Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Size: px
Start display at page:

Download "Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and"

Transcription

1 Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and taqman probes are shown in supplemental table 1. Real-time quantitative PCR was performed using an ABI PRISM Sequence Detection System as described () (Applied Biosystems, Foster City, CA). For each gene, mrna expression levels were normalized to the levels of 1S ribosomal RNA. Semi-quantitative PCR was performed using sense '-GCATGCTCTGGATGGACATG-' and antisense '-TGGTGGCTTCTTGGATTCCT -' primers. Thirty-five cycles were performed at C for s, C for s, and C 11 for s. 1 Glucose and Insulin Tolerance Test (GTT and ITT) 1 After a 1h fast, glucose tolerance testing was performed in which mice were 1 injected intra-peritoneally (i.p.) with 1. g/kg (-week-old mice) or. g/kg 1 (-week-old mice) glucose. Insulin tolerance testing was performed after a h fast; 1 mice were injected i.p. with. units/kg (-week-old mice) or 1. units/kg 1 (-week-old mice) human regular insulin (Hummulin R; Eli Lilly Japan, Japan). Blood 1 glucose levels were measured at,,,, and min after injection. 1

2 Insulin release After a 1h fast, mice were injected i.p. with 1. g/kg glucose. Insulin was measured from blood samples collected,, and min after injection. Measurement of plasma ghrelin, des-acyl ghrelin, and Trp -ghrelin levels and Reverse phase HPLC Blood samples were collected from the inferior vena cavas of mice under anesthesia with diethyl ether. Samples were immediately transferred to polypropylene tubes containing 1 mg/ml Na EDTA and kallikrein inactivator U/ml aprotinin (Ohkura Pharmaceutical, Inc., Kyoto, Japan) and centrifuged at C. For N-RIA, hydrogen chloride was added to samples at a final concentration of.1 N immediately 11 after separating plasma. Plasma ghrelin was measured as previously reported (). 1 Briefly, samples were applied to Sep-Pak C1 cartridges prior to performing C-RIA and 1 N-RIA. Plasma samples were also subjected to reverse phase HPLC as described (1). 1 Measurements of body weights and length 1 Body weights were measured weekly beginning at two weeks of age. Body 1 lengths of -week-old mice were represented by measuring a single individual with 1 manual immobilization and extension of mice to determine the nose to-anus length. 1 Measurement of daily food intake

3 Eight-week-old mice were placed in individual cages; food intake was monitored every 1 hours (-) for a two-week period, facilitating the calculation of average daily food intake. Measurement of biochemical and hormonal parameters The levels of serum GH, insulin-like growth factor-i (IGF-I), insulin, NEFA, T.Cho, and TG levels were determined using a rat growth hormone EIA kit (SPI bio, Massy Cedes, France), a mouse IGF-I immunoassay kit (R&D Systems, Inc., Minneapolis, MN), a rat insulin ELISA kit (Morinaga, Yokohama, Japan), a NEFA C Assay kit, (Wako Pure Chemical Industries, Ltd., Osaka, Japan), Cholesterol E Assay kit, (Wako Pure Chemical Industries, Ltd., Osaka, Japan), and Triglyceride E Assay kit 11 (Wako Pure Chemical Industries, Ltd., Osaka, Japan), respectively. We measured blood 1 glucose levels by the glucose oxidase method using a Glutest sensor (Sanwa Kagaku, 1 Kyoto, Japan). 1 Measurement of total body fat percentage and lean body mass 1 Mice were anesthetized with pentobarbital. Total body fat percentages and lean 1 body masses were measured by computed tomography (Latheta LTC-, ALOKA, 1 Tokyo, Japan). 1 Statistical analyses

4 Results were expressed as means ± SEM. Statistical significance for Fig1A-C, FigB, D, F, FigA-D, Supplemental Fig1B-E, and Supplemental FigA, B were determined by two-sided Student s t test. Statistical significance for FigA, C, E, and Supplemental Fig1A, E, F were determined by repeated measures analysis of variance. P values less than. were considered to be statistically significant. All statistical analyses were performed by StatView (version.; SAS Institute, Inc., Cary, NC)

