Contribution of Interstitial Valve Cells to Aortic Valve Calcification
|
|
|
- Erika Gibson
- 5 years ago
- Views:
Transcription
1 UNIVERSITÀ DEGLI STUDI DI PADOVA SEDE AMMINISTRATIVA: UNIVERSITÀ DEGLI STUDI DI PADOVA DIPARTIMENTO DI SCIENZE MEDICO-DIAGNOSTICHE E TERAPIE SPECIALI SCUOLA DI DOTTORATO DI RICERCA IN SCIENZE MEDICHE, CLINICHE E SPERIMENTALI INDIRIZZO: SCIENZE CARDIOVASCOLARI CICLO XXI Contribution of Interstitial Valve Cells to Aortic Valve Calcification Coordinatore: Ch.mo Prof. Gaetano Thiene Supervisore: Ch.mo Prof. Paolo Pauletto Dottorando: Dott. Marcello Rattazzi
2 Ai miei genitori,
3 INDEX Abbreviations 1. Riassunto p Summary p Introduction p Epidemiology of aortic valve calcification p Aortic valve developmental biology and functional structure p The developing aortic valve p The adult aortic valve p Mechanisms of vascular calcification p Induction of bone formation p Loss of inhibition p Cell death p Circulating calciprotein particles p Pathogenesis of aortic valve calcification p Aim of the study p Methods p Bovine tissue collection and VIC isolation p Treatments of uncloned and cloned VIC p VIC seeding on collagen scaffolds p Immunocytochemical and histochemical studies p Calcium deposition assay p Alkaline phosphatase activity assay p Flow cytometry analysis p Proteomic analysis p Western blotting analysis p Measurement of reactive oxygen species production p Statistical analysis p. 48
4 10. Results p Phenotypic cell profile of intact aortic valve leaflet p Isolation and characterization of BVIC clones p Endotoxin and phosphate effects on ALP activity expression and calcium deposition in uncloned BVIC p Selective response of BVIC clones to endotoxin and phosphate treatment p Calcification of collagen scaffolds by BVIC clones p Modification in cytosolic protein profile in clonal cells acquiring a pro-calcific phenotype p Reactive oxygen species production in pro-calcific clonal cells p Discussion p References p. 75 Appendix
5 Abbreviations AB: apoptotic bodies ACE: angiotensin-converting enzyme ADMA: asymmetric dimethylarginine ALP: alkaline phosphatase AngII: angiotensin II ApoE-/-: apoliproteine deficient mice AT1: angiotensin receptor-1 avic: activated VIC BMI: body mass index BMP: bone morphogenic proteins BVIC: bovine interstitial valve cells CAD: coronary artery disease Cbfa-1: core binding factor alfa-1 Chm-I: chondromodulin-i CVC: calcifying vascular cells DDAH: dimethylarginine dimethylaminohydrolase EC: endothelial cells ECM: extracellular matrix EMT: endothelial mesenchymal transition Ennp1: ectonucleotide pyrophosphatase/phosphodiesterase1/pc-1 Ennp1-/-: Ennp1 deficient mice ESRD: end-stage renale disease evic: embryonic VIC FGF-23: fibroblast growth factor-23 FGF-23-/-: FGF-23 deficient mice HA: hydroxyapatite Hsp: heat shock protein ICAM-1: intracellular adhesion molecule-1 IL: interleukin LDL: low density lipoprotein LDLr-/-: LDL receptor deficient mice LPS: lypopolisaccaride/endotoxin Lrp5: LDL receptor-related protein5 MGP: matrix-gla protein MGP-/-: MGP deficient mice MMP: matrix metalloproteinase Msx2: Msh homeobox 2 MV: matrix vescicles NAFTc1: Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 NMM: non muscle myosin NO: nitric oxide NOS: nitric oxide synthase Notch1: Notch homolog 1, translocationassociated obvic: osteoblastic VIC OC: osteocalcin ON: osteonectin OPG: osteoprotegerin OPG-/-: OPG deficient mice OPN: osteopontin OPN-/-: OPN deficient mice oxldl: oxidized LDL Pi: inorganic phosphate PPi: inorganic pyrophosphate pvic: precursor VIC qvic: quiescent VIC RANK: receptor activator of NF-kB RANKL: receptor activator of NF-kB ligand RANKL-/-: RANKL deficient mice RAS: renin-angiotensin system ROS: reactive oxygen species Runx2: runt-related transcription factor 2 SMA: smooth muscle α-actin SMC: smooth muscle cells SMemb: embryonic smooth muscle heavy chain SMM: smooth muscle myosin SOD[Cu-Zn]: superoxide dismutase [Cu-Zn] Sox-9: SRY-box 9 TGF-β: transforming growth factor-β TIMP: tissue inhibitor of metalloproteinases TLR: toll-like receptor TNFα: tumor necrosis factor-α VCAM-1: vascular cell adhesion molecole-1 VEC: valve endothelial cells VEGF: vascular endothelial growth factor VIC: valve interstitial cell vwf: von Willebrand Factor
