Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1

Size: px
Start display at page:

Download "Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1"

Transcription

1 Table 1. Oligonucleotides and RT-PCR conditions. Overview of PCR templates, gene accession number of sequences used as template, product size, annealing temperatures and optimal cycles, cdna and MgCl 2 concentration for medial basal hypothalamus (MBH), anterior pituitary and brown adipose tissue (BAT). Supplementary Material and Methods Fig. 1. Figures show representative data from anterior pituitary and from BAT-RNA of controls at different cycles (A,B) or different cdna concentration at selected number of cycles (C). D.E: figures showing correlation between a cdna of experimental gene and house keeping gene from sedentary (blue rombos) compared to exercised rats (red squares) of one representative experiment.

2 Supplementary Material and Methods, Table 1. Oligonucleotides and RT-PCR conditions GENE ID SIZE SENSE ANTISENSE START STOP Tm C HPRT NM_ CCTCAGTCCCAGCGTCGTGA TGGGGCTGTACTGCTTGACCA CYC 2 NM_ CGAGCTGTTTGCAGACAAAGTTCC GATGGGGTGGGGGTGCTCTC PPII NM_ CTGGATCGCATACAAAAA GGACAGCCAAATAATTGCT Dio2 NM_ GATGCTCCCAATTCCAGTGT AGGCTGGCAGTTGCCTAGTA TRH-R1 NM_ ACCCAGAGAAGCAGGCAGCGTGACA GATCCGCCACAGCCAGACTCACCAG UCP-1 NM_ GGATCAAACCCCGCTACACTG CAGGATCCGAGTCGCAGAAAA MBH Anterior Pituitary BAT GENE CYCLES cdna CYCLES cdna CYCLES cdna MgCl 2 HPRT 24 2 µl 1.5 mm CYC µl 2 4 µl 21 2 µl 1.5 mm G3PDH 26 2 µl 1.5 mm PPII 29 4 µl 29 4 µl 1.5 mm Dio2 3 4 µl 28 4 µl 26 2 µl 1.5 mm TRH-R µl 1.5 mm TSH-β 21 4 µl 1.5 mm UCP µl 1.5 mm

3 Cyclophilin (a.u.) Cyclophilin (a.u.) Cyclophilin (a.u.) Arbitrary Unists Arbitrary units Arbitrary units A) RNA from Anterior Pituitary Dio2 TSH-β Number of cycles TSHβ (a.u.) Number of cycles Sed Ex RNA from BAT B) C) D) Dio2 UCP Dio2 (a.u.) E) Dio2 26c CYC 21c HPRT 24c UCP-1 18c μl cdna Sed Ex Naive X 2 4 UCP-1 (a.u.)

4 Supplementary Figure 1. Effect of voluntary exercise, or of repeated restraint, on body weight gain (BWg) and food intake. Wistar male rats were introduced into a plastic restraint tube in prone position (Res), or in an empty cage (controls: C), for 3 min /day during 1-14 days. Male rats from other cohort were kept during the night in individual cages containing (Exercise: Ex) or not a running wheel (sedentary: Sed) and returned with their cage mates during light period. Each time point of each paradigm was repeated in 2 independent experiments (total 1 animals/group). a,b) Body weight was measured on days stated in abscissa and compared to the weight of each rat on day. Graphs represent the cumulative weight gain; Repeated measures ANOVA (Supplementary Table 1), followed by post-hoc hoc significance between experimental and control groups (C or Sed) of same day p<.5. c) Relative food intake (average grams of chow/day/kg of body weight) for the 2 weeks. d) Food efficiency calculated as BWg /1 g of chow consumed during two weeks. e) Cumulative food intake (g) was measured on days 3, 7 and 14 during night and day periods for sedentary and exercised rats; significant differences against day period (PostHoc: p<.1). f,g) Correlation plots between food intake (g) and water intake (ml) or amount of exercise performed during 1,3,7 or 14 days. significant differences against controls (post-hoc: p<.1, p<.1). Supplementary figure 2. Variations in WAT and BAT weights, and serum leptin of animals exposed to restraint or exercise. Treatments described in legend of Fig.1 a) Subcutaneous (sc) white adipose tissue (WAT) from interscapulum (localized above BAT), from epididymus (ε) or from retroperitoneum (ρ) was excised and weighed fresh; figure depicts values calculated as % of particular controls of each independent experiment (=1%, represented as horizontal line); only values after 14 days restraint (Res) are shown. b) Correlation plots between values of scwat weight (in % of sedentary) and average number of revolutions (Rev) after 7 or 14 days (d) of exercise. c) Slices from scwat stained with hematoxylin and eosin. d) Variations in BAT weight after 1-14 days of exercise, or 14 days of restraint; e) correlation plots between BAT weight and revolutions at 7 or 14 days of exercise; f) stained slices of BAT (as c). g) Leptin serum concentration determined by ELISA after 14 days of exercise or restraint. h) correlation plots between WAT weight and procrh mrna or corticosterone serum levels (i); j) correlation plots between epididymal WAT (εwat) weight and serum

