Reproductive Phenotype of Transgenic Mouse with Conditional Deletion of Fibroblast Growth Factor Receptor 1 in GnRH Neurons

Transcription

1 University of Colorado, Boulder CU Scholar Integrative Physiology Graduate Theses & Dissertations Integrative Physiology Spring Reproductive Phenotype of Transgenic Mouse with Conditional Deletion of Fibroblast Growth Factor Receptor 1 in GnRH Neurons Sarah Leanne Ramelli University of Colorado at Boulder, sarah.ramelli@colorado.edu Follow this and additional works at: Part of the Endocrinology Commons Recommended Citation Ramelli, Sarah Leanne, "Reproductive Phenotype of Transgenic Mouse with Conditional Deletion of Fibroblast Growth Factor Receptor 1 in GnRH Neurons" (214). Integrative Physiology Graduate Theses & Dissertations This Thesis is brought to you for free and open access by Integrative Physiology at CU Scholar. It has been accepted for inclusion in Integrative Physiology Graduate Theses & Dissertations by an authorized administrator of CU Scholar. For more information, please contact cuscholaradmin@colorado.edu.

2 Reproductive Phenotype of Transgenic Mouse with Conditional Deletion of Fibroblast Growth Factor Receptor 1 in GnRH Neurons by Sarah Leanne Ramelli B.S., University of Washington, 28 A thesis submitted to the Faculty of the Graduate School of the University of Colorado in partial fulfillment of the requirement for the degree of Master of Science Department of Integrative Physiology 214

3 ii This thesis entitled: Reproductive Phenotype of Transgenic Mouse with Conditional Deletion of Fibroblast Growth Factor Receptor 1 in GnRH Neurons Written by Sarah Leanne Ramelli Has been approved for the Department of Integrative Physiology Pei-San Tsai, PhD., Committee Chair David Norris, PhD. Robert Spencer, PhD. Date The final copy of this thesis has been examined by the signatories, and we find that both the content and the form meet acceptable presentation standards of scholarly work in the above mentioned discipline.

4 Reproductive Phenotype of Transgenic Mouse with Conditional Deletion of Fibroblast Growth Factor Receptor 1 in GnRH Neurons Sarah Leanne Ramelli (M.S.) iii Thesis directed by Professor Pei-San Tsai, PhD. Department of Integrative Physiology, 214 Abstract Fibroblast growth factor receptor 1 (Fgfr1) gene mutations can cause deficiencies in gonadotropin-releasing hormone (GnRH) production in humans. GnRH deficiencies cause Kallmann syndrome and a form of hypogonadotropic hypogonadism. Fgfr1 deficiencies in mice have led to several abnormalities associated with reproduction including a reduction in neurons that produce GnRH. Fgfr1 global deletion causes widespread disruptions in development. The goal of this thesis was to use a Cre-loxP strategy to produce transgenic mice with conditional Fgfr1 deletion in GnRH neurons. These transgenic mice will be used to investigate if Fgfr1 has a cell-autonomous effect on GnRH neurons. Mice were generated using male GnRH-Cre mice (GnRH-Cre +/- ) breed with female mice with floxed Fgfr1 exon 4 allele (Fgfr1 flox/flox ). After two generations, male and female conditional knockout (KO) mice (GnRH-Cre +/- : Fgfr1 flox/flox ) and control mice (GnRH-Cre -/- : Fgfr1 flox/flox ) were produced. To investigate

5 iv deficiencies in the conditional KO mice, the reproductive phenotype was assessed measuring GnRH neurons, luteinizing hormone (LH) levels, and reproductive measurements. Results from this experiment show no significant differences in GnRH neurons or LH plasma concentration levels. However, significant deficiencies are found in the reproductive capabilities of the conditional KO mice. These results suggest that conditional KO mice in both sexes have functionally compromised GnRH neurons despite normal GnRH neuronal populations. However, the female reproductive axis of the conditional KO mice demonstrates greater reproductive impairments when compared to male conditional KO mice. The overall findings of this thesis work illustrate that Fgfr1 does have a direct effect on GnRH neuronal function without causing an alteration to GnRH neuronal numbers.

6 v Acknowledgements The author gratefully acknowledges the following individuals for their assistance in the completion of this work: Dr. Pei-San Tsai Thank you so much for the chance to work in and be a part of your lab. I have learned so much during my time in your lab, and I really appreciate all the time and effort you put in to help me graduate. Committee Members Dr. Robert Spencer and Dr. David Norris thank you so much for being willing to be on my committee. I know it is a huge commitment, and I am very grateful for the time, effort, and knowledge that you invested in helping me graduate. Tsai Lab I just wanted to say thanks to everyone I worked with during my time in the lab. Your help and kindness was an immense help during graduate school. Natalie Rubio Thank you so much for all your hard work. I m grateful to you for all the hours you spent helping me accomplish this research.

7 vi Table of Contents General Introduction Chapter Reproductive Phenotype of Transgenic Mouse with Conditional Deletion of Fibroblast Growth Factor Receptor 1 in GnRH Neurons..4 I. Introduction.4 II. III. IV. Materials and Methods.. 9 Results...15 Discussion.29 General Discussion..39 References 42

8 vii Tables Table Characterization of Reproduction...21

9 viii Figures Figure 1. G3177 and LR-5 GnRH Antibody Comparison Summary of Body Weights Vaginal Opening Age Estrous Cyclicity Balanopreputial Separation Age Anogenital Distance GnRH Immunocytochemistry Male GnRH Neuron Counts Male GnRH Neuronal Distribution Female GnRH Neuron Counts Female GnRH Neuronal Distribution GnRH Neuronal Morphology Plasma LH Levels..29