6
조현재 서울대학교병원순환기내과, 심혈관연구실,
Molecular Mechanism of Vascular Calcification 2010. 4. 17. 조현재 서울대학교병원순환기내과, 심혈관연구실, 서울대학교병원심혈관센터 Vascular calcification : clinical hurdles Vascular calcification : clinical significance! Clinical consequences
Generation of post-germinal centre myeloma plasma B cell.
Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused
A Comparative Study on Calcification of Aortic Valves
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2016 A Comparative Study on Calcification of Aortic Valves Shirin Masjedi University
Role of androgens in vascular smooth muscle cell calcification
Role of androgens in vascular smooth muscle cell calcification Tania Tsatralis A thesis submitted in fulfilment of the requirements for the degree of Master of Science University of Technology, Sydney
Calcification of Porcine Aortic Valvular Interstitial Cells
Calcification of Porcine Aortic Valvular Interstitial Cells Liwen Gu 1,2* Supervisor: Craig A. Simmons 1 Department of Engineering Science, 2 Institute of Biomaterials and Biomedical Engineering, University
Fructose Upregulates FGF23 Expression In MC3T3 Pre-osteoblasts
Fructose Upregulates FGF23 Expression In MC3T3 Pre-osteoblasts Edek A. Williams, B.S.E., Veronique Douard, Ph.D., Joseph M. Lomuti, B.S., Ronaldo Ferraris, Ph.D., J. C. Fritton, Ph.D.. Rutgers University,
Molecular and cellular mechanisms of valve calcification Adrian H. Chester
O P E N A C C E S S Review Article Molecular and cellular mechanisms of valve calcification Adrian H. Chester Imperial College London Heart Science Centre, Harefield Hospital, Harefield, Middlesex. UB9
Molecular Mechanisms of Vascular Calcification
Molecular Mechanisms of Vascular Calcification Catherine Shanahan, PhD Cardiovascular Division, King s College London, UK ESC, Munich, August 2012 CONFLICTS OF INTEREST: NONE TO DECLARE Vascular smooth
renoprotection therapy goals 208, 209
Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization
MOLECULAR AND CELLULAR MECHANISMS OF VASCULAR CALCIFICATION: PATHOGENESIS AND TREATMENT
UNIVERSITA DEGLI STUDI DI MILANO Dipartimento di Scienze della Salute Scuola di Dottorato in Scienze Biochimiche, Nutrizionali e Metaboliche Corso di Dottorato in Fisiopatologia, Farmacologia, Clinica
The Study of Endothelial Function in CKD and ESRD
The Study of Endothelial Function in CKD and ESRD Endothelial Diversity in the Human Body Aird WC. Circ Res 2007 Endothelial Diversity in the Human Body The endothelium should be viewed for what it is:
New Insights into the Puzzling Pathogenesis of Calcific Aortic Stenosis
New Insights into the Puzzling Pathogenesis of Calcific Aortic Stenosis Chen Li *, BSc., Songyi Xu *, MSc., Avrum I. Gotlieb, MDCM, FRCPC Departments of Pathology, Toronto General Research Institute, University
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
: Soft Bones Hard Arteries
: Soft Bones Hard Arteries The Bone Vascular Axis in CKD/ESRD Gérard London INSERM U970, PARIS Yearly % gains in aortic calcification and bone loss in the women (n=157) with vascular calcifications at
Biochemistry #01 Bone Formation Dr. Nabil Bashir Farah Banyhany
Biochemistry #01 Bone Formation Dr. Nabil Bashir Farah Banyhany Greetings This lecture is quite detailed, but I promise you will make it through, it just requires your 100% FOCUS! Let s begin. Today s
The Mechanism of Discoidin Domain Receptor 1 Mediated Vascular Calcification
The Mechanism of Discoidin Domain Receptor 1 Mediated Vascular Calcification By Mark H. Wan A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department
Declaration of conflict of interest
Declaration of conflict of interest Inhibitors of vascular calcification what have we learned from animal models Ralf Westenfeld Department of Cardiology Heinrich-Heine-University Düsseldorf Do you know
