mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons

Transcription

1 Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal Barbry, Christophe Beclin and Harold Cremer

2 Supplemental Figure 1: Expression of Pax6 and mir-7a in the adult SVZ. Brain section from an adult transgenic mouse expressing EGFP under the control of human Pax6 promoter, immunostained with a Pax6 antibody. GFP and Pax6 protein co-localized in most cells (arrow head) of the dorsal (D) and dorso-lateral (DL) aspects (top and middle panels). In contrast, Pax6 protein was quasi absent from the GFP + cells (asterisk) of the ventral aspect (VL, bottom panel), indicating that the discrepancy between Pax6 promoter activity and protein expression along the lateral wall is maintained in adult brain. Scale bar: 50 µm

3 Supplemental Figure 2: The 5 UTR of Pax6 has no effect on protein expression along the dorsoventral axis. A 6-Myc-tag alone or fused to the 5 UTR of Pax6 was introduced into the lateral wall by electroporation. Cells were co-transfected with pcx-egfp and GFP + progeny was analyzed 2 days post-electroporation (dpe) for the presence of Myc protein. Quantification of Myc + / GFP + cells revealed no significant difference in Myc expression in absence (white bar) or presence (black bar) of Pax6 5 UTR (control: n=4; 5 UTR: n=5).

4 Supplemental Figure 3: Global micro-rna expression analysis in the dorsal and lateral PVZ at P1. Dot-plot of Deep-sequencing analyses for microrna expression in dorsal (x-axis) versus lateral (yaxis) PVZ tissue at P1. Selected mirnas that are either candidates for Pax6-3 UTR binding or have been implicated in processes related to neurogenesis are depicted.

5 Supplemental Figure 4: The mir-7a gradient is maintained in the adult. qrt-pcr from microdissected adult SEZ showed that the mir-7a expression gradient along the dorso-ventral axis was also present in adult mice with decreasing levels from ventral to dorsal aspects (n=3 wells per condition, One way ANOVA with Bonferroni post-test, P<0.0001).

6 Supplemental Figure 5: (a) Validation of mutated mir-7a binding sites by luciferase assay. HEK293 cells were transfected by pmirglo containing the 3 UTR in wild type (wt) or mutated (mut) form in the presence or absence of mir-7a. The decrease of luciferase expression by mir-7a was restored when the mir-7a binding site was mutated (n=3 experiments, 3 wells per condition, two-tailed unpaired t-test with Welch correction, P<0.05). (b) Validation of pre-mir-7a function. The ability of pcx-pre-mir-7a2 to produce functional mature mir-7a was tested by luciferase assay, using a mir-7a mimic as a positive control. Relative luciferase level was reported as percentage of control condition (n=3 different experiments, 3 well per condition, two-tailed unpaired t-test with Welch correction, *P<0.05, **P<0.01).

7 Supplemental Figure 6: Modulation of mir-7a expression in dorsal PVZ does not alter dopaminergic specification. Radial glial neural stem cells from dorsal PVZ were electroporated with pre-mir-7a2 (a) or mir-7a sponge (b) and their progeny was analyzed 15 days post-electroporation in the olfactory bulb. Sections were immunostained with an anti-th antibody and the number of periglomerular GFP + / TH + neurons was quantified. No significant difference in the number of TH+ neurons in both experimental conditions (black bars) compared to controls (white bars) was observed (n=5). GL, Glomerular Layer.

8 Supplemental Figure 7: Characterization of lateral PVZ progenitors after interfering with Pax6 protein levels. (a) Forced Pax6 expression in lateral PVZ does not modify progenitor cell proliferation. Pax6 ORF or empty vector was co-electroporated with pcx-egfp in the lateral wall. One day later, the proportion of GFP + / BrdU + cells was similar in both conditions (control: n=7, Pax6 ORF: n= 6). (bd) Characterization of PVZ progenitors after mir-7a knock-down. Quantification of Mash1 + transitamplifying precursors (b, n=3), Dlx2 + neuronal precursors (control: n=4, mir-7a SP: n=5) and GFAP + astrocytes (d, n=4) showed no obvious difference in early commitment of PVZ progenitors after mir- 7a SP electroporation. (e, f) Interfering with mir-7a expression in the lateral wall did not significantly alter the genesis of Calbindin (e, n=5) and Calretinin-expressing (f, control: n=5 and mir-7a SP: n= 4) periglomerular neuronal populations. GL, Glomerular Layer.

9 Supplemental Figure 8: Summary of the results. (a) Left panel: In the wild type, Pax6 protein is inhibited by mir-7a in the lateral PVZ and thus limits dopaminergic differentiation of periglomerular neurons. In this condition TH + periglomerular neurons are predominantly generated by neural stem cells located in the dorsal part of the PVZ, where Pax6 protein is strongly expressed. Forced expression of Pax6 (middle panel) or inhibition of mir-7a (right panel) in the lateral neural stem cells is sufficient to trigger dopaminergic fate of periglomerular neurons, indicating that their fate depends on accurate control of Pax6 protein levels in the lateral PVZ. (b) Proposed model of Pax6 regulation by mir-7a in the lateral PVZ. Pax6 mrna and mir-7a are expressed in opposite dorsoventral gradients in the lateral PVZ, which leads to the restriction of Pax6 protein to the dorsal aspect.

10 Supplemental Materials and Methods a Oligonucleotide sequences Primers mir-7-a2-f mir-7-a2-r luci-utr-mut7a-f luci-utr-mut7a-r Sponge-7-F Sponge-7-R Pax6- Forward (qrt-pcr) Pax6-Reverse (qrt-pcr) HPRT-Forward (qrt-pcr) HPRT-Reverse (qrt-pcr) UTR-mut-mir7a-BS 5 -CTCCAGGAAGGGGGGAAAG-3 5 -AGGGTCTGCAGGTGCAGAG CAAGATCGCCGTGTAATTCTAG CTTTGTTAGCAGCCGGATGAGC-3 5 -CTCGGCATGGACGAGCTGTAC-3 5 -TCACACCACAGAAGTAAGGTTCC-3 5 -TGAAGCGGAAGCTGCAAAGAAA TTTGGCCCTTCGATTAGAAAACC CTGGTGAAAAGGACCTCTCG TGGCAACATCAACAGGACTC-3 5 -AAATGTAAGTATTTGTCAACCCTAGAAATCCTCAGAATG-3 b Mature mirna sequences (mimic) mmu-mir-7-a mmu-mir-365 mmu-mir-375 mmu-mir-300 mmu-mir-129-5p 5 -UGGAAGACUAGUGAUUUUGUUGU-3 5 -UAAUGCCCCUAAAAAUCCUUAU-3 5 -UUUGUUCGUUCGGCUCGCGUGA-3 5 -UAUGCAAGGGCAAGCUCUCUUC-3 5 -CUUUUUGCGGUCUGGGCUUGC-3 Supplemental Tables: Oligonucleotide sequences (a) and mature mirna sequences (b) used in this study.