10 1 General Introduction Kallmann syndrome (KS) is a genetic condition that is defined by hypogonadotropic hypogonadism (HH) and anosmia (1). KS has a prevalence of 1 out of every 8 males and 1 out of every 4, females (2). HH can be caused by a number of deficiencies including gonadotropin-releasing hormone (GnRH) deficiency, low gonadotropin levels, and decreased responsiveness to either GnRH or gonadotropins (3). However, HH in KS patients is specifically due to GnRH neuron deficiency (4). GnRH neurons, which release GnRH, are considered to be the most upstream neuroendocrine control of reproduction. A decrease in GnRH causes decreased gonadotropin release, small genitals, absent puberty, and absent secondary sex characteristics in KS patients (5). While reproduction and anosmia, the inability to smell, may seem unrelated, neurons that control these two functions have a similar origin. GnRH neurons and chemosensory neurons, which respond to odors, both originate in the olfactory placode (6,7,8,9,1). The olfactory placode originates from the ventrolateral ectodermal thickenings at the anterior neural ridge (11). In mice, a model most commonly used to study the development of GnRH neurons, the olfactory placode undergoes two invaginations between embryonic day (E) 1 to E1.5 to form the olfactory pit and secondary medial recess (6). The invagination of the olfactory placode can be disrupted by decreases in the fibroblast growth factor (Fgf) signaling pathway. The Fgf ligand Fgf8 is necessary for normal development of the olfactory placode and nasal cavities (12), and double mutant mice with gene deletions in both Fgf receptor 1 (Fgfr1) and Fgfr2 exhibited

11 2 disrupted nasal cavity formation, abnormal olfactory placode thickening, and failure of the olfactory placode to invaginate at E1.5 (13). In mice, Fgf8 is the only Fgf ligand found in the ventral-most subdomain of the medial olfactory pit at E1.5 (14). GnRH neurons are found to emerge from progenitor cells at E1.5 in the medial olfactory pit. This association in temporal and spatial development links Fgf8 to GnRH neuron development. Fgfr was first found to be involved in the process of GnRH fate specification in an in vitro study on E1.5 nasal explants. In that study, an increased emergence of GnRH neurons from the nasal explant was observed within 2 to 3 days in vitro, and when an Fgfr antagonist, SU542, was added to the nasal explants, GnRH proliferation was inhibited (15). Later using transgenic mice, Fgf8 binding to Fgfr1 at this early stage in a GnRH neuron s life is necessary for the early development of GnRH neurons (16,17). There is also evidence that reduced GnRH neurons resulting from disrupted fate specification in Fgf8-deficient mice is associated with long-lasting deficiencies in reproduction (18). Fgf signaling is not only involved in the fate specification stage of GnRH development but is involved in all stages of GnRH neuronal development. GnRH neurons in mice arise in the medial olfactory pit of the olfactory placode from embryonic day (E) 1.5 to E11.5 (9,1). In order to reach their final destination of the preoptic area (POA) in the forebrain, GnRH neurons undergo a period of migration from E11.5 to E14.5 (19). This migration is guided by peripherin-positive tracts of the vomeronasal and olfactory nerves that GnRH neurons use to navigate across the cribriform plate to reach the forebrain. Once in the brain, they make a ventral turn toward the POA (18). E14.5 to E15.5 GnRH neurons undergo axon targeting to complete their neuronal

12 3 development (2,21,22). Fgf8 and Fgfr1 are involved to some degree in all of these stages of GnRH neuron development. Fgf signaling is even associated with the postnatal development of GnRH neurons, although postnatal GnRH neurons appear to be more dependent on Fgfr3 rather than Fgfr1 (17). Deficiencies in Fgf signaling also have a direct connection to KS and a fraction of isolated HH in humans. Many genetic mutations associated with these disorders are inactivating mutations in Fgfr1 and Fgf8 (5). Mutations in Fgfr1 account for 1% of KS cases (23). Compound mutations in genes that affect KS also are seen in some patients, including Fgfr1 and Fgf8 digenic heterozygous mutations (24). The combined heterozygous hypomorphic mutations in Fgfr1 and Fgf8 increase deficiencies in reproduction in mice when compared to single mutations alone (25). This leads to the hypothesis that KS patients who have the same mutations but more severe symptoms may have additional unknown mutations that cause GnRH deficiencies. Fgf signaling plays a major role in the etiology of HH in KS patients. Human genetic mutations in Fgf8 and Fgfr1 are associated with KS, and deficiencies in Fgf8, Fgfr1, and Fgfr3 in mouse models cause abnormalities to GnRH neuronal development and maintenance. The current knowledge on the role of Fgf signaling in the olfactory placode, GnRH neurons, and KS indicates that understanding Fgf8 and Fgfr1 signaling in relation to GnRH neurons could be a key component in understanding the mechanism underlying HH in KS patients.

13 4 1. Introduction Gonadotropin-releasing hormone (GnRH) is a neuropeptide released from the hypothalamus to stimulate the release of luteinizing hormone (LH) and folliclestimulating hormone (FSH), collectively called gonadotropins, from the vertebrate anterior pituitary. Gonadotropins stimulate gametogenesis and the production of gonadal steroids in the gonad, leading to fertility and the establishment of sex characteristics. Deficiencies in this hypothalamic-pituitary-gonadal (HPG) system may lead to compromised reproductive capabilities. GnRH is produced by GnRH neurons located in the forebrain, predominantly concentrated in the preoptic area (POA). The development and maintenance of the GnRH system are regulated by a number of signaling molecules, including fibroblast growth factors (Fgfs) (25-27). Whereas most signaling molecules orchestrate the prenatal development of GnRH neurons, emerging evidence suggests Fgfs participate in every stage of GnRH neuronal development including prenatal and postnatal periods. Fgfs belong to a family comprising twenty-two ligands and are involved in many developmental processes. Fgfs bind to fibroblast growth factor receptors (Fgfr). Fgfr are tyrosine kinase receptors that, in full-length forms, consist of three extracellular immunoglobulin-like domains, a transmembrane domain, and a split intracellular tyrosine kinase domain (28). Fgfr1 and Fgfr3 have been found on postnatal GnRH neurons (15). Fgfr1 is specifically indispensable for the very early phase of GnRH neuronal development (16).