silent epidemic,. (WHO),
Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining
The Role of Microenvironment in the Control of Tumor Angiogenesis
The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
Apelin attenuates the osteoblastic differentiation of aortic valve interstitial cells via the ERK and PI3 K/Akt pathways
Amino Acids (2015) 47:2475 2482 DOI 10.1007/s00726-015-2020-3 ORIGINAL ARTICLE Apelin attenuates the osteoblastic differentiation of aortic valve interstitial cells via the ERK and PI3 K/Akt pathways Zhao
Introduction. Acute sodium overload produces renal tubulointerstitial inflammation in normal rats
Acute sodium overload produces renal tubulointerstitial inflammation in normal rats MI Roson, et al. Kidney International (2006) Introduction Present by Kanya Bunnan and Wiraporn paebua Tubular sodium
Dyslipidemia Endothelial dysfunction Free radicals Immunologic
ATHEROSCLEROSIS Hossein Mehrani Professor of Clinical Biochemistry Definition Atherosclerosis: Is a chronic inflammatory process characterized by plaque formation within the vessel wall of arteries and
Vascular Calcification Increased Cardiovascular Events ~ 20% ~ 60% ~ 90% Age. young middle elderly. 5-year mortality.
Vascular Calcification Increased Cardiovascular Events ~ 2% ~ 6% ~ 9% 2 4 6 young middle elderly Age 5-year mortality Framingham Risk Women had a greater probabilityofdeath than men in each strata of vascular
Vavlular heart diseases result in deaths annually
This article is part of a thematic series on Pathobiology of Calcific Vasculopathy and Valvulopathy, which includes the following articles: Thematic series on the pathobiology of vascular calcification:
Vavlular heart diseases result in deaths annually
This article is part of a thematic series on Pathobiology of Calcific Vasculopathy and Valvulopathy, which includes the following articles: Thematic series on the pathobiology of vascular calcification:
Cellular Interactions Underlying Vascular Calcification in Diabetes
Clemson University TigerPrints All Theses Theses 5-2016 Cellular Interactions Underlying Vascular Calcification in Diabetes Lisa Ann Larrew Clemson University, llarrew@clemson.edu Follow this and additional
Sphingosine-1-phosphate signaling and cardiac fibrosis. Department of Physiology, Kanazawa University School of Medicine, Kanazawa, Japan
96 Special Issue: Cellular and Molecular Bases for Fibrotic Diseases Review Article Sphingosine-1-phosphate signaling and cardiac fibrosis Noriko Takuwa 1, 2, ), Yasuo Okamoto 1), Kazuaki Yoshioka 1) and
ROLE OF INFLAMMATION IN HYPERTENSION. Dr Barasa FA Physician Cardiologist Eldoret
ROLE OF INFLAMMATION IN HYPERTENSION Dr Barasa FA Physician Cardiologist Eldoret Outline Inflammation in CVDs the evidence Basic Science in Cardiovascular inflammation: The Main players Inflammation as
Omics and coronary atherosclerosis
Omics and coronary atherosclerosis Dr.ssa Rosalinda Madonna Centro Scienze dell Invecchiamento e Medicina Traslazionale CESI-Met Università G. d Annunzio Chieti Geographic Distribution of Relative Mortality
T cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry
METABOLISM of ADIPOSE TISSUE
METABOLISM of ADIPOSE TISSUE 2. LF UK Prof. Rudolf Poledne, PhD. TYPES OF ADIPOSE TISSUE brown adipose tissue subcutaneous adipose tissue visceral adipose tissue ADIPOSE TISSUE FUNCTIONS: thermal isolation
Cell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
RANKL system in vascular and valve calcification with aging
Kawakami et al. Inflammation and Regeneration (2016) 36:10 DOI 10.1186/s41232-016-0016-3 Inflammation and Regeneration REVIEW RANKL system in vascular and valve calcification with aging Open Access Ryo
Phospholipase C γ Prof. Graham Carpenter
Graham Carpenter, h.d. rofessor of Biochemistry Cornelia Crooke Department of Biochemistry Vanderbilt University School of Medicine, Nashville, TN 1 Receptor Tyrosine Kinases GF Extracellular M Intracellular
Cardiovascular Mortality: General Population vs ESRD Dialysis Patients