5 Supplemental Table 1: PCR primers and Taqman probes ghrelin GOAT Insulin 1 GH GHRH somatostati n (SST) NPY AgRP Orexin GHS-R sense '-GCATGCTCTGGATGGACATG-' antisense '-TGGTGGCTTCTTGGATTCCT-' probe '-AGCCCAGAGCACCAGAAAGCCCA-' sense '-AGGGACTCTAGGAAGGACAG-' antisense '-CCCATCTGAAAGAAGAAGGT-' with power SYBR Green sense '-CAGCTATAATCAGAGACCATCAGCAA-' antisense '-GGGTAGGAAGTGCACCAACAG-' probe '-CAGGTCATTGTTTCAAC-' sense '-AAGAGTTCGAGCGTGCCTACA-' antisense '-GAAGCAATTCCATGTCGGTTC-' probe '-CCATTCAGAATGCCCAGGCTGCTTTC-' sense '-AGGATGCAGCGACACGTAGA-' antisense '-TCTCCCCTTGCTTGTTCATGA-' probe '-CCACCAACTACAGGAAACTCCTGAGCCA-' sense '-AGCTGAGCAGGACGAGATGAG-' antisense '-ACAGGATGTGAATGTCTTCCAGTT-' probe '-CGAACCCAGCAATGGCACCCC-' sense '-TCCGCTCTGCGACACTACAT-' antisense '-GGAAGGGTCTTCAAGCCTTGT-' probe '-CAAGGGCTGGATCTCTTGCCATATCTCTG-' sense '-GCTCCACTGAAGGGCATCA-' antisense '-TAGCACCTCCGCCAAAGCT-' probe '-TTCCCAGGTCTAAGTCTGAATGGCCTCA-' sense '-TCCAGATTACTCCCCTGAGC-' antisense '-TCACGGCGGCCCAGGGAACC-' probe '-CAGGCACCATGAACTTTCCTTCTACAAAAGTT- sense '-CACCAACCTCTATCCAGCAT-' antisense '-CTGACAAACTGGAAGCGTTTGCA-' probe '-TCCGATCTGCTCATCTTCCTGTGCATG-'

6 Supplemental Figure legends Supplemental Figure 1: The analysis of Trp -ghrelin transgenic mice in early life. A: Changes in body weight of Trp -ghrelin- mice (closed triangles) and non-transgenic littermates (open squares) from to weeks of age (n = 1-1). B: Body lengths (nose-to-anus length) of -week-old Trp -ghrelin- mice (closed bars) and non-transgenic littermates (open bars) (n = -1).) and non-transgenic littermates (open squares) (n = 1-1). C and D: Serum GH (C) and IGF-I (D) levels were assessed in -week-old Trp -ghrelin- mice (closed bars) and non-transgenic littermates (open bars) (n = ). E: Average daily food intake of Trp -ghrelin- mice (closed bars) and non-transgenic littermates (open bars) from eight to weeks of age (n = -). 11 F: Glucose tolerance test using injection of 1. g/kg glucose was performed in 1 -week-old Trp -ghrelin- mice (closed triangles) and non-transgenic littermates 1 (open squares) (n= 1-1). 1 G: Insulin tolerance test with injection of regular insulin. U/kg was performed in 1 -week-old Trp -ghrelin- mice (closed triangles) and non-transgenic littermates 1 (open squares) (n = 1-1). 1 Data are presented as the means ± SEM. 1

7 Supplemental Figure : Hypothalamic and pituitary mrna levels of factors involved in GH regulation and food intake. A: The mrna levels of GH and the GH secretagogue receptor (GHS-R) in the pituitaries of -week-old Trp -ghrelin- mice (closed bars) and non-transgenic littermates (open bars). B: mrna levels of GH-releasing hormone (GHRH), somatostatin (SST), neuropeptide Y (NPY), agouti-related protein (AgRP), orexin (OR), and GHS-R in the hypothalamus samples from -week-old Trp -ghrelin- mice (closed bars) and non-transgenic littermates (open bars). n =, Data are presented as the means ± SEM.

8 A Body weight (g) non- B Body length (cm) 1 Weeks non- C D E Serum GH (ng/ml) 1 Serum IGF-I (ng/ml) Food intake (g/day) non- non-. non- E F Blood glucose (mg/dl) non- Time (min) Glucose change (%) non- 1 Time (min) Supplemental Figure 1

9 A. B. Arbitrary unit Arbitrary unit non GH non GHS-R. non- non- non- non- non- non- GHRH SST NPY AgRP OR GHS-R Supplemental Figure

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week

More information

a b c Physical appearance of mice Lean mass Adipocyte size d e f

a b c Physical appearance of mice Lean mass Adipocyte size d e f LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.

Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2. Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Characterization of a novel genetically obese mouse model demonstrating early onset hyperphagia and hyperleptinemia

Characterization of a novel genetically obese mouse model demonstrating early onset hyperphagia and hyperleptinemia Am J Physiol Endocrinol Metab 305: E451 E463, 2013. First published June 4, 2013; doi:10.1152/ajpendo.00540.2012. Characterization of a novel genetically obese mouse model demonstrating early onset hyperphagia

More information

Supplemental Materials, Nishimura et al, Page1 of 22 1

Supplemental Materials, Nishimura et al, Page1 of 22 1 Supplemental Materials, Nishimura et al, Page of 5 Quantitative assessment of Pdx promoter activity in vivo using a secreted luciferase reporter system 6 7 8 9 Wataru Nishimura, Koki Eto, Atsushi Miki,

More information

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according

More information

GLUCOSE CONCENTRATION INCREASES IGF EXPRESSION FROM SYNOVIAL MEMBRANE

GLUCOSE CONCENTRATION INCREASES IGF EXPRESSION FROM SYNOVIAL MEMBRANE GLUCOSE CONCENTRATION INCREASES IGF EXPRESSION FROM SYNOVIAL MEMBRANE Final Report Aug 17 2009 Darryl D'Lima, MD, PhD Shiley Center for Orthopaedic Research and Education at Scripps Clinic La Jolla, California

More information

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water

More information

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1 Table 1. Oligonucleotides and RT-PCR conditions. Overview of PCR templates, gene accession number of sequences used as template, product size, annealing temperatures and optimal cycles, cdna and MgCl 2

More information

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

Appeal decision. Appeal No USA HILL'S PET NUTRITION, INC. Osaka, Japan

Appeal decision. Appeal No USA HILL'S PET NUTRITION, INC. Osaka, Japan Appeal decision Appeal No. 2015-17056 USA Appellant HILL'S PET NUTRITION, INC. Osaka, Japan Patent Attorney MURAI, Koji The case of appeal against the examiner's decision of refusal of Japanese Patent

More information

Ghrelin mediates stressinduced. behavior in mice. Chuang et al 2011 L3: Love, Lust, Labor

Ghrelin mediates stressinduced. behavior in mice. Chuang et al 2011 L3: Love, Lust, Labor Ghrelin mediates stressinduced food-reward behavior in mice Chuang et al 2011 L3: Love, Lust, Labor Agenda Introduction What is Ghrelin? Previous Models New model Methods Results Discussion Conclusion

More information

Critical role for peptide YY in protein-mediated satiation and bodyweight

Critical role for peptide YY in protein-mediated satiation and bodyweight Cell Metabolism, Volume 4 Supplemental data Critical role for peptide YY in protein-mediated satiation and bodyweight regulation Rachel L. Batterham, Helen Heffron, Saloni Kapoor, Joanna E. Chivers, Keval

More information

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko

More information

Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU).

Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU). Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU). JCU (4g/kg) n=7 Vehicle (water 10 ml/kg) n=5 P value (between

More information

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow diet (n = 7 per genotype). Body weight and fed blood glucose

More information

Effects of sea squirt (Halocynthia roretzi) lipids on white adipose tissue weight and blood glucose in diabetic/obese KK-A y mice

Effects of sea squirt (Halocynthia roretzi) lipids on white adipose tissue weight and blood glucose in diabetic/obese KK-A y mice Molecular Medicine REPORTS 3: 449-453, 2010 Effects of sea squirt (Halocynthia roretzi) lipids on white adipose tissue weight and blood glucose in diabetic/obese KK-A y mice Nana Mikami, Masashi Hosokawa

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Supporting Information

Supporting Information Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs

More information

Elevated Circulating Level of Ghrelin in Cachexia Associated With Chronic Heart Failure. Relationships Between Ghrelin and Anabolic/Catabolic Factors

