucp1 gene expression and plasma lipid levels. (a) Brown adipose tissue (BAT) Ucp1 gene expression in ob/ob (B) mice that underwent a basal glucose turnover study followed by an FSIGT 7 d after a single i.c.v. Nature Medicine: doi:1.13/nm.11

3 injection of m (3 µg; n = 13) or veh (n = 9). (b) Plasma levels of triglycerides (left), cholesterol (middle) and non-esterified free fatty acids (NEFA; right) in h fasted ob/ob (B) mice from samples obtained d following a single i.c.v. injection of either h (3 µg; n = ), m (3µg; n = ) or veh (n = ). (c) Plasma levels of triglycerides (left), cholesterol (middle), and NEFA (right) in h fasted db/db mice from samples obtained d following a single i.c.v. injection of either m (3 µg; n = ) or veh (n = 9). Throughout, data are mean ± s.e.m. P <.5, i.c.v. h versus veh as determined by one-way ANOVA analyses. SUPPLEMENTARY FIGURE 5 Effect of severe hyperglycemia on central -mediated glucose lowering. (a) Time course of blood glucose levels from severely hyperglycemic, ad-libfed db/db mice following i.c.v. injection of m (n = ) or veh (n = 9). (b) Time course of blood glucose levels from severely hyperglycemic, ad-lib-fed DIO WT mice treated with high dose-stz (DIO-HD STZ) following i.c.v. injection of m (n = ) or veh (n = 3). (c) Time course of blood glucose levels from severely hyperglycemic, ad-lib-fed ob/ob (BTBR) mice following i.c.v. injection of m (n = ) or veh (n = ). (d) Food intake (left), body weight (middle) and blood glucose (right) levels from ad-lib-fed DIO WT mice receiving continuous s.c. infusion of the insulin receptor antagonist S91 that received i.c.v. injection of either veh (n = 1) or m (3 µg; n = 11). Throughout, data are mean ± s.e.m. (d) For the time course of food intake (left), the groups differed on days 1 and (P <.1 and P =.3, respectively). P-values for group (veh versus ) by repeated measures designs by linear mixed-model analyses. Nature Medicine: doi:1.13/nm.11

4 SUPPLEMENTARY FIGURE Effect of i.c.v. in LIRFKO and littermate IRF control mice made hyperglycemic by systemic administration of the insulin receptor antagonist S91. Food intake (left) body weight (middle) and blood glucose levels (right) from ad-lib-fed littermate IRF controls (a) and LIRFKO mice (b) in which hyperglycemia was induced by continuous s.c. infusion of the insulin receptor antagonist S91, following i.c.v. injection of either veh (IRF, n = 1; LIRFKO, n = 1) or m (3 µg; IRF, n = 13; LIRFKO, n = 11). Throughout, data are mean ± s.e.m. P<.5, i.c.v. m versus veh by mixed factorial analyses. SUPPLEMENTARY FIGURE 7 (a) Representative immunofluorescence images of c-fos (red) in the hypothalamus of mice euthanized 9 min after a single i.c.v. injection of either veh saline (left, of n = images), m (3 µg; middle, of n = 1 images) or h9 (3 µg; right, of n = 1 images) (original magnification, x; Scale bar: µm). (b) C-Fos immunoreactive nuclei quantified from cells (both ependymal and tanycytes) lining the 3 rd ventricle (3V) from anatomically matched sections from the hypothalamus of mice treated with either i.c.v. veh (n = ), m (n = ) or h9 (n = ). (c) Hypothalamic levels of Hspb1 mrna (encoding HSP5) obtained from chow-fed WT mice h after a single i.c.v. injection of either veh (n = 9) or m (3 µg; n = ). (d) Western blot image (left) and densitometry quantification of synaptophysin protein levels (right) in hypothalamus (normalized to the loading control, β- tubulin III) from ob/ob mice obtained 1 week following a single i.c.v. injection of either m (3 µg; n = ) or veh (n = 5). Throughout, data are mean ± s.e.m. P <.5, i.c.v. m versus veh as determined by one-way ANOVA analysis or by Student s two-tailed t-test. Nature Medicine: doi:1.13/nm.11

5 Supplementary Figure 1 a Insulin (ng/ml) Glucagon (pmol/liter) 1..5 b Nature Medicine: doi:1.13/nm.11

6 Supplementary Figure a b c Corticosterone (ng/ml) Corticosterone (ng/ml) Corticosterone (ng/ml) Nature Medicine: doi:1.13/nm.11

7 Supplementary Figure 3 a m b _ m _ 1 3 c d Food intake (g/rat/day) h m # # 7 9 Time (h) # r ####### h m Fat mass (g) r 3 Nature Medicine: doi:1.13/nm.11