Cardiovascular Mortality: General Population vs ESRD Dialysis Patients Annual CVD Mortality (%) 100 10 1 0.1 0.01 0.001 25-34 35-44 45-54 55-64 66-74 75-84 >85 Age (years) GP Male GP Female GP Black GP
Valve interstitial cell activation and proliferation are associated with changes in β-catenin
Valve interstitial cell activation and proliferation are associated with changes in β-catenin by Songyi Xu A thesis submitted in conformity with the requirements for the degree of Master of Science Department
Stefanos K. Roumeliotis. Department of Nephrology, Medical School Democritus University of Thrace, Alexandroupolis, Greece. Stefanos K.
Department of Nephrology, Medical School Democritus University of Thrace, Alexandroupolis, Greece Passive, degenerative accumulation process of Ca ++ /P +++ without treatment options Active, complex, condition:
Seeds and soil theory by Stephen Paget at the end of the XIX century.
Seeds and soil theory by Stephen Paget at the end of the XIX century. In The Distribution Of Secondary Growths In Cancer Of The Breast Paget presents and analyzes 735 fatal cases of breast cancer, complete
Doppler ultrasound, see Ultrasonography. Magnetic resonance imaging (MRI), kidney oxygenation assessment 75
Subject Index Acidemia, cardiorenal syndrome type 3 146 Acute Dialysis Quality Initiative (ADQI) acute kidney injury biomarkers, see Acute kidney injury; specific biomarkers cardiorenal syndrome, see specific
Materials and Methods
Short term hyperthermia prevents activation of proinflammatory genes in type B synoviocytes by blocking the activation of the transcription factor NF-κB Marica Markovic Institute of Medical Biochemistry,
Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi
Role of Vitamin D receptor (VDR) in HIV induced tubular injury Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi 07/10/2015 INTRODUCTION Vitamin D is technically not a Vitamin;
Comment les cellules osseuses communiquent entre elles. Gérard Friedlander Journées UPA 2011
Comment les cellules osseuses communiquent entre elles Gérard Friedlander Journées UPA 2011 Structure de l os Osteocyte Ostéoclaste Remodelage osseux RANKL RANK NF-kB pathway Stem cell progenitor precursor
Effects of Kidney Disease on Cardiovascular Morbidity and Mortality
Effects of Kidney Disease on Cardiovascular Morbidity and Mortality Joachim H. Ix, MD, MAS Assistant Professor in Residence Division of Nephrology University of California San Diego, and Veterans Affairs
Cell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
This article is part of a thematic series on Pathobiology of Calcific Vasculopathy and Valvulopathy, which includes the following articles:
This article is part of a thematic series on Pathobiology of Calcific Vasculopathy and Valvulopathy, which includes the following articles: Thematic Series on the Pathobiology of Vascular Calcification:
Innate Immunity II. Integration. Lindsay Nicholson Advanced Immunology L2
Innate Immunity II Integration Lindsay Nicholson Advanced Immunology L2 l.nicholson@bristol.ac.uk Lecture 1 Defining Innate Immunity Recognition and effector mechanisms (I) Lecture 2 Recognition and effector
Novel Markers of Arterial Dysfunction
혈관연구회창립심포지움, 3 월 3 일, 2005 Novel Markers of Arterial Dysfunction Kwang Kon Koh, MD, FACC, FAHA Cardiology Gachon Medical School Incheon, Korea Atherosclerosis: A progressive process PHASE I: Initiation
Obstructive nephropathy: Insights from genetically engineered animals
Kidney International, Vol. 68 (2005), pp. 925 937 Obstructive nephropathy: Insights from genetically engineered animals JEAN-LOUP BASCANDS and JOOST P. SCHANSTRA Inserm U388, Institut Louis Bugnard, Touluse
Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin
Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity
IL-17 in health and disease. March 2014 PSO13-C051n
IL-17 in health and disease March 2014 PSO13-C051n Originally Researchers Suggested That IL-12 and IL-4 drove Th Cell Differentiation Naïve CD4 + T cell Question: Which of these cell types is responsible