14 5 GnRH neurons have three distinct stages of development including fate specification, migration, and axon targeting that occurs between embryonic day (E) 1.5 to E15.5. In the mouse model, fate specification occurs in the olfactory placode at approximately E1.5 and is the time period when a progenitor cell commits to become a GnRH neuron. After fate specification, GnRH neurons migrate across the cribriform plate from the olfactory placode to the final forebrain destination by following the pathways established by the vomeronasal and olfactory nerve tracts. The migration of GnRH neurons occurs between E11.5 to E14.5. Finally, GnRH neuronal development is complete by E15.5 after their axons are properly targeted to the median eminence. From GnRH axon terminals at the median eminence, GnRH is released to stimulate the secretion of LH and FSH from the anterior pituitary (1,19). Disruption at any stage of GnRH neurons development could lead to deficiencies in reproduction. An increasing body of work suggests Fgf signaling through Fgfr1 is primarily required for GnRH neuronal fate specification (15,16,17). In humans, mutations on the Fgfr1 gene can lead to adverse conditions including hypogonadotropic hypogonadism (HH) and Kallmann syndrome (KS) (23). HH is a reproductive disorder defined by small genitals, absent puberty, and absent secondary sex characteristics due to low levels of circulating gonadotropins. KS is defined as HH coupled to anosmia, an absent sense of smell. Although HH and anosmia may seem unrelated, they are linked by the shared developmental origin of GnRH neurons and chemosensory neurons, both of which are born within the olfactory placode (29). Thus, disrupted development of the olfactory placode can simultaneously disrupt GnRH and olfactory chemosensory neurons, resulting in HH coupled to anosmia. It is important to

15 6 note that although HH alone can result from either GnRH neuronal or pituitary dysfunction, HH in KS invariably stems from the malformation of the GnRH system. The genetic causes of KS and HH are very complex, and currently there are 16 genes whose mutations are associated with these two disorders. Some of the more prevalent causal genes include Fgfr1, KAL1, Fgf8, GNRHR, GPR54, KISS1, HS6ST1, NELF, PROK2, and PROKR2, yet still more than 6% of individuals with KS or HH do not have mutations in known causal genes (5,3). Genetic mutations in a few of these genes are found to alter the signaling of Fgfr1 as enhancers or inhibitors. The KAL1 gene, for example, encodes the protein anosmin-1, which interacts with the Fgfr-Fgfheparan sulfate proteoglycan complex as an enhancer of Fgf signaling (31). Mutations in Fgfr1 ligands (Fgf8 and Fgf17) and signaling inhibitors (IL17RD, DUSP6, and SPRY4) can alter Fgfr1 signaling and are also associated with HH and KS (24,32). At present, loss-of-function mutations on the Fgfr1 gene account for 1% of patients with autosomal dominant KS (23) and 7% of patients with HH (33). Additionally, many of the other genes associated with KS and HH encode proteins that interact with or are part of Fgf signaling (32). In this regard, KS and HH in humans provide a strong impetus for understanding how Fgfs signal through Fgfr1 to control the development of the GnRH system. Previous studies on transgenic mice with global Fgfr1 deletion revealed severe developmental disorders. Global Fgfr1 knockout (KO) mice are not viable past E9.5 due to the overall importance of Fgfr1 in embryonic development (34,35). Therefore, Fgfr1 KO mice are not useful for investigating the exact effects of Fgfr1 alterations on GnRH neurons and reproductive capabilities. Increased tissue specificity of Fgfr1

16 7 deletion is needed to acquire a better understanding of its role in GnRH development and maintenance. In addition to KO mice, mice with global reductions in the Fgfr1 gene have been examined in the form of Fgfr1 hypomorphic mice. Through GnRH immunocytochemistry (ICC), the total number of GnRH neurons in newborn homozygous Fgfr1 hypomorphs was found to be 88% lower when compared to wildtype (WT) littermates (16). This suggests that Fgfr1 is involved in the prenatal development of GnRH neurons. In fact, studies examining homozygous Fgfr1 hypomorphic embryos on E11.5 revealed no GnRH neurons in the olfactory placode, suggesting these neurons did not fate specify properly (16). However, these animals were prone to early death and were not able to survive for more than 24 h after birth. Heterozygous Fgfr1 hypomorphs, on the other hand, are not susceptible to early death and can be used for postnatal studies. These animals have a 3% reduction in GnRH neurons at P6 when compared to WT mice (17). However, their reproductive function has not yet been assessed. In addition to mice with global deletion or reduction of Fgfr1, dominant-negative Fgfr (dnfgfr) mice have also been investigated. dnfgfr mice have tissue-specific functional disruption of Fgfr 1, 2, and 3 on GnRH neurons (36). In these mice, a rat GnRH promoter was used to drive the expression of dnfgfr, a truncated Fgfr1 that heterodimerizes with Fgfr1-3 to interfere with their ability to signal (36). These mice have reproductive deficiencies in the form of reduced litter production, delayed puberty, and early reproductive senescence (36). These animals also have a 3% reduction in GnRH neurons and an increased rate of age-related GnRH neuronal loss (37). GnRH

17 8 neurons in dnfgfr mice have also been shown to exhibit immature neuronal morphology in the form of increased dendritic branching (37). dnfgfr mice also have deficiencies in axon targeting of GnRH neurons to the median eminence (38). Hypothalamic GnRH concentrations measured by radioimmunoassay (RIA) showed a 5% reduction in dnfgfr mice compared to WT mice (36). Findings from Fgfr1 hypomorphic mice illustrate the importance of Fgfr1 in the embryonic development of GnRH neurons, but this transgenic line harbors a global, not tissue-specific, reduction in Fgfr1. Thus the phenotype observed in Fgfr1 hypomorphs may be caused by the disruption of other non-gnrh neuronal cell types. On the other hand, dnfgfr mice harbor tissue-specific disruption of Fgfr1 and Fgfr3 function, but this disruption is not specific to Fgfr1. Thus, both lines of transgenic mice have limitations in that they do not address if Fgfr1 signaling alone directly impacts GnRH neurons. The overall goal of my thesis research was to investigate if Fgf signaling acts directly through Fgfr1 present on GnRH neurons to promote their development and maintenance. This was done by examining a mouse model with conditional deletion of Fgfr1 specific to GnRH neurons. A tissue-specific Fgfr1 knockout mouse was generated to achieve this goal. This highly specific Fgfr1 gene deletion may provide greater insights into the function of Fgfr1 present specifically on GnRH neurons and reveal whether the effects mediated by Fgfr1 are cell-autonomous. The first goal of my thesis research was to produce a transgenic mouse line harboring GnRH neuron-specific deletion of Fgfr1 using the Cre-loxP strategy. This was achieved by mating a GnRH-Cre +/- mouse line (39) with an Fgfr1 flox/flox mouse line (4).