8 Supplementary Figure a BAT Ucp1 mrna (fold change) 1 m b Triglycerides (mg/dl) h m Cholesterol (mg/dl) NEFA (mmol/liter) c Triglycerides (mg/dl) m Cholesterol (mg/dl) NEFA (mmol/liter) Nature Medicine: doi:1.13/nm.11

9 Supplementary Figure 5 a b c _ 1 _ d 3 1 _ 1 1 Osmotic pump Icv injection _ 1 1 Nature Medicine: doi:1.13/nm.11

10 Supplementary Figure a Osmotic pump Icv injection b Osmotic pump Icv injection Nature Medicine: doi:1.13/nm.11

11 Supplementary Figure 7 a b 3V lining c-fos count (immunoreactive nuclei/section) c Hypothalamic Hspb1 mrna (fold change ) 1 d Hypothalamic synaptophysin/ -tubulin III (a.u.) Nature Medicine: doi:1.13/nm.11

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Metabolic responses to leptin in obese db/db mice are strain dependent

Metabolic responses to leptin in obese db/db mice are strain dependent Am J Physiol Regulatory Integrative Comp Physiol 281: R115 R132, 2001. Metabolic responses to leptin in obese db/db mice are strain dependent RUTH B. S. HARRIS, TIFFANY D. MITCHELL, XIAOLANG YAN, JACOB

More information

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1 Table 1. Oligonucleotides and RT-PCR conditions. Overview of PCR templates, gene accession number of sequences used as template, product size, annealing temperatures and optimal cycles, cdna and MgCl 2

More information

Ruth B. S. Harris, Tiffany D. Mitchell, Xiaolang Yan, Jacob S. Simpson and Stephen M. Redmann, Jr.

Ruth B. S. Harris, Tiffany D. Mitchell, Xiaolang Yan, Jacob S. Simpson and Stephen M. Redmann, Jr. Metabolic responses to leptin in obesedb/db mice are strain dependent Ruth B. S. Harris, Tiffany D. Mitchell, Xiaolang Yan, Jacob S. Simpson and Stephen M. Redmann, Jr. Am J Physiol Regul Integr Comp Physiol

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

FGF19 Action in the Brain Induces Insulin- Independent Glucose Lowering

FGF19 Action in the Brain Induces Insulin- Independent Glucose Lowering University of Pennsylvania ScholarlyCommons Departmental Papers (Vet) School of Veterinary Medicine 11-1-2013 FGF19 Action in the Brain Induces Insulin- Independent Glucose Lowering Gregory J. Morton Miles

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp, SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

perk/erk STAT5B

perk/erk STAT5B pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)

More information

a b c Physical appearance of mice Lean mass Adipocyte size d e f

a b c Physical appearance of mice Lean mass Adipocyte size d e f LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)

More information

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression) a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171 SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)

More information

Supplementary Table 1.

Supplementary Table 1. Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA

More information

Control 7 d cold 7 d CL

Control 7 d cold 7 d CL Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with

More information

People Living with And Inspired by Diabetes

People Living with And Inspired by Diabetes People Living with And Inspired by Diabetes IMPERFECTLY MOVING TOWARDS & FAINTING GOATS Vol. 2 No. 2 Fall 2016 Vol. 2 No. 2 Fall 2016 1 Review PARTNERING WITH SCIENCE: New Hope for the Effective Treatment

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production

Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production activates a duodenal Ampk-dependent pathway to lower hepatic glucose Frank A. Duca, Clémence D. Côté, Brittany A. Rasmussen, Melika Zadeh-Tahmasebi, Guy A. Rutter, Beatrice M. Filippi & Tony K.T. Lam Supplementary

More information

Interplay between FGF21 and insulin action in the liver regulates metabolism

Interplay between FGF21 and insulin action in the liver regulates metabolism Research article Interplay between FGF21 and insulin action in the liver regulates metabolism Brice Emanuelli, 1 Sara G. Vienberg, 1 Graham Smyth, 1 Christine Cheng, 2 Kristin I. Stanford, 1 Manimozhiyan

More information

Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.

Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2. Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

Supplementary Fig. 1: TBR2+ cells in different brain regions.

Supplementary Fig. 1: TBR2+ cells in different brain regions. Hip SVZ OB Cere Hypo Supplementary Fig. 1: TBR2 + cells in different brain regions. Three weeks after the last tamoxifen injection, TBR2 immunostaining images reveal a large reduction of TBR2 + cells in

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8 Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

Supplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol

Supplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol ell Metabolism, Volume 7 Supplemental Information The Hormone Stimulates Water Drinking in Response to Ketogenic Diet and lcohol Parkyong Song, hristoph Zechner, Genaro Hernandez, José ánovas, Yang Xie,

More information

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)

More information

Expanded View Figures

Expanded View Figures Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old

More information

Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network

Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG

More information

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,

More information

islets scored 1 week month months

islets scored 1 week month months Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic

More information

Food Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Food Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Food Intake Regulation & the Clock Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Circadian disruption affect multiple organ systems: The diagram provides examples of how circadian disruption

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

Hypothalamic TLR2 triggers sickness behavior via a microglia-neuronal axis

Hypothalamic TLR2 triggers sickness behavior via a microglia-neuronal axis Hypothalamic TLR triggers sickness behavior via a microglia-neuronal axis Sungho Jin, *, Jae Geun Kim,, *, Jeong Woo Park, Marco Koch,, Tamas L. Horvath and Byung Ju Lee Department of Biological Sciences,

More information

Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney

Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney SUPPLEMENTAL FIGURE LEGENDS Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney macrophage infiltration. Wild type or COX-2 -/- mice (2 months old, C57/Bl6 background) were treated

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and

More information

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold

More information

Supporting Information

Supporting Information Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Control. csarnt -/- Cre, f/f

Control. csarnt -/- Cre, f/f ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen

More information

Nature Medicine: doi: /nm.4324

Nature Medicine: doi: /nm.4324 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression

More information

BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.

BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Supplementary Figure 1 BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Boxplots show the 25% and 75% quantiles of normalized mrna expression levels

More information

Metabolic Solutions Development Company, Kalamazoo, USA.

Metabolic Solutions Development Company, Kalamazoo, USA. New Insulin Sensitizers Produce Differentiation of Brown-like Adipose Cells from a Subcutaneous Fat Depot and Increase Secretion of Adiponectin in vitro William G. McDonald, Serena L. Cole, Danielle D.

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

The reduction of feed intake and gluconeogenesis during hyperketonemia in dairy cows indicates a signal of abundant energy availability

The reduction of feed intake and gluconeogenesis during hyperketonemia in dairy cows indicates a signal of abundant energy availability Veterinary Physiology The reduction of feed intake and gluconeogenesis during hyperketonemia in dairy cows indicates a signal of abundant energy availability Rupert M. Bruckmaier 1 & Björn Kuhla 2 1 Veterinary

More information

Supplementary legends

Supplementary legends Supplementary legends Supplemental figure S1. Apelin-TAMRA is functional and induces apelin receptor internalization. HEK-293T cells transiently expressing YFP tagged APJ were incubated for 1 hour with:

More information

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Nature Medicine: doi: /nm.3891

Nature Medicine: doi: /nm.3891 Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,

More information

Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice

Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice Am J Physiol Regul Integr Comp Physiol 284: R87 R100, 2003; 10.1152/ajpregu.00431.2002. Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice HEATHER

More information

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Supplementary Information

Supplementary Information Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,

More information

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

Inhibition of 11β-hydroxysteroid dehydrogenase type 1 reduces food intake and weight gain but maintains energy expenditure in diet-induced obese mice

Inhibition of 11β-hydroxysteroid dehydrogenase type 1 reduces food intake and weight gain but maintains energy expenditure in diet-induced obese mice Diabetologia (2006) 49: 1333 1337 DOI 10.1007/s00125-006-0239-y SHORT COMMUNICATION S. J. Y. Wang. S. Birtles. J. de Schoolmeester. J. Swales. G. Moody. D. Hislop. J. O Dowd. D. M. Smith. A. V. Turnbull.

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

a! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin!

a! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin! a! b! c! Diamet (μm) 2 2 1 WT Nogo-A/B-deficient -9-8 -7 - -5-4 PE (LogM) Diamet (μm) 2 2 1-12-11-1 -9-8 -7 - -5 U-419 (LogM) Diamet (μm) 2 2 1-8 -7 - -5 S1P (LogM) d! WT! Nogo-A/B-deficient! MLE! enos!

More information

Table S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group

Table S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group Table S1: Nutrient composition of cracker and almond snacks Cracker* Almond** Weight, g 77.5 g (5 sheets) 56.7 g (2 oz.) Energy, kcal 338 364 Carbohydrate, g (kcal) 62.5 12.6 Dietary fiber, g 2.5 8.1 Protein,

More information

HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)

HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU) Supplementary Figure 1. Impaired insulin action in HSP72 deficient muscle and myotubes in culture cannot be explained by altered myogenesis or reduced total GLUT4 expression. Genes associated with myogenesis

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.

Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Pancreata from 16-weeks-old 6J +/+, 6J db/db, KS +/+ and KS db/db mice were harvested, fixed with

More information

Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID

Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream

More information