Osteoporosis and atherosclerosis: biological linkages and the emergence of dual-purpose therapies
Q J Med 2005; 98:467 484 Advance Access publication 13 June 2005 doi:10.1093/qjmed/hci077 Review Osteoporosis and atherosclerosis: biological linkages and the emergence of dual-purpose therapies D. HAMERMAN
Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S100A9
Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S1A9 Joanna Nikitorowicz-Buniak UCL Division of Medicine Systemic sclerosis
BONE MORPHOGENETIC PROTEIN BINDING ENDOTHELIAL REGULATOR (BMPER) REGULATES VASCULAR INFLAMMATORY RESPONSES IN ENDOTHELIAL CELLS. Pamela P.
BONE MORPHOGENETIC PROTEIN BINDING ENDOTHELIAL REGULATOR (BMPER) REGULATES VASCULAR INFLAMMATORY RESPONSES IN ENDOTHELIAL CELLS Pamela P. Lockyer A thesis submitted to the faculty at the University of
Cardiovascular Protection and the RAS
Cardiovascular Protection and the RAS Katalin Kauser, MD, PhD, DSc Senior Associate Director, Boehringer Ingelheim Pharmaceutical Inc. Micardis Product Pipeline Scientific Support Ridgefield, CT, USA Cardiovascular
The role of the calcium sensing receptor as a modulator of smooth muscle cell mineralisation
The role of the calcium sensing receptor as a modulator of smooth muscle cell mineralisation Presented for the degree of Master of Philosophy to Cardiff University Siobhan Briody (0829409) September, 2011
EARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES
EARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES JAMES M. ANDERSON, MD, PhD DISTINGUISHED UNIVERSITY PROFESSOR DEPARTMENTS OF PATHOLOGY, MACROMOLECULAR SCIENCE, AND BIOMEDICAL ENGINEERING CASE WESTERN
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
Osteoporosis and its Association with Rheumatoid Arthritis and Prednisolone Therapy
Osteoporosis and its Association with Rheumatoid Arthritis and Prednisolone Therapy Master s Thesis Ane Eriksen Medicine with Industrial Specialization Aalborg University Osteoporosis and its Association
Peggers Super Summaries Basic Sciences Bone
Bone Overview & Turnover BONES Function o Support o Protection o Assisting movement o Storage of minerals o Production of red blood cells from marrow Types o Cancellous o Compact with Haversian systems
Tissue renewal and Repair. Nisamanee Charoenchon, PhD Department of Pathobiology, Faculty of Science
Tissue renewal and Repair Nisamanee Charoenchon, PhD Email: nisamanee.cha@mahidol.ac.th Department of Pathobiology, Faculty of Science Topic Objectives 1. Describe processes of tissue repair, regeneration
Markers of increased atherosclerotic risk in patients with chronic kidney disease: a preliminary study
Gluba-Brzózka et al. Lipids in Health and Disease (2016) 15:22 DOI 10.1186/s12944-016-0191-x RESEARCH Open Access Markers of increased atherosclerotic risk in patients with chronic kidney disease: a preliminary
REVINAGE. The real bio-retinol
REVINAGE The real bio-retinol Aging of the world United Nations 2015 Report Aging Who wants to get old? Retinoids o Family of compounds related to vitamin A and its derivatives o They interact with specific
DAX1, testes development role 7, 8 DFFRY, spermatogenesis role 49 DMRT genes, male sex differentiation role 15
Subject Index N-Acetylcysteine, sperm quality effects 71 Ambiguous genitalia, origins 1, 2 Anti-Müllerian hormone function 13 receptors 13 Sertoli cell secretion 10, 38 Apoptosis assays in testes 73, 74
Prof. Isabelle Six INSERM Unit 1088 Jules Verne University of Picardie Amiens, France. Slide 1. Slide 2
Effects of phosphate on vascular function New insights Isabelle Six, Amiens, France Chairs: Griet Glorieux, Ghent, Belgium Alberto Ortiz, Madrid, Spain Prof. Isabelle Six INSERM Unit 1088 Jules Verne University
Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies. Traditional Hypothesis Stress
3/1/212 Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies K.R. Stenmark University of Colorado Denver, CO 845 Prominent Fibroproliferative
MinimallyModifiedLDLInducesActinPolymerization Macrophages viacd14signalingpathway.