18 9 GnRH-Cre +/- mice are heterozygous for Cre recombinase expression specifically in GnRH neurons (39). Fgfr1 flox/flox mice have exon 4 of the Fgfr1 gene flanked by loxp sites (floxed) (4). The two loxp sites serve as targets upon which Cre recombinase acts to excise the floxed sequence. Exon 4 is one of 17 exons on the Fgfr1 gene that codes for part of the extracellular immunoglobulin-like domain and is the first exon common to all splice variants of Fgfr1. The second goal of my thesis research was to assess the biological effects of this conditional Fgfr1 deletion on GnRH neurons. To do so, GnRH ICC was performed on brain sections to examine GnRH neuron number and cell morphology, and RIA of blood plasma was conducted to examine circulating LH levels. Lastly, as the ultimate measure of GnRH neuronal function, reproductive capabilities were assessed at the age of puberty onset as evidenced by measurement of anogenital distance, litter production, and estrous cycle parameters. In summary, the overarching goal of this thesis was to investigate the direct effects of Fgfr1 on GnRH neuronal development and maintenance in a mouse with a conditional, deletion of Fgfr1 gene in GnRH neurons and assess possible effects this conditional deletion on reproduction. This information may provide insights into the etiology of infertility in KS and HH patients. 2. Materials and Methods 2.1 Animals Two transgenic strains of C57BL/6 were used. GnRH-Cre +/- mice were obtained from Drs. Sally Radovick and Andrew Wolfe (John Hopkins University, Baltimore, MD)

19 1 (39). Fgfr1 flox/flox mice of the strain B6.129S4-Fgfr1 tm5.1sor /J were obtained from Jackson Laboratory (Bar Harbor, ME). Fgfr1 flox/flox mice have loxp sites flanking exon4 of the Fgfr1 gene (4). All mice were housed in the Department of Integrative Physiology Animal Facility at the University of Colorado, Boulder. Mice were bred for several generations in our animal facilities before use. A 12L:12D photoperiod was used in the mouse facility. Mice were fed rodent chow and water ad libitum. All animal procedures were approved by the University of Colorado Boulder Institutional Animal Care and Use Committee. 2.2 Breeding Male GnRH-Cre +/- mice were bred with female Fgfr1 flox/flox mice to generate the F1 generation of GnRH-Cre +/- :Fgfr1 flox/- offspring. The F1 male GnRH-Cre +/- :Fgfr1 flox/- mice were then bred with female Fgfr1 flox/flox mice to obtain male and female GnRH-Cre +/- :Fgfr1 flox/flox conditional KO mice and GnRH-Cre -/- :Fgfr1 flox/flox control mice. 2.3 Polymerase Chain Reaction Genomic DNA was obtained by tail biopsies and used for genotyping by polymerase chain reaction (PCR). DNA was amplified using a PCR reaction mixture comprising 1x PCR reaction buffer, 1.25U Taq polymerase (BioReady, Cambridge, MA),.2 mm dntp, and 1µM primers. One primer set (forward: 5 - CGACCAAGTGACAGCAATGCT and reverse: 5 -GGTGCTAACCAGCGTTTTCGT) was used to amplify the GnRH-Cre transgene using the following amplification protocol: 5-min denaturation at 94 o C; 35 cycles of.5 min at 94 C, 1 min at 58 C, and 1 min at 72 C; and a 1-min extension at 72 C. A second primer set (forward: 5 -

20 11 GGACTGGGATAGCAAGTCTCTA and reverse: 5 -GTGGATCTCTGTGAGCCTGAG) was used to amplify Fgfr1 flox/flox specific sequence at 94 for 3 min followed by 35 cycles of.5 min at 94 C, 1 min at 64 C, and 1 min at 72 C. The PCR reaction was completed by a 2-min extension at 72 C. Reaction products were separated on 1.3% agarose gels and visualized with ethidium bromide. 2.4 External Characterization of Reproductive Phenotype Body Weight Mice were weighed on postnatal day (P) 21, 25, 3, 35, 4, 45, 5, and at the time of sacrifice (P9, P18, or P27) to assess somatic growth. Vaginal Opening Female mice were checked daily starting at P21 for vaginal opening (VO), a gauge of pubertal onset. Estrous Cycle Vaginal smears were performed on female mice from P7-9 to assess reproductive cyclicity. Vaginal epithelial cells were obtained by flushing the vaginal opening with 2µl of.9% saline. The fluid from the lavage was then smeared onto a slide and visualized under a microscope to differentiate among proestrus, estrus, metestrus, and diestrus. Balanopreputial Separation

21 12 Balanopreputial separation (BPS), an indicator of male pubertal onset (41), was assessed daily in male mice starting at P25. Anogenital Distance The distance from the anus to the penis or vaginal opening was measured with a digital caliper on the day of VO (for females) or BPS (for males) and on P5 (for both sexes). Two consecutive measurements were taken for each time point and averaged. 2.5 In Vivo Characterization of Reproduction Several measurements of reproduction were taken to assess fertility and reproductive lifespan. These include: 1) age of first litter production, 2) number of pups produced in the first litter, 3) total number of offspring produced by each age group (P9, P18, and P27) before sacrifice, 4) total number of litters produced by each age group (P9, P18, and P27) before sacrifice and 5) average number of pups per litter. To establish breeding pairs, a P3 male or female conditional KO mouse was placed with a P4 WT mouse of opposite sex and allowed to breed until the time of sacrifice. 2.6 Tissue Harvest and Preparation Mice at P3, P9, P18, and P27 were lightly anesthetized with isoflurane vapor and sacrificed by decapitation. All female mice P9 and older were sacrificed during the diestrus phase of their estrous cycle, thus the actual age at sacrifice may exceed the intended time point (P9, 18 and 27) by 5 days. Trunk blood was collected into heparinized tubes and centrifuged to collect the plasma. All plasma samples were stored frozen at -2 C until LH RIA. Brains were dissected, blocked

22 13 anteriorly at the olfactory bulbs and posteriorly after the mammillary bodies, and immersion-fixed in 4% paraformaldehyde overnight at 4 C. Following fixation, brains were cryoprotected in 3% sucrose, cut by a cryostat into 6-µm thick sections, and stored at 4 C in.1 M phosphate-buffered saline with.4% Triton X-1 (PBST) until GnRH immunocytochemistry (ICC). 2.7 GnRH Immunocytochemistry (ICC) Free-floating brain sections were washed in.5% hydrogen peroxide in PBST for 1 min to quench the endogenous peroxidase activity. Tissue sections were then rinsed five times in PBST and incubated for 48 h at 4 C in a rabbit anti-gnrh antibody (G3177; 1:2,) diluted in 4% normal donkey serum. G3177 was generated against D-Lys 6 -GnRH conjugated to ovalbumin and has previously been validated by our laboratory to react specifically with the mammalian form of GnRH in preadsorption studies (not shown). After the primary antibody incubation, three PBST rinses were done before the tissue was incubated in a biotinylated donkey anti-rabbit secondary antibody (1:5, Jackson Immunoresearch, Jackson Grove, PA) for 1 h at room temperature. Sections were once again rinsed with PBST before incubation in avidinbiotin complex (ABC, Vector Labs, Burlingame, CA) for 1 h at room temperature. Three PBST washes were completed before diaminobenzidine was used as a chromagen to detect GnRH-immunoreactive (ir) neurons. Sections were washed in PBST for a final rinse, and then mounted on gelatin-subbed slides. Sections were dehydrated through an ascending series of 7-1% ethanol, cleared in Histoclear (National Diagnostics, Atlanta, GA), and coverslipped. A preliminary test showed G3177 detected similar number of GnRH-ir neurons in control mice compared to another well-established

23 Total GnRH neuron number 14 GnRH antibody LR-5 (Fig. 1), further validating the use of G3177 in ICC. All slides were blinded to conceal their identity before being scored. GnRH-ir cells with darkly stained cytoplasm and light nuclei were scored. Cells were counted in every section from 21 sections rostral to the organum vasculosum of lamina terminalis (OVLT) to 3 sections caudal to OVLT (including the median eminence). The dendritic morphology of P3 GnRH neurons was classified as unipolar, bipolar, or complex using the criteria described by Cottrell et al. (42) LR-5 GnRH antibody G3177 Figure 1. G3177 and LR-5 GnRH antibodies do not produce significantly different GnRH neuron counts. No significant difference of GnRH neuron number was seen between LR-5 and G3177 primary antibody staining. Bars represent mean ± SEM, n= LH radioimmunoassay (RIA) Plasma LH was measured using a rat LH RIA described previously (43). The RIA kit was provided by Dr. A.F. Parlow (National Institutes of Health National Pituitary Program). rlh-i1, rlh-rp3, and rlh-s11 were used as the iodination stock, RIA

24 15 standard, and antibody, respectively. The detection limit was.5 ng/ml. Intra-assay and inter-assay coefficients of variation are 5.2% and 9.4%, respectively. 2.9 Statistics Student s t-test was used for comparison between two groups. One-way or twoway ANOVA followed by Tukey s post hoc test was used to analyze differences among multiple groups. P <.5 was defined as the level of significance. All analyses were performed using RStudio (Boston, MA). 3. Results 3.1 External Characterization of Reproductive Phenotype To assess somatic growth differences between control and conditional KO mice, mice were weighed at P21, P25, P3, P4, P45, P5, and at age of sacrifice. Two-way repeated measures ANOVA was performed on the body mass data from P21 to P5. Male body mass was not significantly different between genotypes (Figure 2A). However, a significant interaction was found between age and genotype (p=.12), although Post-hoc test with Bonferroni correction revealed no significant differences at any of the ages examined. Male body mass at the time of sacrifice was also not significantly different (Figure 2B). Body mass of female conditional KO was not significantly different from controls at any of the ages measured (Figure 2C & D). Age at which VO occurred was measured in females to assess female pubertal onset. Conditional KO female mice exhibited a significant delay in age of VO (3.29 ± 1.17 days) compared to controls (26.64 ± 1.17 days; p=.5) (Figure 3). In addition to

25 16 VO, estrous cycles were also monitored in female mice from P7-P9 to investigate alterations in reproductive cyclicity. No significant differences were found in the percentage of time spent in any of the four phases between the two genotypes (Figure 4). BPS was observed in male mice as an indicator of pubertal onset. Age at which BPS occurred was not significantly different between control and conditional KO mice (Figure 5). Anogenital distance was measured at age of VO (females), BPS (males), and on P5 (both sexes) as an external indicator of androgen levels. Male conditional KO mice had significantly shorter anogenital distance at age of BPS (p=.13) and on P5 (p=.27) compared to control mice (Figure 6A). The anogenital distance of female conditional KO mice did not differ significantly from control females at either time point (Figure 6B).

26 Body Mass (g) Body Mass (g) Body Mass (g) Body Mass (g) A Conditional KO B Conditional KO Age (days) 1 P9 P18 P C Conditional KO Age (days) D Conditional KO P9 P18 P27 Figure 2. Summary of body weights in grams taken at various developmental stages. Data from body weights continuously taken during the peripubertal time points in males (A) and females (C) are presented in line graphs. Average body mass at sacrifice is represented in bar graphs for male (B) and female (D) data. Data points or bars are presented as mean ± SEM, n=5-6/group. 4 Age of VO (days) ** Conditional KO Figure 3. Conditional KO females have significantly delayed age of vaginal opening (VO). Bars represent mean ± SEM. (** indicates P <.1, Student s t-test; n = 17-22/group).

27 Age of BPS (Days) Percent Time in Each Phase Conditional KO Diestrus Proestrus Estrus Metestrus Figure 4. Percentage of time spend in each estrous cycle phase is not significantly different between genotypes in female mice. Bars represent mean ± SEM, n= Conditional KO Figure 5. Age of balanopreputial separation (BPS) is not significantly altered in male conditional KO mice. Bars represent mean ± SEM, n=18-22/group.

28 19 Anogenital Distance (mm) A Day of BPS * P5 * Conditional KO Anogenital Distance (mm) B Day of VO P5 Conditional KO Figure 6. Anogenital distance is significantly shortened in conditional KO males but not females. Anogenital distance (in mm) was measured for both male (A) and female (B) mice at two different time points. Only male conditional KO mice had significantly shortened anogenital distance. Bars represent mean ± SEM. (*P <.5 compared to controls of same age, Student s t-test; n = 8-2/group). 3.2 In Vivo Characterization of Reproduction Reproduction was monitored in animals before sacrifice at P9, P18, and P27. Male P27 conditional KO mice produced significantly fewer offspring (p=.3) and litters (p=.6) compared to control males, but this difference was not observed at younger ages (Table 1). No other deficiencies were seen in male conditional KO mice.

29 2 In contrast, multiple deficiencies were seen in female KO mice, including delayed production of first litter (p=.7), decreased offspring produced in the first litter (p=.39), reduced offspring produced by P18 (p=.3), and decreased mean number of offspring per litter (p=1.12 x 1-6 ).

30 21 21 Male Conditional KO Male Female Time to First Litter, days ± 1.87, ± 2.41, ± 1.83, 1 Number of Pups in the first litter 6.92 ±.52, ±.4, ±.42, 1 P9 offspring produced 13 ± 1.98, 6 7. ± 1.86, ± 1.93, 6 P18 offspring produced 38 ± 5.24, ± 4.74, ± 3.57, 6 P27 offspring produced 68.2 ± 3.22, ± 2.64, 6** 43.2 ± 6.16, 5 P9 litters produced 1.83 ±.17, ±.31, 6.83 ±.31, 6 P18 litters produced 5. ±.63, ±.83, ±.22, 6 P27 litters produced 8.4 ±.37, ±.46, 6** 7.4 ±.87, 5 Mean number of pups per litter 8.3 ±.33, ±.38, ±.29, 17 Conditional KO Female 8.57 ± 4.95, 7** 4.86 ±.77, 7* 5.17 ± 1.58, ± 3.4, 6** 3.5 ± 7.28, ±.31, ±.72, ± 1.2, ±.25, 18*** Table 1. Reproductive measurements are significantly altered in both male and female conditional KO mice. Mean ± SEM, n=5-18/group. (* P <.5, ** P <.1, *** P <.1 by Student s t-test compared to controls of the same sex).

31 GnRH ICC GnRH ICC was performed to investigate alterations in GnRH neuronal number, distribution, and morphology resulting from tissue-specific Fgfr1 deletion. GnRH neuronal numbers were not significantly different between control and conditional KO mice at P3, P9, P18, or P27 in both males and females (Figures 7, 8 & 1). Analysis of GnRH neuronal distribution across the brain showed no difference between genotypes for either males or females at any age (Figure 9 & 11). GnRH neuron morphology was also examined for the pattern of dendritic branching, a surrogate measure of functional maturation (42). Before puberty, GnRH neurons undergo postnatal dendritic tree remodeling. GnRH neurons initially exhibit a greater number of neurons with a highly complex dendritic morphology (see Figure 12C for representative neuron types). As these neurons mature, a simple, unipolar dendritic structure becomes more prevalent (Figure 12A). (42). No differences were seen in percentages of unipolar, bipolar, or complex GnRH neurons between genotypes at P3 (Figure 12D). Neuronal morphology was not significantly different between sexes, thus male (n=6) and female (n=6) data were combined in Figure 12.

32 23 A B Figure 7. Representative photomicrographs of GnRH neurons at the plane of OVLT. Photomicrographs of the OVLT region from a P3 control (A) and conditional KO (B) mice. Scale bar is 5µm.

33 GnRH Neuron Number GnRH Neuron Number GnRH Neuron Number GnRH Neuron Number 24 Male 7 A P3 7 B P Conditional KO Condtional KO 7 C P18 7 D P Conditional KO Conditional KO Figure 8. GnRH neuron counts are not significantly different in male conditional KO mice. GnRH neuron numbers are not significantly different at P3 (A), P9 (B), P18 (C), or P27 (D) in male conditional KO mice compared to controls. Bars represent mean ± SEM, n=6.

34 GnRH Neuron Number GnRH Neuron Number GnRH Neuron Number GnRH Neuron Number 25 Male A P3 Conditional KO B P9 Conditional KO C P18 Conditional KO D P27 Conditional KO Section Number (6 µm increment) Figure 9. Distribution of GnRH neurons across the forebrain in male control and conditional KO mice. Average GnRH neuron number in each brain section from P3 (A), P9 (B), P18 (C), and P27 (D) male mice. The X-axis, from left to right, represents the rostral to caudal sequence in 6- m increments. OVLT is used as a landmark and denoted as. Sections rostral to the OVLT are assigned negative numbers, and sections caudal to OVLT assigned positive numbers. Data points represent mean ± SEM, n=6.

35 GnRH Neuron Number GnRH Neuron Number GnRH Neuron Number GnRH Neuron Number 26 Female 7 A P3 7 B P Conditional KO Conditional KO 7 C P18 7 D P Conditional KO Conditional KO Figure 1. GnRH neuron counts are not significantly different in female conditional KO mice. GnRH neuron numbers are not significantly different at P3 (A), P9 (B), P18 (C), or P27 (D) in female conditional KO mice compared to controls. Bars represent mean ± SEM, n=6.

36 GnRH Neuron Number GnRH Neuron Number GnRH Neuron Number GnRH Neuron Number 27 Female A P3 Conditional KO B P9 Conditional KO C P18 Conditional KO D P27 Conditional KO Section number (6 µm increment) Figure 11. Distribution of GnRH neuron numbers across female forebrain in control and conditional KO mice. Average Female GnRH neuron numbers in each brain section from P3 (A), P9 (B), P18 (C), and P27 (D) control and conditional KO mice. In 6-µm increments, the X-axis represents the rostral to caudal brain sequence. denotes OVLT which is used as a landmark. Sections rostral to the OVLT are assigned negative numbers, and sections caudal to the OVLT are assigned positive numbers. Data points represent mean ± SEM, n=6.

37 Percent Neuron Type 28 A B C D Condtional KO Unipolar Bipolar Complex Figure 12. GnRH neuron morphology is not different between conditional KO and control mice at P3. GnRH neuron morphology was assessed in male (n = 6) and female mice (n = 6) sacrificed at P3. Neurons were categorized as unipolar (A), bipolar (B), or complex (C). Scale bar is 5 µm. No differences in GnRH neuron morphology numbers were found between sexes, and data have been combined (D). No differences were found between genotypes in the percentage of unipolar, bipolar, or complex neurons. Bars represent mean ± SEM, n= LH RIA Circulating LH was measured by an LH RIA to assess any difference in pituitary gonadotropin output in conditional KO mice. Two-way ANOVA revealed no effects of age, genotype, or age x genotype interaction on male plasma LH (Figure 13A). Similar observations were made in females (Fig. 13B). P3 female mice did not have sufficient plasma for LH RIA and were not included in the analysis.

38 Plasma LH ng/ml Plasma LH ng/ml A Conditional KO P3 P9 P18 P B Conditional KO P9 P18 P27 Figure 13. Plasma LH levels were not significantly different between genotypes. Circulating LH levels in males (A) and females (B) were not be significantly different between control and conditional KO mice. Bars represent mean ± SEM, n=6. 4. Discussion KS and a fraction of HH are associated with GnRH disruption. Fgfr1 gene mutations are known to cause the autosomal dominant form of KS in humans (23), and a growing number of studies using mouse models show that Fgfr1 is critical for the GnRH system (16,17,36,37,38). Therefore, understanding the effects of Fgfr1 on GnRH signaling is an important step in understanding the mechanism behind KS and HH stemming from GnRH deficiency. One aspect of this line of research that has not been

39 3 examined is whether Fgfr1 acts directly on GnRH neurons to exert changes to the HPG axis. By using the Cre-loxP strategy to delete Fgfr1 specifically on GnRH neurons, we can examine the cell-autonomous effect of Fgfr1 on GnRH neurons. We hypothesized that a tissue-specific conditional deletion of Fgfr1 on GnRH neurons would cause a decrease in the number of GnRH neurons, circulating LH concentration levels, and reproduction. Although post-hoc test revealed no significant differences in body mass between control and conditional KO mice, two-way repeated ANOVA indicated a significant genotype x age interaction in males, suggesting a difference in the growth trajectory of male mice between genotypes. Interestingly, this interaction was not seen in females. Further, at the time of sacrifice on P9, P18, and P27, no significant differences in body mass were observed between genotypes in either males or females. These findings suggest the rate of growth in male conditional KO mice before P9 may be reduced (Fig. 2). Interestingly, body mass reduction during the peripubertal period occurs in male mice with deficiencies in the GnRH system, including hpg and Gpr54 KO mice (44,45). Decreased androgen levels resulting from low GnRH were thought to be a cause of reduced weight gain (46,47). The decreases in body weights from P25 to P4 in conditional KO male mice may contribute to the genotype x age interaction seen in male mice. VO in female mice is an apoptosis-mediated event that is initiated by elevated levels of estradiol and is a marker of pubertal onset (48). Conditional KO mice exhibited delayed VO, suggesting decreased estradiol levels and a delay in pubertal onset as a

40 31 result of delayed HPG axis activation. To investigate reproductive cyclicity, vaginal smears were performed from P7 to P9. The percentage of time spent in each phase of estrous cycle was not significantly different between genotypes. These findings suggest that the cyclic nature of GnRH neuronal activation in female conditional KO mice is relatively normal. BPS is an androgen-dependent external measurement of pubertal development in male mice. BPS occurs due to a transition from continuously low levels of androgens to an androgen spike at the pubertal onset (41,49). There was no difference in age of BPS between controls and conditional KO males. These findings suggest that conditional KO male mice exhibited a sufficient androgen surge to induce BPS at the appropriate time. In combination with the body mass data, our results suggest that the disruption of the HPG axis may be subtle and long-lasting in that the pubertal growth trajectory is impacted without influencing the onset of BPS. Anogenital distance is another external measurement associated with androgen levels (5,51). This measurement is significantly reduced in male but not female conditional KO mice. As expected, female mice do not normally exhibit altered anogenital distance (52). Reduced anogenital distance is believed to be due to decreases in androgen exposure, and decreased anogenital distance in males has been correlated with reduced sperm production, sperm counts, and penis size (5,53). Decreased anogenital distance in male conditional KO mice implies these mice were exposed to lower levels of androgens. The decrease in androgen exposure that caused decreased anogenital distance likely occurred before BPS because both time points

41 32 measured (at BPS and on P5) had similar differences of about 1mm (Fig. 6). Anogenital distance is commonly increased by fetal androgens (54), and decreases in anogenital distance may indicate decreased androgen exposure during the fetal period in male conditional KO mice in addition to a decrease in postnatal androgen exposure. The conditional KO mice show various changes in reproduction. The male conditional KO mice have normal reproductive capabilities before P27 (Table 1). At P27, these animals show decreases in both the number of offspring produced and litters produced. These findings suggest male conditional KO mice undergo early reproductive senescence. Interestingly, female reproductive deficiencies are seen much earlier with delayed production of the first litter and decreased offspring produced in the first litter (Table 1). The delay in the first litter produced is probably associated with delayed VO, and thus delayed puberty, seen in these animals. From these two measurements, we can conclude that female conditional KO mice exhibit not only delayed pubertal markers, but also delayed reproduction. The first litter produced by female conditional KO mice is seen to have a decrease in offspring produced. The average number of offspring produced per litter is decreased by about 2 pups per litter for conditional KO females. Litter size is prone to gonadotropin manipulation (55,56). The decrease in litter size produced by conditional KO females suggests decreased fecundity as the result of an altered HPG axis, and thus GnRH, production. In this respect, a reduction in mean litter size should correlate with an overall reduction in the total number of offspring produced over a female s lifetime. However, we only observed a significant reduction in the offspring produced by conditional KO females surviving until P18, suggesting the greatest reproductive disruption in conditional KO females

42 33 occurred between the first litter and P18, but there is enough disruption during this early period to lead to a significant decrease in the mean litter size. These data collectively suggest the timing of reproductive disruption in conditional KO mice is different between males and females. The reproductive disruption of females occurred earlier in life and of males later in life. GnRH ICC was performed to examine differences in GnRH neuronal number and distribution between genotypes. No differences were seen in the GnRH neuronal number or distribution at any of the time points examined. Cre recombinase in these animals is driven by the GnRH promoter and therefore the conditional deletion in the KO genotype should not occur until after the fate specification of GnRH neurons (57). Strong evidence suggests fate specification is the primary stage at which Fgfr1 deficiency causes a reduction in GnRH neuronal numbers. This is, in part, supported by in vitro studies showing nasal explants isolated from E1.5 embryos at the time of GnRH neuronal fate specification exhibited disrupted fate specification in the presence of SU542, a general Fgfr antagonist (15). In addition, Fgfr1 homozygous hypomorphic mice at P have an 88% decrease in GnRH neuronal number (16). Embryonic GnRH neurons, after fate specification, produce proteins for both Fgfr1 and Fgfr3 (15). However, a decrease in GnRH neuronal number is not present in Fgfr3 KO mice (36). These findings demonstrate that Fgfr1 is the main receptor for Fgf8 in GnRH neurons during fate specification (36). Fgfr1 does not appear to have as significant a role in GnRH neuronal migration and survival since there would be no GnRH neurons to undergo further development if they were not properly fate specified (36). Since Fgfr1 deficiency reduced GnRH neurons primarily during fate specification, a process that

43 34 should not be affected in our conditional KO mice, it is not surprising that GnRH neuron number in conditional KO mice was not reduced. Nevertheless, our present results suggest Fgfr1 deletion after GnRH neuronal fate specification could still compromise their postnatal function. This suggests that Fgfr1, in addition to fate specification (36), is important for establishing the functional GnRH neuronal network required for normal pubertal onset and fecundity. GnRH neuronal morphology was examined in P3 brains to assess the pubertal transition in dendritic branching. GnRH neurons mature from a complex dendritic tree with few spines to a simple dendritic structure bearing many spine densities (42). This remodeling of dendrites allows for an increase in excitatory synaptic inputs (58). An increased percentage of GnRH neurons with complex dendritic branching, signifying immature morphology, was found in dnfgfr mice during pubertal transition (37). In the current study, dendritic branching is unaltered in conditional KO mice. These findings suggest that Fgfr1 does not participate significantly in the postnatal morphological remodeling of GnRH neurons. LH levels were examined to assess the effects of the conditional KO on gonadotropin levels in plasma. LH levels were not significantly different between genotypes. Since conditional KO mice have normal GnRH neuronal numbers, it is not surprising that they have normal circulating LH. A caveat is that GnRH concentrations in the median eminence have not been measured in these animals, thus it is unclear if GnRH neurons in condition KO mice produce normal levels of mature GnRH, and if mature GnRH is transported normally to the median eminence for release.

44 35 Measurement of GnRH concentration levels in the median eminence could help to determine if GnRH neurons have any functional deficiencies such as decreased production of the GnRH mature peptide or abnormal axon targeting. The measurement of GnRH concentration in the median eminence is an important future step to quantifying the mature GnRH peptide available for release, since a semi-quantitative method such as the ICC is not an accurate gauge of this parameter. For example, the processing of GnRH prohormone into the mature GnRH peptide may be compromised in our conditional KO mice. Supporting this, prohormone convertase 2 is an endopeptidase necessary for the processing of GnRH prohormone to generate the mature GnRH peptide, and mrna of this enzyme was stimulated by Fgf treatment in a GnRH neuronal cell line (59). This suggests decreased Fgf signaling in GnRH neurons could decrease GnRH prohormone processing, leading to decreased availability of mature GnRH and compromised reproduction seen in this model. Another important consideration is that even if mature GnRH accumulates normally in the median eminence, it is unclear if it is released in a normal pattern to stimulate LH and FSH. GnRH is secreted in a consistent pattern in males and cyclic pattern in females. Alterations to the frequency of this pattern of GnRH production and release causes abnormal LH and FSH stimulation. Interestingly, LH levels are found to be the same in dnfgfr mice compared to controls despite their reduced GnRH neuron numbers and GnRH concentration in the median eminence (36). It is hypothesized that dnfgfr animals can compensate at the pituitary level to increase gonadotropin secretion despite the reduced GnRH stimulation. If GnRH concentrations in the median eminence were diminished in these conditional KO mice, this compensatory mechanism