Elevated Circulating Level of Ghrelin in Cachexia Associated With Chronic Heart Failure. Relationships Between Ghrelin and Anabolic/Catabolic Factors Elevated Circulating Level of Ghrelin in Cachexia Associated With Chronic Heart Failure Relationships Between Ghrelin and Anabolic/Catabolic Factors Noritoshi Nagaya, MD; Masaaki Uematsu, MD; Masayasu

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Entrainment of the mouse circadian clock by sub-acute physical and psychological

Entrainment of the mouse circadian clock by sub-acute physical and psychological Supplementary Information Entrainment of the mouse circadian clock by sub-acute physical and psychological Yu Tahara 1, Takuya Shiraishi 1, Yosuke Kikuchi 1, Atsushi Haraguchi 1, Daisuke Kuriki 1, Hiroyuki

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Chapter 12. Ingestive Behavior

Chapter 12. Ingestive Behavior Chapter 12 Ingestive Behavior Drinking a. fluid compartments b. osmometric thirst c. volumetric thirst Eating a. energy sources b. starting a meal c. stopping a meal d. eating disordersd Drinking a. fluid

More information

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is

More information

Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4. glucose metabolism in mice.

Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4. glucose metabolism in mice. Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4 Binding Protein neurons in the regulation of whole body energy and glucose metabolism in mice. Eulalia Coutinho Department of Physiological

More information

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent

More information

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary

More information

Pair-fed % inkt cells 0.5. EtOH 0.0

Pair-fed % inkt cells 0.5. EtOH 0.0 MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded

More information

Introduction. Leptin secretion after a high-fat meal in normal-weight rats: strong predictor of long-term body fat accrual on a high-fat diet

Introduction. Leptin secretion after a high-fat meal in normal-weight rats: strong predictor of long-term body fat accrual on a high-fat diet Leptin secretion after a high-fat meal in normal-weight rats: strong predictor of long-term body fat accrual on a high-fat diet - Diet - Activity - Genetics etc. Introduction Obesity - Cardiovascular disease

More information

GH SECRETAGOGUES (GHSs) are synthetic compounds

GH SECRETAGOGUES (GHSs) are synthetic compounds 0013-7227/01/$03.00/0 The Journal of Clinical Endocrinology & Metabolism 86(10):4753 4758 Printed in U.S.A. Copyright 2001 by The Endocrine Society Stomach Is a Major Source of Circulating Ghrelin, and

More information

LESSON 3.3 WORKBOOK. How do we decide when and how much to eat?

LESSON 3.3 WORKBOOK. How do we decide when and how much to eat? Appetite The psychological desire to eat, driven by feelings of pleasure from the brain. Hunger The biological or physiological need to eat, caused by a release of hormones from the digestive tract. LESSON

More information

JLR Papers In Press. Published on October 16, 2003 as Manuscript D JLR200

JLR Papers In Press. Published on October 16, 2003 as Manuscript D JLR200 JLR Papers In Press. Published on October 16, 2003 as Manuscript D300024-JLR200 A method of direct measurement for the enzymatic determination of cholesterol esters Toshimi Mizoguchi 1, Toshiyuki Edano,

More information

Internal Regulation II Energy

Internal Regulation II Energy Internal Regulation II Energy Reading: BCP Chapter 16 lookfordiagnosis.com Homeostasis Biologically, what is necessary for life is a coordinated set of chemical reactions. These reactions take place in

More information

Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1

Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1 Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1 Authors: Georgios K. Paschos, Salam Ibrahim, Wen-Liang Song, Takeshige Kunieda, Gregory Grant, Teresa M. Reyes, Christopher

More information

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation

More information

perk/erk STAT5B

perk/erk STAT5B pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)

More information

Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus

Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Chen et al. 1 Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Hainan Chen 1, Xueying Gu 1, I-hsin Su 2, Rita Bottino

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

A 10.8 kb ghr fragment containing exons 4 and 5 was PCR amplified with Pfu Turbo. DNA polymerase (Stratagene) and cloned into pcr Blunt II-TOPO vector

A 10.8 kb ghr fragment containing exons 4 and 5 was PCR amplified with Pfu Turbo. DNA polymerase (Stratagene) and cloned into pcr Blunt II-TOPO vector Supplemental Method: Generation of a conditional GHR knockout mice. A 1.8 kb ghr fragment containing exons 4 and 5 was PCR amplified with Pfu Turbo DNA polymerase (Stratagene) and cloned into pcr Blunt

More information

Low ambient temperature lowers cholecystokinin and leptin plasma concentrations in adult men

Low ambient temperature lowers cholecystokinin and leptin plasma concentrations in adult men ISPUB.COM The Internet Journal of Gastroenterology Volume 7 Number 2 Low ambient temperature lowers cholecystokinin and leptin plasma concentrations in adult men M Pizon, P Tomasic, K Sztefko, Z Szafran

More information

FLASH CARDS. Kalat s Book Chapter 10 Alphabetical

FLASH CARDS.   Kalat s Book Chapter 10 Alphabetical FLASH CARDS www.biologicalpsych.com Kalat s Book Chapter 10 Alphabetical AgRP AgRP Agouti-related peptide; synthesized in hypothalamus. Acts as an appetite stimulator. Also decreases metabolism. aldosterone

More information

Ingestive Behaviors 33. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model)

Ingestive Behaviors 33. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model) Ingestive Behaviors 33 (a review of general endocrinology) A neuroendocrine system: components, a reflex arc, the endocrine system, the AN, endocrine / nervous systems as afferents and efferents, the theoretical

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly, 1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies

Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Copyright 2016. All Rights Reserved. Property of Theratechnologies Inc. Mechanism of Action of Tesamorelin

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Supplementary Information

Supplementary Information Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,

More information

Division of Hypothalamic Research, Departments of Internal Medicine and

Division of Hypothalamic Research, Departments of Internal Medicine and 1 5-HT 2C Rs Expressed by Pro-opiomelanocortin Neurons Regulate Insulin Sensitivity in Liver Yong Xu 1, 3*, Eric D. Berglund 1*, Jong-Woo Sohn 1, William L. Holland 2, Jen-Chieh Chuang 1, Makoto Fukuda

More information

Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN

Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN YK051 Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN 418 0011 Contents Introduction 2 Characteristics 3 Composition 4 Method 5-6 Notes

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

Human, Rat, Mouse Melanin Concentrating Hormone (MCH) ELISA Kit

Human, Rat, Mouse Melanin Concentrating Hormone (MCH) ELISA Kit Human, Rat, Mouse Melanin Concentrating Hormone (MCH) ELISA Kit Cat. No.:DEIA10659 Pkg.Size:96T Intended use The Human, Rat, Mouse Melanin Concentrating Hormone (MCH) ELISA Kit is intended for the detection

More information

Growth Hormone, Somatostatin, and Prolactin 1 & 2 Mohammed Y. Kalimi, Ph.D.

Growth Hormone, Somatostatin, and Prolactin 1 & 2 Mohammed Y. Kalimi, Ph.D. Growth Hormone, Somatostatin, and Prolactin 1 & 2 Mohammed Y. Kalimi, Ph.D. I. Growth Hormone (somatotropin): Growth hormone (GH) is a 191 amino acid single chain polypeptide (MW 22,000 daltons). Growth

More information

G hrelin, a 28-amino acid peptide with structural

G hrelin, a 28-amino acid peptide with structural 18 STOMACH Stomach regulates energy balance via acylated ghrelin and desacyl ghrelin A Asakawa, A Inui, M Fujimiya, R Sakamaki, N Shinfuku, Y Ueta, M M Meguid, M Kasuga... See end of article for authors

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Ryuhei KANAMOTO, Shinya KIMURA and Gaku OKAMURA. Graduate School of Agriculture, Kyoto Prefectural University, Kyoto ABSTRACT

Ryuhei KANAMOTO, Shinya KIMURA and Gaku OKAMURA. Graduate School of Agriculture, Kyoto Prefectural University, Kyoto ABSTRACT Ryuhei KANAMOTO, Shinya KIMURA and Gaku OKAMURA Graduate School of Agriculture, Kyoto Prefectural University, Kyoto 606-8522 ABSTRACT Recently, a group of lipophilic proteins (LP) associated with lecithin

More information

Supplemental Data Tamoxifen administration to Vil-Scap- mice.

Supplemental Data Tamoxifen administration to Vil-Scap- mice. Supplemental Data FIGURE S1. Tamoxifen administration to Vil-Scap - mice. In the experiments shown in Fig. 1 to Fig. 5, tamoxifen (2 mg per dose) was dissolved in corn oil and administered by orogastric

More information

Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC

Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC Supplementary information Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC Pathway in Pancreatic -Cells Authors: Hodaka Yamada 1,*, Masashi Yoshida 1,*, Kiyonori Ito 1, Katsuya

More information

Effects of Novel Growth Hormone Secretagogues on Growth Hormone Secretion in Farm Animals

Effects of Novel Growth Hormone Secretagogues on Growth Hormone Secretion in Farm Animals Beef Research Report, 1996 Animal Science Research Reports 1997 Effects of Novel Growth Hormone Secretagogues on Growth Hormone Secretion in Farm Animals Lloyd L. Anderson Iowa State University Follow

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

Chapter 24 Cholesterol, Energy Balance and Body Temperature. 10/28/13 MDufilho

Chapter 24 Cholesterol, Energy Balance and Body Temperature. 10/28/13 MDufilho Chapter 24 Cholesterol, Energy Balance and Body Temperature 10/28/13 MDufilho 1 Metabolic Role of the Liver Hepatocytes ~500 metabolic functions Process nearly every class of nutrient Play major role in

More information

Recent results of the research into the possible contribution of whey powders in the fight against obesity. David J Baer, PhD

Recent results of the research into the possible contribution of whey powders in the fight against obesity. David J Baer, PhD Recent results of the research into the possible contribution of whey powders in the fight against obesity David J Baer, PhD Beltsville Human Nutrition Research Center Funded by USDA, ARS and the Whey

More information

Digestion: Endocrinology of Appetite

Digestion: Endocrinology of Appetite Digestion: Endocrinology of Dr. Ritamarie Loscalzo Medical Disclaimer: The information in this presentation is not intended to replace a one on one relationship with a qualified health care professional

More information

Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control

Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control Jan Trost Prof. Gudrun A. Brockmann Humboldt Universität zu Berlin Department of Crop and Animal Sciences Breeding Biology and Molecular

More information

Title Modified Western blotting for insulin and other diabetes-associated peptide hormones

Title Modified Western blotting for insulin and other diabetes-associated peptide hormones Supplemental Figures Title Modified Western blotting for insulin and other diabetes-associated peptide hormones Authors Naoyuki Okita, Yoshikazu Higami, Fumio Fukai, Masaki Kobayashi, Miku Mitarai, Takao

More information

Kazumi YAGASAKI, Masato NAGAOKA and Yutaka MIURA

Kazumi YAGASAKI, Masato NAGAOKA and Yutaka MIURA Kazumi YAGASAKI, Masato NAGAOKA and Yutaka MIURA Division of Agriscience and Bioscience, Institute of Symbiotic Science and Technology, Tokyo University of Agriculture and Technology, Fuchu 183-8509 ABSTRACT

More information

Supplemental Table 1. List of primers used for real time PCR.

Supplemental Table 1. List of primers used for real time PCR. Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse

More information

Endocrine Regulation of Energy Metabolism: Review of Pathobiochemical and Clinical Chemical Aspects of Leptin, Ghrelin, Adiponectin, and Resistin

Endocrine Regulation of Energy Metabolism: Review of Pathobiochemical and Clinical Chemical Aspects of Leptin, Ghrelin, Adiponectin, and Resistin Clinical Chemistry 50:9 1511 1525 (2004) Review Endocrine Regulation of Energy Metabolism: Review of Pathobiochemical and Clinical Chemical Aspects of Leptin, Ghrelin, Adiponectin, and Resistin Ursula

More information

Supporting Information

Supporting Information Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween

More information

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Research article MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Hajime Kanda, 1 Sanshiro Tateya, 1 Yoshikazu Tamori, 1 Ko Kotani,

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular

More information

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency AdPLA AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency Kathy Jaworski, Maryam Ahmadian, Robin E. Duncan, Eszter Sarkadi-Nagy, Krista A. Va rady,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

Protein extraction and western blot analysis Protein extraction was performed as

Protein extraction and western blot analysis Protein extraction was performed as ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1,

More information

A Tryptophan Hydroxylase Inhibitor Decreases Hepatic FGF21 Expression and Circulating FGF21 in Mice Fed A High-Fat Diet

A Tryptophan Hydroxylase Inhibitor Decreases Hepatic FGF21 Expression and Circulating FGF21 in Mice Fed A High-Fat Diet A Tryptophan Hydroxylase Inhibitor Decreases Hepatic FGF21 Expression Circulating FGF21 in Mice Fed A High-Fat Diet Katsunori Nonogaki, Takao Kaji, Mari Murakami Abstract Background: Fibroblast growth

More information

Ghrelin Stimulates Porcine Somatotropes

Ghrelin Stimulates Porcine Somatotropes Animal Industry Report AS 650 ASL R1957 2004 Ghrelin Stimulates Porcine Somatotropes Aleksandra Glavaski-Joksimovic Ksenija Jeftinija Colin G. Scanes Lloyd L. Anderson Srdija Jeftinija Recommended Citation

More information

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla

More information

Obese Type 2 Diabetic Model. Rat Model with Early Onset of Diabetic Complications. SDT fatty rats. SDT fatty rats

Obese Type 2 Diabetic Model. Rat Model with Early Onset of Diabetic Complications. SDT fatty rats. SDT fatty rats Obese Type 2 Diabetic Model rats Rat Model with Early Onset of Diabetic Complications rats Background and Origin In 24, Dr. Masuyama and Dr. Shinohara (Research Laboratories of Torii Pharmaceutical Co.,

More information

Motility Conference Ghrelin

Motility Conference Ghrelin Motility Conference Ghrelin Emori Bizer, M.D. Division of Gastroenterology/Hepatology November 21, 2007 Ghrelin: Basics Hormone produced by the A-like A endocrine cells in the oxyntic mucosa (stomach body

More information

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice. competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

Adrenocorticotropin Responses to Corticotropin Releasing Factor and Vasopressin in Spontaneously Hypertensive Rats

Adrenocorticotropin Responses to Corticotropin Releasing Factor and Vasopressin in Spontaneously Hypertensive Rats Laboratory Studies Adrenocorticotropin Responses to Corticotropin Releasing Factor and Vasopressin in Spontaneously Hypertensive Rats TERUHIKO HATTORI, KOZO HASHIMOTO, AND ZENSUKE OTA SUMMARY The effects

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

Establishment and Pathophysiological Characterization of Type 2 Diabetic Mouse Model Produced by Streptozotocin and Nicotinamide

Establishment and Pathophysiological Characterization of Type 2 Diabetic Mouse Model Produced by Streptozotocin and Nicotinamide June 2006 Biol. Pharm. Bull. 29(6) 1167 1174 (2006) 1167 Establishment and Pathophysiological Characterization of Type 2 Diabetic Mouse Model Produced by Streptozotocin and Nicotinamide Tomonori NAKAMURA,*,a

More information

The somatopause. What stops our growth and diminishes GH secretion?

The somatopause. What stops our growth and diminishes GH secretion? The somatopause What stops our growth and diminishes GH secretion? What extends or stops statural growth? Statural growth is extended if the early growth rate is slowed underfed adolescents grow for a

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/science.118828/dc1 Supporting Online Material for Is an Anti-Inflammatory Adipokine That Modulates Metabolic Dysfunction in Obesity Noriyuki Ouchi, Akiko Higuchi, Koji

More information

Motivation 1 of 6. during the prandial state when the blood is filled

Motivation 1 of 6. during the prandial state when the blood is filled Motivation 1 of 6 I. INTRODUCTION A. Motivation: a condition (usually internal) that initiates, activates, or maintains goal-directed behavior. B. Archery analogy 1. undrawn bow has no potential energy

More information

Conflict of interest regarding this presentation:

Conflict of interest regarding this presentation: 2 Conflict of interest regarding this presentation: I wish to declare a potential conflict of interest, and that I have received either direct or indirect industry support in relation to all or part of

More information

Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved

Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved 1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich

More information

Title. CitationJournal of Bioscience and Bioengineering, 100(1): 12. Issue Date Doc URL. Type. File Information

Title. CitationJournal of Bioscience and Bioengineering, 100(1): 12. Issue Date Doc URL. Type. File Information Title Effect of chondroitin sulfate and hyaluronic acid on Author(s)Nishimoto, Shohei; Takagi, Mutsumi; Wakitani, Shigey CitationJournal of Bioscience and Bioengineering, 100(1): 12 Issue Date 2005-07

More information