MinimallyModifiedLDLInducesActinPolymerization Macrophages viacd14signalingpathway. *Randon T. Hall I, Joseph L. Witztum2, Yury I. Miller2 From the IMSTP-SURF Program and 2Division of Endocrinology and
Deposition of Bone by the Osteoblasts. Bone is continually being deposited by osteoblasts, and it is continually being resorbed where osteoclasts are
Bone remodeling Deposition of Bone by the Osteoblasts. Bone is continually being deposited by osteoblasts, and it is continually being resorbed where osteoclasts are active. This mechanism is always is
Arterial calcification in patients with chronic kidney disease
2488 N. Koleganova et al. 25. Kannel WB, Kannel C, Paffenbarger RS Jr et al. Heart rate and cardiovascular mortality: the Framingham Study. Am Heart J 1987;113: 1489 1494 26. Palatini P, Julius S. Association
physical properties depend on: electrostatic bonds between collagen/elastic fibers and GAGs water bound to negatively charged sulfated GAG chains
connective/supporting tissue bears mechanical stress without distortion -> shock absorption smooth surface -> facilitates movements of joints guides development of bones chondrocytes extracellular matrix
David Ramenofsky, MD Bryan Kestenbaum, MD
Association of Serum Phosphate Concentration with Vascular Calcification in Patients Free of Chronic Kidney Disease: The Multi Ethnic Study of Atherosclerosis David Ramenofsky, MD Bryan Kestenbaum, MD
Role of Inflammation in Pulmonary Hypertension
Role of Inflammation in Pulmonary Hypertension K. R. Stenmark University of Colorado Denver, USA Prominent Fibroproliferative Changes are Observed in the Lung Vasculature of Infants With Pulmonary Arterial
Nano-analytical electron microscopy reveals fundamental insights into human cardiovascular tissue calcification
Nano-analytical electron microscopy reveals fundamental insights into human cardiovascular tissue calcification Supplementary table 1: Aortic valve donor information (n=32). Patient age (yr) 57±11 (range:
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
9/23/2017. Prof. Steven S. Saliterman. Department of Biomedical Engineering, University of Minnesota
Department of Biomedical Engineering, University of Minnesota http://saliterman.umn.edu/ Murphy, S. V., and A. Atala. "3d Bioprinting of Tissues and Organs." Nature Biotechnology 32, no. 8 (Aug 2014):
CKD-Mineral Bone Disorder (MBD) Pathogenesis of Metabolic Bone Disease. Grants: NIH, Abbott, Amgen, OPKO, Shire
Pathogenesis of Metabolic Bone Disease Stuart M. Sprague, D.O. Chief, Division of Nephrology and Hypertension Professor of Medicine NorthShore University HealthSystem University of Chicago Pritzker School
supplementary information
DOI:.38/ncb1963 a wild 5.3kb 11.2kb targeting vector stop PCR primer KKpn NNhe targeted allele 5.7kb 6.8kb probe b d (g) 35 3 25 2 genomic Southern blot Kpn I digest Nhe I digest / / / / / / 11.2 kb 5.7
Arteriosclerosis & Atherosclerosis
Arteriosclerosis & Atherosclerosis Arteriosclerosis = hardening of arteries = arterial wall thickening + loss of elasticity 3 types: -Arteriolosclerosis -Monckeberg medial sclerosis -Atherosclerosis Arteriosclerosis,
ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236
Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine
Understanding Root Cause: Pathogenesis of Hepatic Fibrosis
10/1/12 Understanding Root Cause: Pathogenesis of Hepatic Fibrosis Hepatitis C Virus Mild inflammation Inflammation Fibrosis Cirrhosis 1 10/1/12 Non-alcoholic Fatty Liver Disease Steatosis Steatohepatitis