5 corticosterone of exercise and pair fed rats; k) correlation plots between WAT weight and total T3 at 7 and 14 days of exercise; l) correlation plots between serum corticosterona and PVN protrh after 14 days of restraint or of pair feeding (m). Values of ANOVAs or regression analyses in Supplementary Tables 1 and 2; post-hoc significance: x p<.5, p<.5, p<.5.

6 Food intake (g) Water intake (ml) Total Revolutions BWg (g) BWg (g) Food Itk (g)/kg BW BWG(g)/1g food a) b) c) d) Sed Ex days C Res days Sed Ex PF C Res τ e) f) Sed Ex Sed Ex Night Day Sed (.94) Ex (.96) Food Intake (g) d1 d3 d7 d14 g) Food Intake (g)

7 WAT Cort ProTRH Serum leptin (ng/ml) procrh Cort (% sed) ewat BAT weight (g) % of sed Res14 Rev/day WAT weight (g) % of sed Rev/day a sc ε ρ x x b d 7 d 14 c Sedentary Exercised R14 Ex (days) scwat d e f Ex (days) d 7 d BAT (g) (% sed) Sedentary Exercised g k d7 d14 Ex T3 h d7 d εwat l i Res WAT (% sed) m protrh j Pair Fed Cort Ex PF.65 2 Cort

8 Supplementary Table 1. Data of statistical analyses. One or two way (1W, 2W) analyses of variance (ANOVA) were performed with the values of the relative mrna levels, calculated as % of each experiment s control, or serum concentrations of genes and hormones described in column one, of groups described in column 2. Data of 2 independent experiments/day/paradigm were pooled for analysis. Data of body weight or food intake of various days / rat was analyzed by ANOVA of repeated measures. n.m.= not measured. Supplementary Table 2. One or two way (1W, 2W) analyses of variance (ANOVA) were performed with the values of the relative mrna levels, calculated as % of each experiment s control, or serum concentrations of genes and hormones described in column titled variable, of groups described in column titled groups. Data of 2 independent experiments were pooled for analysis. When comparing different variables as Ex and Exα, 2W ANOVA considered each control group independently for comparison with groups of that experiment. Ex α= animals sacrificed 3 hours after the onset of the dark cycle. Supplementary Table 3. Dynamics of the esponse of the HPA axis to repeated restraint or wheel running (exercise). Animals were treated as described in legend Fig.1. Relative levels of mrna, dissected from the paraventricular nucleus of the hypothalamus, were evaluated by RT-PCR and signal of each cdna calculated as ratio of cyclophilin cdna. Corticosterone (cort) serum values quantified by RIA; adrenal weight (Adr.w, g) weighed fresh. Values of different variables in each experiment were calculated as % of mean values of their controls and pooled for statistics. ANOVA data in supplementary Table 1, post-hoc: p<.1. x p <.5, p<.5. n.m.= not measured.

9 Variable Groups Type of statistical test Food intake (g) Exercised 2W, treatment: F 2,119 = 9, p=.2; time: F 3,119 = 541, p<.1; interaction: F 1,18 =11, p=.1 Restraint 1W, F 1,86 = 21, p<.1 Food intake (Kg BW) Restraint 2W, first week: F 1,2 = 33, p=.8, 2nd week: F 1,35 = 14, p=.6 Exercised 2W, first week: F 1,56 = 26, p<.1, 2nd week: F 2,58 = 28, p<.1 Water intake (ml) Restraint n.m. Exercised 2W, treatment: F 1,56 =84, p=.1 Body Weight Gain (g) Sedentary Exercised 2W, treatment: F 1,18 =27, p<.1 ; days: F 9,162 =9.7, p<.1; interaction: F 9,162 =3.54, p=.5 Controls 2W, treatment: F 1,26 =2.82, p<.1 ; days: F 5,13 =43.3, p<.1 Food Efficiency (BWg/1g chow) Restraint Sedentary Exercised 2W, treatment: F 1,58 =34.64, p<.1; days: F 1,58 = 6.8, p =.11 Controls 2W, treatment: F 1,86 =17.54, p<.1; days: F 1,86 = 4.3, p =.41 Restraint BAT Weight (g) Restraint 1W, F 1,2 =6.4, p=.2 Exercised 2W, treatment: F 1,73 =34, p=.1; days: F 3,73 =4, p=.12; interaction: F 3,73 =3.6, p=.17 WAT Weight (g) Exercised 2W, subcutaneous fat, treatment: F 1,85 = 6.7, p =.11; epididymal fat (εwat), treatment: F 1,53 = 16, p=.2 Adrenals (g) Restraint 1W, F 2,46 =37.6, p <.1 Corticosterone (ng/ml) Restraint 1W, F 3,45 = 23, p <.1 procrh (PVN) Restraint 1W, F 2,36 = 4.3, p =.21 CRH-R1 (PVN) Restraint 1W, F 3,5 = 7.9, p =.2 GR (PVN) Restraint 1W, F 3,55 = 3.7, p =.17 ProTRH (PVN) Restraint 2W, treatment: F 1,65 =12.4, p=.8 controls Restraint 1W, F 3,45 = 5.8, p =.2 TSH (ng/ml) Exercised 1W, F 1,65 =14, p=.1 Leptin (14d) (Supplem Fig. 1) Exercised 1W, F 2,46 =37.6, p <.1 Restraint 1W, F 1,2 = 15.8, p =.7 Exercised 1W, F 1,19 = 19.5, p =.3 (2W Ex + Sed : treatment: F 1,39 =35, p=.1, no interaction)

10 Variable Groups Statistical Analysis protrh PVN Restraint 2W, treatment: F 1,65 =12.4; p=.8 Figure 1 Exercise 2W, treatment: F 1,73 =12.4; p=.1 TSH (ng/ml) Restraint 1W, F 3,45 = 5.8, p =.2 Exercise 2W, treatment: F 1,68 =5.6; p=.2 Body Weight Gain (g) Pair Fed and Exercise 1W, F 2,48 = 15.1, p<.1 Epididymal Fat Weight (g) Exercise 2W, treatment: F 2,55 = 6.5, p=.3 Retroperitoneal Fat Weight (g) Exercise 2W, treatment: F 2,43 = 9.4, p=.1 Interescapular Fat Weight (g) Pair Fed and Exercise 2W, treatment: F 2,63 = 8.5, p=.1 Figure 2 BAT Weight (g) Exercise 2W, treatment: F 2,73 = 7, p=.2 Triglycerides (mg/dl) Exercise 2W, treatment: F 3,32 = 5.6, p=.4 Leptin (ng/ml) Exercise 2W, treatment: F 3,53 = 7.3, p<.1 Corticosterone (ng/ml) Pair Fed 2W, treatment: F 3,54 = 16.2, p<.1 protrh PVN Pair Fed and Exercise 2W, treatment: F 3,44 = 19, p<.1 TSH (ng/ml) Exercise 1W, F 2,39 = 1.3, p=.3 T4/TSH Pair Fed and Ex α 2W, treatment: F 3,32 = 5.1, p=.6 ft4/tsh Pair Fed 2W, treatment: F 3,32 = 5.2, p=.6 T4/T3 Pair Fed 2W, treatment: F 3,33 = 3.8, p=.2 D2 mrna MBH Exercise 2W, F 1,21 = 4.31, p=.5 TRH-R1 mrna Pituitary Exercise 1W, F 1,1 = 7.2, p<.2 Figure 3 D2 mrna BAT Exercise 2W, treatment: F 3,4 = 4.8, p=.6 D2 Activity BAT Pair Fed 1W, F 2,35 = 3.4, p=.4 D1 Activity Liver Pair Fed 1W, F 2,17 = 6.5, p=.9 protrh PVN (ISH) Exercise Unpaired t-test, p=.2 Figure 4 procrh DMH Exercise 1W, F 2,17 = 12.5, p=.1 protrh DMH Ex α 2W, treatment: F 3,26 = 7.8, p=.1

11 % of Controls procrh CRH-R1 GR Corticosterone (88 ± 13 ng/ml) Adrenal (32 ±.8 mg) Restraint Control 1 ± 6 1 ± 5 1 ± 4 1 ± 12 1 ± 1 day 116 ± ± ± 41 n.m. 7 days 113 ± ± 1 96 ± ± 26 n.m. 14 days 94 ± ± 9 x 8 ± ± ± 3 Exercise Sedentary 1 ± 4 1 ± 11 1 ± 5 1 ± 3 1 ± 5 1 day 84 ± 7 n.m. n.m. 84 ± ± 8 3 days 16 ± 4 n.m. n.m. 199 ± ± 4 7 days 122 ± 5 n.m. n.m. 89 ± ± 1 14 days 97 ± 12 9 ± 9 89 ± ± 4 99 ± 12

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Introduction. Leptin secretion after a high-fat meal in normal-weight rats: strong predictor of long-term body fat accrual on a high-fat diet

Introduction. Leptin secretion after a high-fat meal in normal-weight rats: strong predictor of long-term body fat accrual on a high-fat diet Leptin secretion after a high-fat meal in normal-weight rats: strong predictor of long-term body fat accrual on a high-fat diet - Diet - Activity - Genetics etc. Introduction Obesity - Cardiovascular disease

More information

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8 Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory

More information

Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.

Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2. Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for

More information

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC Published in "" which should be cited to refer to this work. mrna extraction and RT-PCR Total RNA from 5 15 mg of crushed white adipose tissue was isolated using the technique described by Chomczynski

More information

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and

More information

Investigation of the role of nesfatin-1/nucb2 in the central nervous system. Ph.D. thesis Katalin Könczöl

Investigation of the role of nesfatin-1/nucb2 in the central nervous system. Ph.D. thesis Katalin Könczöl Investigation of the role of nesfatin-1/nucb2 in the central nervous system Ph.D. thesis Katalin Könczöl Semmelweis University János Szentágothai Doctoral School of Neurosciences Supervisor: Official reviewers:

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network

Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira

More information

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG

More information

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD) SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of

More information

A new obesity-prone, glucose intolerant rat strain (F.DIO)

A new obesity-prone, glucose intolerant rat strain (F.DIO) A new obesity-prone, glucose intolerant rat strain (F.DIO) Barry E. Levin 1,2, Ambrose A. Dunn-Meynell 1,2, Julie E. McMinn 3, Michael Alperovich 3, Amy Cunningham-Bussel 3, Streamson C. Chua, Jr. 3 Neurology

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Histogram showing hybridization signals for chicken (left) and quail (right) genomic DNA analyzed by Chicken GeneChip (n=3). www.nature.com/nature 1 Supplementary Figure 2. Independent

More information

Entrainment of the mouse circadian clock by sub-acute physical and psychological

Entrainment of the mouse circadian clock by sub-acute physical and psychological Supplementary Information Entrainment of the mouse circadian clock by sub-acute physical and psychological Yu Tahara 1, Takuya Shiraishi 1, Yosuke Kikuchi 1, Atsushi Haraguchi 1, Daisuke Kuriki 1, Hiroyuki

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Hormonal gain control of a medial preoptic area social reward circuit

Hormonal gain control of a medial preoptic area social reward circuit CORRECTION NOTICE Nat. Neurosci. 20, 449 458 (2017) Hormonal gain control of a medial preoptic area social reward circuit Jenna A McHenry, James M Otis, Mark A Rossi, J Elliott Robinson, Oksana Kosyk,

More information

Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice

Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice Am J Physiol Regul Integr Comp Physiol 284: R87 R100, 2003; 10.1152/ajpregu.00431.2002. Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice HEATHER

More information

Fat-Pad Specific Effects of Lipectomy on Appetitive and Consummatory Ingestive Behaviors in Siberian Hamsters (Phodopus sungorus)

Fat-Pad Specific Effects of Lipectomy on Appetitive and Consummatory Ingestive Behaviors in Siberian Hamsters (Phodopus sungorus) Georgia State University ScholarWorks @ Georgia State University Biology Honors Theses Department of Biology 6-9-2006 Fat-Pad Specific Effects of Lipectomy on Appetitive and Consummatory Ingestive Behaviors

More information

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,

More information

Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID

Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream

More information

Food Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Food Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Food Intake Regulation & the Clock Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Circadian disruption affect multiple organ systems: The diagram provides examples of how circadian disruption

More information

Hypothalamus. Small, central, & essential.

Hypothalamus. Small, central, & essential. Hypothalamus Small, central, & essential. Summary: You can t live without a hypothalamus. Located at the junction between the brain stem and the forebrain Medial hypothalamus: interface between the brain

More information

Supplementary Fig. 1: TBR2+ cells in different brain regions.

Supplementary Fig. 1: TBR2+ cells in different brain regions. Hip SVZ OB Cere Hypo Supplementary Fig. 1: TBR2 + cells in different brain regions. Three weeks after the last tamoxifen injection, TBR2 immunostaining images reveal a large reduction of TBR2 + cells in

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171 SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)

More information

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

Supplementary Information

Supplementary Information Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Nicolucci C. (1), Rossi S. (2), Catapane M. (1), Introduction:

Nicolucci C. (1), Rossi S. (2), Catapane M. (1), Introduction: Bisphenol A and Nicolucci C. (1), Rossi S. (2), Catapane M. (1), (1) Dept. Experimental Medicine, Second University of (2) Institute of Genetic and Biophysics, CNR, Naples (3) Dept. of Pediatrics 'F. Fede',

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected

More information

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23 3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF

More information

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very

More information

Protein quantitation guidance (SXHL288)

Protein quantitation guidance (SXHL288) Protein quantitation guidance (SXHL288) You may find it helpful to print this document and have it to hand as you work onscreen with the spectrophotometer. Contents 1. Introduction... 1 2. Protein Assay...

More information

Stress and Emotion. Stressors are things that challenge homeostasis -- these challenges may be real or merely anticipated

Stress and Emotion. Stressors are things that challenge homeostasis -- these challenges may be real or merely anticipated Stress and Emotion 1 Stressors are things that challenge homeostasis -- these challenges may be real or merely anticipated Stress responses are what the body does about it 2 1 Two broad stressor categories

More information

Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.

Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig. C D E F Mock 17 Mock 4.1 CD38 57 CD8 23.7 HLA-DR Ki67 G H I Cheng et al. Fig.S1 Supplementary Figure 1. persistent infection leads to human T cell depletion and hyper-immune activation. Humanized mice

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.

More information

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly, 1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day

More information

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with

More information

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195. pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus

More information

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION -. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17

More information

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95

More information

Social transmission and buffering of synaptic changes after stress

Social transmission and buffering of synaptic changes after stress SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-017-0044-6 In the format provided by the authors and unedited. Social transmission and buffering of synaptic changes after stress Toni-Lee

More information

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression) a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT

More information

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons

High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons Tim Klöckener 1,2,3, Simon Hess 2,4, Bengt F. Belgardt 1,2,3, Lars Paeger 2,4, Linda A. W. Verhagen

More information

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Royal jelly improves mental health

Royal jelly improves mental health 6 Apimedica & 5 Apiquality International Symposium, Nov., 2016 Royal jelly improves mental health Noriko Hattori, and Nagaragawa research center, email: ichihara-kenji@api3838.co.jp 1 Royal jelly is a

More information

Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between

Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between Myod +/ or Myod / females and Myod +/ ;Igf2 +/ males and

More information

Supplementary table I. Real-time primers used in the study. The fold change was obtained by

Supplementary table I. Real-time primers used in the study. The fold change was obtained by Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.

More information

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)

More information

a b c Physical appearance of mice Lean mass Adipocyte size d e f

a b c Physical appearance of mice Lean mass Adipocyte size d e f LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte

More information

Importance of NMDA Receptor Activation During Initial Exposure to a Stressor for Stress Response Habituation

Importance of NMDA Receptor Activation During Initial Exposure to a Stressor for Stress Response Habituation University of Colorado, Boulder CU Scholar Undergraduate Honors Theses Honors Program Fall 2012 Importance of NMDA Receptor Activation During Initial Exposure to a Stressor for Stress Response Habituation

More information

Midterm Exam MMI 409 Spring 2009 Gordon Bleil

Midterm Exam MMI 409 Spring 2009 Gordon Bleil Midterm Exam MMI 409 Spring 2009 Gordon Bleil Table of contents: (Hyperlinked to problem sections) Problem 1 Hypothesis Tests Results Inferences Problem 2 Hypothesis Tests Results Inferences Problem 3

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Splenic atrophy and leucopenia caused by T3 SCI.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Splenic atrophy and leucopenia caused by T3 SCI. Supplementary Figure 1 Splenic atrophy and leucopenia caused by T3 SCI. (a) Gross anatomy of representative spleens from control and T3 SCI mice at 28 days post-injury. (b and c) Hematoxylin and eosin

More information

Supporting Information

Supporting Information Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs

More information

Instructions for use. TSH rat ELISA. Please use only the valid version of the Instructions for Use provided with the kit AR E-8600

Instructions for use. TSH rat ELISA. Please use only the valid version of the Instructions for Use provided with the kit AR E-8600 Instructions for use TSH rat ELISA AR E-8600 TSH rat ELISA 1. INTRODUCTION 1.1 Intended use The TSH rat ELISA is an enzyme immunoassay for the quantitative measurement of TSH in rat serum. For research

More information

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock

More information

Control 7 d cold 7 d CL

Control 7 d cold 7 d CL Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week

More information

Metabolic Solutions Development Company, Kalamazoo, USA.

Metabolic Solutions Development Company, Kalamazoo, USA. New Insulin Sensitizers Produce Differentiation of Brown-like Adipose Cells from a Subcutaneous Fat Depot and Increase Secretion of Adiponectin in vitro William G. McDonald, Serena L. Cole, Danielle D.

More information

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)

More information

Instructions for use. TSH rat ELISA. Please use only the valid version of the Instructions for Use provided with the kit AR E-8600

Instructions for use. TSH rat ELISA. Please use only the valid version of the Instructions for Use provided with the kit AR E-8600 Instructions for use TSH rat ELISA AR E8600 TSH rat ELISA INTRODUCTION INTENDED USE The TSH rat ELISA is an enzyme immunoassay for the quantitative measurement of TSH in rat serum. For research use only.

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Ingestive Behaviors 21. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model)

Ingestive Behaviors 21. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model) Ingestive Behaviors 21 (a review of general endocrinology) A neuroendocrine system: components, a reflex arc, the endocrine system, the AN, endocrine / nervous systems as afferents and efferents, the theoretical

More information

High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22

High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Supplementary Information High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Max Gulhane 1, Lydia Murray 1, Rohan Lourie 1, Hui Tong 1, Yong H. Sheng 1, Ran

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

Inhibition of 11β-hydroxysteroid dehydrogenase type 1 reduces food intake and weight gain but maintains energy expenditure in diet-induced obese mice

Inhibition of 11β-hydroxysteroid dehydrogenase type 1 reduces food intake and weight gain but maintains energy expenditure in diet-induced obese mice Diabetologia (2006) 49: 1333 1337 DOI 10.1007/s00125-006-0239-y SHORT COMMUNICATION S. J. Y. Wang. S. Birtles. J. de Schoolmeester. J. Swales. G. Moody. D. Hislop. J. O Dowd. D. M. Smith. A. V. Turnbull.

More information

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.

More information

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

The central melanocortin system affects the hypothalamopituitary thyroid axis and may mediate the effect of leptin

The central melanocortin system affects the hypothalamopituitary thyroid axis and may mediate the effect of leptin The central melanocortin system affects the hypothalamopituitary thyroid axis and may mediate the effect of leptin M.S. Kim, C.J. Small, S.A Stanley, D.G.A. Morgan, L.J. Seal, W.M. Kong, C.M.B. Edwards,

More information