Radioterapia nel trattamento del carcinoma mammario e cardiotossicità:
Radioterapia nel trattamento del carcinoma mammario e cardiotossicità: un problema reale, da quantificare, da evitare Bruno Meduri A.O.U. Policlinico di Modena Radioterapia nel trattamento del carcinoma
Tissue repair. (3&4 of 4)
Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid
VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer
VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad
PROTEIN O-GLCNAC MODIFICATION IN DIABETIC VASCULAR CALCIFICATION JACK M HEATH
PROTEIN O-GLCNAC MODIFICATION IN DIABETIC VASCULAR CALCIFICATION by JACK M HEATH VICTOR DARLEY-USMAR, COMMITTEE CHAIR JOHN CHATHAM YABING CHEN, MENTOR JEONGA KIM JIANBO WANG A DISSERTATION Submitted to
Serum Phosphorus level: A marker of myocardial infarction
Neha Sheth and H.B Sirajwala / International Journal of Biomedical Research 217; 8(11): 618-622. 618 International Journal of Biomedical Research ISSN: 976-9633 (Online); 2455-566 (Print) Journal DOI:
Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath
Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis
Fibers and extracellular matrix of hard tissues - Collagen and non-collagen proteins in hard tissues
Fibers and extracellular matrix of hard tissues - Collagen and non-collagen proteins in hard tissues Dr. Gábor Varga Department of Oral Biology February, 2016 Radiograph of teeth remarkable harmony of
Arterial Calci cation: A Review of Mechanisms, Animal Models, and the Prospects fortherapy
Arterial Calci cation: A Review of Mechanisms, Animal Models, and the Prospects fortherapy Reidar Wallin, 1 Nadeem Wajih, 2 G. Todd Greenwood, 2 David C. Sane 2 1 Section of Rheumatology, Department of
Nature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
Statins for Calcific Aortic Valve Stenosis: Into Oblivion After SALTIRE and SEAS? An Extensive Review from Bench to Bedside
Statins for Calcific Aortic Valve Stenosis: Into Oblivion After SALTIRE and SEAS? An Extensive Review from Bench to Bedside Hadewich Hermans, MD, Paul Herijgers, MD, PhD, Paul Holvoet, PhD, Eric Verbeken,
1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number
Modulation of Valve Interstitial Cell Function through Cell Shape and Phenotype
University of Arkansas, Fayetteville ScholarWorks@UARK Theses and Dissertations 12-2015 Modulation of Valve Interstitial Cell Function through Cell Shape and Phenotype Atefeh Razavi University of Arkansas,
Bone Markers and Vascular Calcification in CKD-MBD
Bone Markers and Vascular Calcification in CKD-MBD Pierre Delanaye, MD, PhD Department of Nephrology, Dialysis, Transplantation CHU Sart Tilman University of Liège BELGIUM Bone Markers and Vascular Calcification
Innate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin
Know Differences and Provide Examples Chapter * Innate Immunity * kin and Epithelial Barriers * Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive
Vascular Calcification in Rat Cultured Smooth Muscle Cells: a Role for Nitric Oxide. Nimer Fehaid N Alsabeelah. February 2016
Vascular Calcification in Rat Cultured Smooth Muscle Cells: a Role for Nitric Oxide Nimer Fehaid N Alsabeelah February 2016 Submitted to the University of Hertfordshire in partial fulfilment of the requirements
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
Lipid metabolism in familial hypercholesterolemia
Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis