HAEMATO-BIOCEMICAL ALTERATIONS IN Clarias Lazara INDUCED BY DELTAMETHRIN

Size: px
Start display at page:

Download "HAEMATO-BIOCEMICAL ALTERATIONS IN Clarias Lazara INDUCED BY DELTAMETHRIN"

Transcription

1 HAEMATO-BIOCEMICAL ALTERATIONS IN Clarias Lazara INDUCED BY DELTAMETHRIN ABSTRACT Inyang 1, I. R., Pughikumo 2, D. T. and Tuesday 1, T. S. 1 Department of biological sciences, Environmental Toxicology unit, Niger Delta University, Wilberforce Island, Bayelsa State. 2 Department of Human physiology, College of Health Sciences, Niger Delta University, Wilberforce Island Bayelsa State, Nigeria. Correspondence author dr.inyang2009@gmail.com Phone: The aim of this study was to unveil the effects of deltamethrin, a type II synthetic pyrethroid on some selected haematological and biochemical parameters. Thirty African catfich (Clariaslazara, juveniles), mean length, ± 0.20cm SD and mean weight, ± 0.34gSD were acclimatized to laboratory condition for 10 days and then exposed to varying sublethal concentrations of deltamethrin (0.01, 0.02 and 0.03 mg/l) in semistatic bioassays for 14 days. Blood parameters were determined in the plasma while biochemical parameters (transferases; Alanine amino transferase, ALT and aspertate amino transferase, AST) were determined in the kidney and liver. Blood parameters were significant (P<0.05) as well as transferases (ALT & AST) in a dose dependent pattern. It is concluded that deltamethrin could be toxic at high concentation. Transferases and some haematological parameters tested could serve a good biomaker in assessment of pesticide toxicity in fishes. Further studies are required to evaluate the toxicity of deltamethrin in Clariasgariepinus fingerlings and adults and recovery response. Keywords: Clariasgariepinus, deltamethrin, transferases, haematological parameters. INTRODUCTION Pesticides in general are primarily designed to control, and eliminate pest. The wide use of chemicals to control pest has been recognized in the world. The benefit that these chemicals have brought to mankind unveiled remarkable testimonies to technological advancement in terms of lives saved, increased food production and economical gains (Adelowa, 2004). The widespread and sometimes indiscriminate uses of pesticides have led to serious ecosystem problems, especially water and soil pollution (Helfrick, et al, 1983). Pollution via pesticides has become a significant subject of discussion globally (Inyang, 2013). A sudden rise in pesticide production and utilization in agriculture have exacerbated the problem of pesticide pollution (Inyang, 2013). In recent years, there have been reports of residues of persistent organic pesticides in the aquatic environment and in the bodies of aquatic organisms. The largest amount of residues seems to occur in the tissues of animals near the top of food chain and man himself (Miller, 2004). Pesticides can reach the environment via run-off from farmlands, industrial pollution and careless disposal of pesticide containers. Careless handling of organochlorine compounds from wood workers and carpet manufacturers are also possible sources of pesticide into the environment. Alterations in water quality as a result of effects pesticide usually predispose fish to stress and diseases as a result provoke quick response in the physiology of the fish, especially the haematological and biochemical parameters (Ugwa et al., 2008). Deltamethrin (s-a-cyano-3-phenoxyloenyl ((IR)-CIS-3 (2, 2,-dibromovinyl) -2, 2 dimethyl cyclopane carboxylate) which is the active ingredient of decis, belongs to type II synthetic pyrethroid. Synthetic pyrethroids (eg. deltamethrin) are analogue of naturally occurring pyrethrins found in the flowers of chrysanthemum cinerariaefoluim. Deltamethrin was synthesized in 1974 and since then it is widely used in agriculture. In Nigeria it is sold in an open market and it is well embraced by local farmers. The presence of deltamethrin in aquatic environment as a sub lethal effect on fish such as energy metabolism and ionic regulations in the kidney and liver (Khalili et al., 2012). A contributing factor to the sensitivity of fish to deltamethrin exposure seems to be its high rate of gill adsorption due to the lipophilicity (Eells et al., 1995). The main mode of its action is neurotoxicity (Elells, et al., 1995). This xenobiotic has a great impact upon the central and peripheral nervous system and acts by modulating the opening and closing of channels that can result in synaptic discharge depolarization and ultimately death (Elells et al., 1995) although this xenobiotic is broken down via ultraviolet light and sunlight, it is quite tolerant to storage and can preserve its activity for 6 months at 40 0 c and pose risk to mammals and aquatic organisms and ecosystem as a whole. (Ozkan et al., 2012) Haematological and biochemical profiles of blood can provide important information about the internal environment of the organism (Manupust, 2000). Additionally, the evaluation of haematological and biochemical characteristics in fish has become an important means of understanding normal, pathological process and toxicological impacts of xenobiotics (Sudova et al., 2008). The objective of this work, therefore, was to study the NJAFE VOL. 11 No. 1,

2 effect of deltamethrin on haematological parameters (WBC, RBC, HGb, PCV etc) and enzyme parameters (transferases: ALT & AST) in Clariaslazara (Juveniles). MATERIALS AND METHODS Experimental Stock Thirty African catfish (Clariaslazara) juveniles, mean weight 97.00±0.34SD and mean length 14.02±0.20cmSD were obtained from a private farm at Tombia town Yenagoa, Bayelsa State. They were transported in a 20 litre trough to the wet laboratory (Ecotoxicology unit), of the Department of Biological Sciences, Niger Delta university, where the assays were conducted from April to June Fishes were acclimatized individually in rectangular aquaria for ten days during which they were fed once a day ( hr) with 35% crude protein at 1% biomass. Experimental design Completely randomized design (CRD) was used for the experiment. There were four treatment levels with three replicates. A range finding test (trial test) was carried out using the toxicant deltamethrin. Four concentrations of the toxicant were prepared from the original solution (350glL). The test solution was renewed daily. This exposure (trial test) lasted for 10days. General bioassay techniques Sub-lethal concentrations of deltamethrin (toxicant) for the assay (0.01, 0.02 and 0.03 mg/l) were determined based on the range finding test (Inyang et al., 2010). These were prepared by transferring 0.002, 0.003, ml of the original concentration of deltamethrin and making it up to 300Lwith borehole water in the test aquaria. 30L of the diluents (water) was used as control. For replications of each treatment level (concentration) and control were set up by introducing fishes individually into each aquarium. The exposure period lasted 14 days during which the exposure media were renewed daily. The physico-chemical characterization of the water used for fish bioassay was carried out using standard methods of APHA (1998) and the following values were obtained: temperature c, PH , dissolved oxygen mg/l, alkalinity mg/l, conductivity µs/cm and turbidity NTU Haemato-biochemical assay technique After 14 days exposure period, blood sample for haematological analysis were collected from each fish (behind the anal fin) with 23 G size needle and syringe. Fishes were not fed prior to blood collection. Samples were preserved in EDTA bottles and the fishes were sacrificed after blood collection and dissected for the collection of the liver and kidney. 0.5g of each organ was macerated (grounded) with pestle and mortar. Physiological saline was used for preservation and stabilization. Samples were centrifuged at the rate of 3,000rpm for 10 minutes. The supernatants were then removed and stored in plain bottles at c for analysis. The activities of aspertate amino transferase (ALT) in liver and muscle were assayed using the colimeter method of Reitman and Frankel (1957). Data analysis The data were subjected to analysis of variance (ANOVA). Where differences exists, Ducan multiple range test (DMRT) was used to test for pair wise significant differences (p<0.05) between treatment (Wahua, 1999) RESULTS Haematological parameters, Various haematological parameters tested e.g. WBC, RBC, HGB and PCV showed significant (P<0.05) deviation from the control values, indicating effects on these parameters. Nuetrophyl and lymphphocytes values were not significant compared to control, albeit experimental values slightly differ from the control (Table II). Unlike PCV and HGB, WBC values decreased as the concentration of the toxicant increases. Both were dose dependent. Enzyme parameters ALT values in the kidney and liver showed a clear elevation as the concentration of the toxicant increased akin to AST, the highest value recorded was at the highest concentration (0.03mg/l), except ALT at 0.01mg/l. the value recorded here was ±0.13SD, while the highest concentration had ± 0.98SD. DISCUSSION Fish can serve as a bio-indicator of environmental pollution and also assessment of quality of aquatic environment since they are directly exposed to xenobiotics resulting from anthropogenic, agricultural and industrial practices. Leucocytes (WBC) values decreased with increasing concentration of the toxicant. This decrease is dose dependent. The present study is contrary to the belief that since WBC functions in organisms against foreign bodies aided by phagocytosis as antibody production, values will increase as a result of lethal effect of the toxicant (Inyang, 2008). The exposure of fish to deltamethrin may have caused a depression in the established total immune response against a variety of antigenic substances. The xenobiotic may have reduce the general NJAFE VOL. 11 No. 1,

3 Table 1: Haematological profile of Clariaslazara exposed to deltamethrin Con. Of WBC RBC HGB PCV PLT MCV MCH MCHC Deltamethrin (10 3 mm -3 ) (10 6 mm -3 ) (g/l) (%) (x10-5 ) (Fl) (Pg) (g/l) (Mg/L) ±0.12 a 11.60±0.03 b 12.10±0.02 ab 19.00±0.01 b 3.00±0.00 ab ±0.30 a 67.00±0.001 a 37.00±0.06 a ±0.05 b 10.01±0.00 b 11.76±0.04 ab 20.11±0.10 b 10.80±0.02a ±0.42 ab 68.00±0.00 a 28.30±0.01 ab ±0.03 c 11.41±0.01 b 14.90±0.06a 30.00±0.03 a 7.50±0.02 a ±0.08 ab 72.30±0.20 a 40.76±0.20 a ±0.10 c 20.52±0.03 a 15.00±0.00 a 31.09±0.07 a 6.50±0.02 ab ±0.11 a 49.00±0.10 b 28.48±0.09 ab Means within column with different superscripts are significantly different (P<0.05) WBC: White Blood Cell, RBC: (Red Blood Cell), HGB (Haemoglobin), PCV (Packed Cell Volume, PLT (Platelets), MCV (Mean Cell Volume), MCH (Mean Cell haemoglobin), MCHC (Mean Cell Haemoglobin Concentration). Table 2: Haematological profile of Clariaslazara exposed to deltamethrin Con. Of Deltamethrin Neut.l( g l -1 ) Lymph (g l -1 ) Mono (g l -1 ) Eosino (g l -1 ) OCC ±0.06 a 42.00±0.03 a 20.00±0.02 a 8.00±0.06 ab ab ±0.04 a 38.00±0.21 a 7.50±0.10 b 15.01±0.05 a b ±0. 10a 30.06±0.05ab 9.00±0.01 b 10.00±0.08 ab a ±0.01 ab 35.02±0.05 a 16.50±0.02 a 15.00±0.00 a a Means within column with different superscript are significantly different (P<0.05) Neut: Neutrophyl; Lymph; Lymphocyte; Mono: Monocytes; Eosino: Eosinophyl; OCC (Oxygen carrrying Capacity) Table 3: ALT and AST in the kidney and liver of Clariaslazara exposed to deltamethrin for 14 days Conc.of ALT (µ/l) AST (µ/l) Deltamethrin (mg/l) Kidney Liver Kidney Liver ±0.02 c ±0.07 c ±0.02 c 6.00±0.00 b ±0.03 b ±0.13 a ±0.05 b 9.00±0.02 b ±0.10 a ±0.41 b ±0.03 a 7.00±0.00 b ±0.01 a ±0.08 b ±0.31 a 15.00±0.03 a Means within column with different superscript are significantly different (P<0.05) immune system leading to significant depression. This is akin to the findings of Ngodegha et al. (1999) and Inyang (2008). Changes in leucocyte system usually manifest in the form of leucocytosis and lymphocypaenia which are characteristics of leucocytic response in animals exhibiting stress. Lymphocytes and neutrophils form part of the granulocytes that make up leucocytes (WBC) in organisms. Neutrophils are very active phagocytes and constitute about 70% of the total granulocytes. In this study, a progrressive decrease (dose dependent) values was observed. The reduction may be akin to carbon tetrachloride and benzene which have been implicated in eliciting excess glucocorticoid, antibody depression, lymphatic involution and retard migration of phagocytic leucocytes which may lead to total white blood cell alteration (Ovuru, 2002). Platelets (thrombocytes) are membrane bound cell fragments, usually lacking nuclei. They are responsible for blood clotting in fish and other organisms. Values of thrombocytes increased progressively as the concentration increases. This may be because of the effect of the toxicant on tissues, hence more production to enable the organism to repair some injured tissues. Erythrocytes (RBC), Hemoglobin (HGB) and packed cell volume (PVC). Haemoglobin, packed cell volume and erythrocytes in this present study were affected by the toxicant. RBC values were not significant except at the highest concentration (0.03ppm) while haemoglobim and packed cell volume values slightly progress as the concentration of the toxicant increased. Similar result was also obtained by Atamanalp and Yanik (2003). They found a significant increase (P<0.05) in the levels of RBC, MCH, MCHC in rainbow trout (Oncorhynchusmykiss) following cypermethrin and Mancozeb acute exposure. The major function of RBC is to pick oxygen from the environment bind it haemoglobin (Oxygen carrying protein) to form oxyhaemoglobin and transport them to tissues. Fishes exposed to pesticide usually lead to tissue damage, neurological disorders, stress and behavioral abnormalities. In this present study, Clarias lazara may have been stressed in addition to haematological alterations, to cushion the effect of this toxicant fish produce enough protein and erythrocytes to pick more oxygen to tissues affected, hence deviation of values of RBC. Monocytes and eosinophils Among the granulocytes, eosinophils are phagolytic and ingest foreign proteins and immune complexes rather than bacteria (Miller and Harley, 2004). In some organism eosinophils also release chemicals that counteract the effects of certain inflammatory chemicals released during allergic reactions. A progressive increase in values was observed as the concentration increases. The sudden increase may be because of emergency of phagocytic response as a result of the toxicant effect on tissues of the probe organism. NJAFE VOL. 11 No. 1,

4 Moncytes are known to circulate in blood for a few days then migrate into the reticulo-endothelial system where they remain for a long time, known in this system as macrophages (Miller and Harley, 2004). In this study, the profound decrease was observed. The reduction is attributable to the effect of deltamethrin as well as lymphoid tissue such as spleen. Enzymology: transferases Enzyme analysis of organs such as muscles, kidney liver, heart and gills in fish can provide important information about the internal environment of the organism (Boeger et al., 2003). Activities of enzymes in fish are essential metabolic processes. We observed an increase in values of transferases tested (AST and ALT) in both Kidney and liver of the probe organism. The trend was not tissue specific but dose dependent. Elevated levels of ALT and AST indicate the enhanced transamination of amino acids, which may provide ketoacids to serve as precursor in the synthesis of essential organic elements (Prashant and Neclagund, 2008). It is likely that toxic stress imposed by deltamethrin might be one of the factors for the observed activities of ALT and AST in the present study. Similarly, sepici-dincel et al. (2009) observed that the increase in activities of AST and ALT in the muscle and liver of common carp exposed to 10.00ppm of cypermethrin may be due to a disturbance in the krebs cycle, hence a decrease in Kreb s cycle intermediate which is compensated by ALT and AST by providing α-ketoglutarate. The transferases (ALT and AST) function as a link between carbohydrate and protein metabolism by catalyzing the inter conversion of strategic compounds like α-ketoglutarate and alanine to pyruvic acid and glutamic acid respectively (Tiwari and Singh, 2004). ALT and AST were higher in the kidney and liver tissues. This suggests that both organs are very efficient in utilizing amino acid for metabolic purposes. Oxygen carrying capacity (OCC) Oxygen carrying capacity values increased slightly as the concentration of the toxicant increases. Quite unlike reports by Dhara and Gassert, (2004) and Inyang(2008). The authors reported a decrease in values of OCC as the concentration of the toxicant decreased. The authors reasoned that the toxicant causes adversity in the protein haemoglobin and possibly carbomoylation (the addition of a carbomyl group (CO-NH 2) to a protein amino acid of the haemoglobin molecule. In this present study, the xenobiotic did not alter the oxygen affinity of blood by carbomoylation of the end amino acid chains of the haemoglobin molecule. CONCLUSION This research work has unveiled the toxicity of deltamethrin on haematological and biochemical indices in Clariaslazara. WBC, RBC, HGB, AST and ALT could serve as useful biomarkers of sub-lethal effects of deltamethrin in aquatic environment. In light of the findings of this study, we therefore recommend that analysis of blood parameters should be done more than once within the exposure period in subsequent studies. It is also pertinent to ascertain the level of toxicity of the toxicant in other aquatic organisms. The monitoring of the environment for the levels of this and other pesticides should be carried out more frequently by the authorities concerned. Finally, the use of deltamethrin close to aquatic environments should be done with caution. REFERENCES Adelewa, I. 2004, Effects of pesticides on aquatic organisms. Canadian Journal of fish and aquatic science 53: Atamanalp M. and Yanik, T Alterations in haematological parameters of rainbow trout (Onchorhynchusmykiss) exposed to mancozeb. Turkish Journal of Veterinary Animal Sc. 27: Boeger, W., Ostrasky, A., Guimaraes, A. T. B. and Romao, S Histopathology as an approach to evaluate the effect of the oil spill on fishes of the rivers Saldanha Barigui and Lyvale (Brazil). Spill. Conf. 2(3) Dhara, U. R. and Gassert, H. T Acute toxicity of cyanide on common carp, Branchydaniorerio, current science vol 14, Elells, J. T., Resmusen, J. L. and Bandetini, P. A Difference in the neuroexcitatory actions of pyrethroid insecticides and sodium channel specific neurotoxins in rat and trout brain. Toxicol and Appl. Pharmacol. 123: Helfric, L. A., Weigmann, D. L., Hipkins, P. and Stinson, E. R., Pesticides and aquatic organisms a guide for reducing impacts on aquatic systems. Environ. Ecol. 11: InyangI, R., Ogamba, E. N., Frank, V. E Biochemical changes and electrolyte stabilization in Clarias gariepinus (Juveniles) induced by dichlovos. International Journal of biochemisty 108: Inyang, I. R Haematological and biochemical responses of Clarias gariepinusto diazinon. Ph.D thesis, Rivers State University of science and technology, Port Harcourt, Rivers State. NJAFE VOL. 11 No. 1,

5 Khalili, M., Khaleghi, S. R. and Hadayati A Acute toxicity test of two pesticides (Diazinon and deltamethrin) on swordtail fish. Global vet 8: Miller, H. W Effects of monoclotopos on some selected aquatic organisms. J. fish. Biology 48: Miller S. A and Harley J. P Zoology. 2Ed. WM.C. Brown Pub. England. 2: Manupust, J., Clinical biochemistry. Kalolinumpraha (Ed), Ngodigha, S. M., Olayimika, F. O., Oruwari, B. M., Ekwepzor, I. K. E. and Wekhe, S. N Toxic effects of crude oil on organs and blood cells of West African dwarf goat. Nig. Vet. J. 20(1):82-91 Ovuru, S. S Gonadal and physiological respnses of rabbits exposed to crude oil contaminated feed. Ph.D thesis, Rivers State University of science and technology, Port Harcourt, Rivers State. Ozkan, O. and Ustuner, A Investigation on genotoxicity of deltamethrin. Kaflkar Univ. vet. 18: Prashauth, M. S and Neelagund, S. E Impact of cypermethrin on enzyme activities in the fresh water fish CirrrhinusMrigala(Hamilton). Caspian J. Env. Sc 6(2): Reitman, S. and Frankel, C Colorimetric method for the determination of serum glutamic oxaloacetalic and glutamic pyruvate transaminase. Am. J. clinical pathotologies (28), Sepici-Dincel, S. V., Hanaty, M. S. and Abdel, M. I Studies on the teratogenic effects of deltamethrin in rats. Dutch J. of fishens 100: Sudova, E,.Piackora.V., Kroupova, H., Pijack, M. and Svuobodova, Z The effect of paraquat dichloride on selected haematological and biochemical indices in common carp (CyprinusCarpio). Fish physiology and biochemistry. 35(4), Tiwari, S. and Singh, A Piscidal activity of alcoholic extract of Nerium indicumleaf and their biochemical stress response on fish metabolism. Ugwua, J. Y. and George, A. D. I Plasma enzymes in Clariasgariepinus. Env. Tox. and pharmacology 21: Wahua, T. A. T Applied statistics for scientific studies; Africa link books, Ibadan. NJAFE VOL. 11 No. 1,

Effects of Sub-Lethal Concentrations of Diazinon on Total Protein and Transaminase Activities in Clarias gariepinus

Effects of Sub-Lethal Concentrations of Diazinon on Total Protein and Transaminase Activities in Clarias gariepinus Current Research Journal of Biological Sciences 2(6): 390-395, 2010 ISSN: 2041-0778 Maxwell Scientific Organization, 2010 Submitted date: September 06, 2010 Accepted date: October 09, 2010 Published date:

More information

Effect of Paraquat Dichloride on Some Metabolic and Enzyme Parameters of Clarias gariepinus

Effect of Paraquat Dichloride on Some Metabolic and Enzyme Parameters of Clarias gariepinus Current Research Journal of Biological Sciences 3(3): 186-190, 2011 ISSN: 2041-0778 Maxwell Scientific Organization, 2011 Received: December 24, 2010 Accepted: February 22, 2010 Published: May 05, 2011

More information

gariepinus Impact of Fluazifop-p-butyl Exposure on Transferases and Phosphatase in Clarias Inyang I.R. Thomas S. Seiyaboh E.I

gariepinus Impact of Fluazifop-p-butyl Exposure on Transferases and Phosphatase in Clarias Inyang I.R. Thomas S. Seiyaboh E.I ISSN: 2384-6321 Submitted: 08/02/2017 Accepted: 10/02/2017 Published: 28/02/2017 DOI: http://doi.org/10.15580/gjbb.2017.1.020817020 Impact of Fluazifop-p-butyl Exposure on Transferases and Phosphatase

More information

Unit Seven Blood and Immunity

Unit Seven Blood and Immunity Unit Seven Blood and Immunity I. Introduction A. Definition Blood is a sticky fluid that is heavier and thicker than water. Blood is a type of, whose cells and suspended in a liquid intercellular material.

More information

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,

More information

The Effects of Crude Oil on the Blood Parameters and Serum Enzymes of the African Catfish Clarias Gariepinus

The Effects of Crude Oil on the Blood Parameters and Serum Enzymes of the African Catfish Clarias Gariepinus The Effects of Crude Oil on the Blood Parameters and Serum Enzymes of the African Catfish Clarias Gariepinus C.F. Ikeogu 1, C.I. Nsofor 2, I.O. Igwilo 3, A.A. Ngene 4 1. Department of Fisheries and Aquaculture,

More information

Haematological and Serological Responses of Clarias Gariepinus to Sublethal Concentrations of Lead Nitrate

Haematological and Serological Responses of Clarias Gariepinus to Sublethal Concentrations of Lead Nitrate Haematological and Serological Responses of Clarias Gariepinus to Sublethal Concentrations of Lead Nitrate ABSTRACT: C.F. Ikeogu 1, C.I. Nsofor 2, I.O. Igwilo 3, A.A. Ngene 4 1Department of Fisheries and

More information

on fishes are detailed out in the Review of Literature. In this

on fishes are detailed out in the Review of Literature. In this SUMMARY VI S U M M A R Y The work presented here centers around the toxic action of three pesticides, comprising organochlorine, organophosphate and by bypyridilium compounds, (N1 the euryhaline fish Etroplus

More information

A. Blood is considered connective tissue. RBC. A. Blood volume and composition 1. Volume varies - average adult has 5 liters

A. Blood is considered connective tissue. RBC. A. Blood volume and composition 1. Volume varies - average adult has 5 liters A. Blood is considered connective tissue. RBC A. Blood volume and composition 1. Volume varies - average adult has 5 liters 2. 45% cells by volume called hematocrit (HCT) a. red blood cells (RBC) mostly

More information

Lifeblood Lab Activity

Lifeblood Lab Activity History of Blood: It is the universal symbol of horror, of death, yet it is the one thing that keeps you living. It is the blood that is coursing through your veins. But, what do you really know about

More information

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge. Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,

More information

Blood Cells Med Terms Quiz

Blood Cells Med Terms Quiz Blood Cells Med Terms Quiz Question Prompt: 1 Mononuclear white blood cells (agranulocyte) formed in lymph tissue, also a phagocyte and a precursor of macrophages are leukocytes. True False Question Prompt:

More information

The fluid medium (blood) is a highly specialized connective tissue that consists of various blood cells (formed elements) suspended in a fluid matrix

The fluid medium (blood) is a highly specialized connective tissue that consists of various blood cells (formed elements) suspended in a fluid matrix Blood In Detail The fluid medium (blood) is a highly specialized connective tissue that consists of various blood cells (formed elements) suspended in a fluid matrix (blood plasma). The formed elements

More information

The Main Constituents of Blood

The Main Constituents of Blood The Main Constituents of Blood Described as a fluid connective tissue, blood is comprised of approximately 55% plasma (a yellow-ish but transparent fluid) and 45% cellular volume (erythrocytes (red cells),

More information

BIOCHEMISTRY OF BLOOD

BIOCHEMISTRY OF BLOOD BCH 471 BIOCHEMISTRY OF BLOOD Amal Alamri Experiment 1 Separation of Plasma and Serum from Whole Blood Whole Blood It is living tissue that circulates through the heart, arteries, veins, and capillaries

More information

Effects of cypermethrin on rainbow trout (Oncorhynchus mykiss)

Effects of cypermethrin on rainbow trout (Oncorhynchus mykiss) Veterinarni Medicina, 51, 2006 (10): 469 476 Original Paper Effects of cypermethrin on rainbow trout (Oncorhynchus mykiss) J. VELISEK 1,2, T. WLASOW 3, P. GOMULKA 3, Z. SVOBODOVA 1,4, R. DOBSIKOVA 4, L.

More information

Haemato-biochemical Parameters in African Catfish Experimentally Infected with Single and Mixed Escherichia coli and Salmonella gallinarium

Haemato-biochemical Parameters in African Catfish Experimentally Infected with Single and Mixed Escherichia coli and Salmonella gallinarium J. Agric. Food. Tech., 9(1)7-12, 2019 2019, TextRoad Publication ISSN 2090 424X Journal of Agriculture and Food Technology www.textroad.com Haemato-biochemical Parameters in African Catfish Experimentally

More information

Whole Blood. Lab 29A. Blood. Plasma. Whole Blood. Formed Elements. Plasma: Fluid component. Formed elements: Cells and fragments

Whole Blood. Lab 29A. Blood. Plasma. Whole Blood. Formed Elements. Plasma: Fluid component. Formed elements: Cells and fragments Whole Blood Lab 29A. Blood Plasma: Fluid component Water (90%) Dissolved plasma proteins Other solutes Formed elements: Cells and fragments RBCs (carry Oxygen) WBCs (immunity) Platelets (cell fragments

More information

Toxicological Studies of the Aqueous Leaves Extracts of Combretum micranthum on Rats

Toxicological Studies of the Aqueous Leaves Extracts of Combretum micranthum on Rats International Journal of Biotechnology and Biochemistry ISSN 0973-2691 Volume 12, Number 2 (2016) pp. 167-171 Research India Publications http://www.ripublication.com Toxicological Studies of the Aqueous

More information

The Circulatory System. Blood and Blood Pressure

The Circulatory System. Blood and Blood Pressure The Circulatory System Blood and Blood Pressure Blood Total volume = 8-9% of body mass Average person = 5 L of blood DYK? Blood is actually a tissue! Plasma: - water, proteins, salts, gases, nutrients,

More information

G. Types of White Blood Cells

G. Types of White Blood Cells 1. White blood cells are also called leukocytes. G. Types of White Blood Cells 2. White blood cells function to protect against diseases. 3. Two hormones that stimulate white blood cell production are

More information

SHRIRAM INSTITUTE FOR INDUSTRIAL RESEARCH

SHRIRAM INSTITUTE FOR INDUSTRIAL RESEARCH IN RATS SUB CHRONIC ORAL TOXICITY WITH NHH 44 Bt-COTTON SEEDS Report for: UNIVERSITY OF AGRICULTURAL SCIENCES AGRICULTURAL RESEARCH STATION DHARWAD-580007 KARNATAKA Guidelines: DBT, Guidelines for Toxicity

More information

EFFECT OF PETROLEUM PRODUCTS INHALATION ON SOME HAEMATOLOGICAL INDICES OF FUEL ATTENDANTS IN CALABAR METROPOLIS, NIGERIA

EFFECT OF PETROLEUM PRODUCTS INHALATION ON SOME HAEMATOLOGICAL INDICES OF FUEL ATTENDANTS IN CALABAR METROPOLIS, NIGERIA 71 Nigerian Journal Of Physiological Sciences 21 (1-2):71-75 Physiological Society Of Nigeria, 2006 Available online/abstracted at http://www.biolineinternational.org.br/njps; www.ajol.info/journals.njps;

More information

Effect of Turmeric (Curcuma longa) Root Meal on Haematological Parameters of Adult Rabbits

Effect of Turmeric (Curcuma longa) Root Meal on Haematological Parameters of Adult Rabbits African Journal of Agriculture Technology and Environment Vol. 7(1): 142-147 June, 2018 E-ISSN: 2346-7290 Effect of Turmeric (Curcuma longa) Root Meal on Haematological Parameters of Adult Rabbits 1 George

More information

Lc50 assessment of cypermethrin in Heteropneustes fossilis: Probit analysis

Lc50 assessment of cypermethrin in Heteropneustes fossilis: Probit analysis 2017; 5(5): 126-130 E-ISSN: 2347-5129 P-ISSN: 2394-0506 (ICV-Poland) Impact Value: 5.62 (GIF) Impact Factor: 0.549 IJFAS 2017; 5(5): 126-130 2017 IJFAS www.fisheriesjournal.com Received: 20-07-2017 Accepted:

More information

International Journal of Science, Environment and Technology, Vol. 6, No 1, 2017,

International Journal of Science, Environment and Technology, Vol. 6, No 1, 2017, International Journal of Science, Environment and Technology, Vol. 6, No 1, 2017, 793 797 ISSN 2278-3687 (O) 2277-663X (P) HAEMATOLOGICAL STATUS OF KARAN FRIES COWS DURING TRANSITION PERIOD IN HOT HUMID

More information

formance Inflammation Recovery Digestion Fertility Endurance Calm

formance Inflammation Recovery Digestion Fertility Endurance Calm formance Inflammation Recovery Digestion Fertility Endurance Calm Inflammation Anti-Oxidant Endurance Fitness Performance Calmness erformance Inflammation Recovery Digestion Fertility Endurance Ca EQUI-BOOST

More information

DEPARTMENT OF PHYSIOLOGY

DEPARTMENT OF PHYSIOLOGY UNIVERSITY OF MEDICAL SCIENCES, ONDO DEPARTMENT OF PHYSIOLOGY BLOOD AND BODY FLUID PHYSIOLOGY LECTURER: MR A.O. AKINOLA OBJECTIVES Leukopoiesis Thrombopoiesis Leukopoiesis and Lymphopoiesis White blood

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Am. J. Life. Sci. Res. Vol. 2, Issue 3, , 2014

Am. J. Life. Sci. Res. Vol. 2, Issue 3, , 2014 2014, World of Researches Publication Am. J. Life. Sci. Res. Vol. 2, Issue 3, 367-378, 2014 American Journal of Life Science Researches www.worldofresearches.com ORIGINAL ARTICLE Received 2 Jan. 2014 Accepted

More information

Environmental Science

Environmental Science ISSN : 0974-7451 Volume 11 Issue 3 ESAIJ, 11(3), 2015 [098-102] Toxicity of copper on rainbow trout: Lethal concentration or lethal dose evaluation? Jalal Hassan*, Hadi Tabarraei Department of Toxicology,

More information

Blood consists of red and white blood cells suspended in plasma Blood is about 55% plasma and 45% cellular elements Plasma 90% water 10% dissolved

Blood consists of red and white blood cells suspended in plasma Blood is about 55% plasma and 45% cellular elements Plasma 90% water 10% dissolved Bio 100 Guide 21 Blood consists of red and white blood cells suspended in plasma Blood is about 55% plasma and 45% cellular elements Plasma 90% water 10% dissolved inorganic ions, proteins, nutrients,

More information

Chapter 19. Openstax: Chapter 18. Blood

Chapter 19. Openstax: Chapter 18. Blood Chapter 19 Blood Openstax: Chapter 18 Chapter 19 Learning Outcomes After completing Chapter 19, you will be able to: 1. Describe the components and major functions of blood and list the physical characteristics

More information

Plasma Red blood cells White blood cells. Leucocytes KEYWORDS Phagocytes

Plasma Red blood cells White blood cells. Leucocytes KEYWORDS Phagocytes Blood Plasma Red blood cells White blood cells Platelets Lymphocytes Leucocytes KEYWORDS Phagocytes Monocytes Erythocytes ABO groups Haemoglobin Blood components: Components of blood: Plasma Red blood

More information

of unknown sub-species with varying genetic make-up. The easiest morphological tool that can be used in differentiating both

of unknown sub-species with varying genetic make-up. The easiest morphological tool that can be used in differentiating both A COMPARATIVE STUDY ON THE BREEDING PERFORMANCE OF BIDORSALIS HETEROBRANCHUS AND HETEROBRANCHUS LONGIFILIS, USING THREE DOSES OF OVAPRIM Nwadukwe, F.O. Department of Animal and Environmental Biology, Delta

More information

The % of blood consisting of packed RBCs is known as the hematocrit. Blood s color ranges from scarlet (oxygen-rich) to dark red (oxygen poor).

The % of blood consisting of packed RBCs is known as the hematocrit. Blood s color ranges from scarlet (oxygen-rich) to dark red (oxygen poor). Biology Blood Blood is a fluid connective tissue consisting of cells suspended in a liquid fibrous matrix. The cells are called formed elements and the liquid matrix is known as plasma. The formed elements

More information

Hematocrit. Hematocrit = using a centrifuge to separate out the parts of blood. Plasma Formed elements:

Hematocrit. Hematocrit = using a centrifuge to separate out the parts of blood. Plasma Formed elements: Blood Notes Hematocrit Hematocrit = using a centrifuge to separate out the parts of blood Plasma Formed elements: Buffy Coat = Leukocytes and Platelets Erythrocytes General Facts Blood ph = 7.4 Volume

More information

Composition of Blood

Composition of Blood Blood is a connective tissue, specialized to transport the respiratory gasses as well as hormones, nutrients, and wastes, and the distribution of heat. The various cells of the blood perform specific functions.

More information

HEMOTOLOGY. B. Helps stabilize body temperature -heats up and cools down slowly which moderates body temp

HEMOTOLOGY. B. Helps stabilize body temperature -heats up and cools down slowly which moderates body temp I. Body H 2 O = HEMOTOLOGY A. Variable quantities 1. sweating and urination ( ) decreases H 2 O 2. drinking H 2 O increases B. Water is found in two compartments 1. contains 2/3 of all water in your body

More information

Capillary Action and Blood Components. Biology 20 Unit D: Body Systems Circulation

Capillary Action and Blood Components. Biology 20 Unit D: Body Systems Circulation Capillary Action and Blood Components Biology 20 Unit D: Body Systems Circulation 1 Remember. Capillaries are so small that blood cells can only pass through single file Important because they are the

More information

Blood: Functions. Liquid connective tissue 3 general functions 1. Transportation. 2. Regulation. 3. Protection

Blood: Functions. Liquid connective tissue 3 general functions 1. Transportation. 2. Regulation. 3. Protection Blood Elements Lecture Objectives List blood components. Classify formed elements of blood. Discuss the scientific basis of the above classification. Describe the basic structure of erythrocytes and criteria

More information

Blood and Defense. Chapter 11

Blood and Defense. Chapter 11 Blood and Defense Chapter 11 Functions of Blood 1. Carry nutrients from the small intestine and oxygen from the lung to tissues in the body 2. Transport wastes from tissues to the kidneys and carbon dioxide

More information

Immunity. ES/RP 531 Fundamentals of Environmental Toxicology. Lecture 14 Immunotoxicity. Instructor: Allan Felsot

Immunity. ES/RP 531 Fundamentals of Environmental Toxicology. Lecture 14 Immunotoxicity. Instructor: Allan Felsot Instructor: Allan Felsot afelsot@tricity.wsu.edu Fall 2005 ES/RP 531 Fundamentals of Environmental Toxicology Lecture 14 Immunotoxicity in Humans Hematopoiesis (generation of blood cells) Differentiation

More information

CH 11 Blood OUTLINE: Functions of Blood Composition of Blood Blood Cell Disorders Blood Types Blood Clotting Functions of Blood Transportation

CH 11 Blood OUTLINE: Functions of Blood Composition of Blood Blood Cell Disorders Blood Types Blood Clotting Functions of Blood Transportation 1 CH 11 Blood OUTLINE: Functions of Blood Composition of Blood Blood Cell Disorders Blood Types Functions of Blood Transportation Protection Regulation ph Temperature Composition of Blood Plasma: liquid

More information

Study of haematological alterations induced by exposure to diazinon in Channa punctatus (Bloch)

Study of haematological alterations induced by exposure to diazinon in Channa punctatus (Bloch) International Journal of Zoology Studies ISSN: 2455-7269 Impact Factor: RJIF 5.14 www.zoologyjournals.com Volume 3; Issue 2; March 2018; Page No. 334-338 Study of haematological alterations induced by

More information

Chapter 19: The Cardiovascular System: The Blood. Copyright 2009, John Wiley & Sons, Inc.

Chapter 19: The Cardiovascular System: The Blood. Copyright 2009, John Wiley & Sons, Inc. Chapter 19: The Cardiovascular System: The Blood Blood Liquid connective tissue 3 general functions 1. Transportation Gases, nutrients, hormones, waste products 2. Regulation ph, body temperature, osmotic

More information

2. Department of Animal Science and Fisheries Management, Bowen University, Iwo, Osun State, Nigeria ABSTRACT

2. Department of Animal Science and Fisheries Management, Bowen University, Iwo, Osun State, Nigeria ABSTRACT Braz. J. Aquat. Sci. Technol., 2009, 13(1):19-24. COMPARATIVE ASSESSMENT OF SODIUM EDTA AND HEPARIN AS ANTICOAGULANTS FOR THE EVALUATION OF HAEMATOLOGICAL PARAMETERS IN CULTURED AND FERAL AFRICAN CATFISH

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

-Renad Habahbeh. -Shahd Alqudah. - Saleem. 1 P a g e

-Renad Habahbeh. -Shahd Alqudah. - Saleem. 1 P a g e -1 -Renad Habahbeh -Shahd Alqudah - Saleem 1 P a g e Introduction: *Hematology and lymph system (MLS): it is a branch of medicine concerned with the study, diagnosis, prevention and treatment of blood

More information

Biology 218 Human Anatomy. Adapted form Martini Human Anatomy 7th ed. Chapter 20 The Cardiovascular System: Blood

Biology 218 Human Anatomy. Adapted form Martini Human Anatomy 7th ed. Chapter 20 The Cardiovascular System: Blood Adapted form Martini Human Anatomy 7th ed. Chapter 20 The Cardiovascular System: Blood Introduction The cardiovascular system functions as a system to transport numerous substances throughout the body

More information

Introduction to Haematology. Prof Roger Pool Department of Haematology University of Pretoria

Introduction to Haematology. Prof Roger Pool Department of Haematology University of Pretoria Introduction to Haematology Prof Roger Pool Department of Haematology University of Pretoria Suggested reading Haematology at a Glance Atul Mehta & Victor Hoffbrand Second Edition Published by Blackwell

More information

BEHAVIOURAL AND BIOCHEMICAL RESPONSES OF JUVENILE CATFISH (CLARIAS GARIEPINUS) EXPOSED TO GRADED CONCENTRATIONS OF CASSAVA WASTE WATER

BEHAVIOURAL AND BIOCHEMICAL RESPONSES OF JUVENILE CATFISH (CLARIAS GARIEPINUS) EXPOSED TO GRADED CONCENTRATIONS OF CASSAVA WASTE WATER 2136 BEHAVIOURAL AND BIOCHEMICAL RESPONSES OF JUVENILE CATFISH (CLARIAS GARIEPINUS) EXPOSED TO GRADED CONCENTRATIONS OF CASSAVA WASTE WATER 1&2 ASOGWA, Chinweike Norman, 1 EZENWAJIAKU, Francis O., 1 OKOLO,

More information

Mistake Correction!!!!!

Mistake Correction!!!!! Tuzzy Talk # 7: Effects of Oil, Dispersants and Dispersed Oil on Organisms Part 1: Introduction to Toxicology (Continued) November 1, 2014 Nancy E. Kinner University of New Hampshire Center for Spills

More information

Human Hemoglobin Colorimetric Detection Kit

Human Hemoglobin Colorimetric Detection Kit Human Hemoglobin Colorimetric Detection Kit CATALOG NO: IRAAKT2522 LOT NO: SAMPLE INTENDED USE The Hemoglobin detection kit is designed to quantitatively measure all forms of hemoglobin present in blood

More information

Chapter 7. Haematology

Chapter 7. Haematology Chapter 7 Haematology INTRODUCTION Currently it has been realized that a large variety of insecticides used extensively to control insect pests and to augment agricultural yield eventually reach the aquatic

More information

Translatability of cytokine data: from animals to humans. Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal

Translatability of cytokine data: from animals to humans. Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal Translatability of cytokine data: from animals to humans Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal Presentation outline Overview of cytokines Factors related

More information

Chapter 14. Blood. Blood Volume. Blood Composition. Blood

Chapter 14. Blood. Blood Volume. Blood Composition. Blood Blood connective tissue transports vital substances maintains stability of interstitial fluid distributes heat Chapter 14 Blood Blood Cells form mostly in red bone marrow red blood cells white blood cells

More information

Complete Blood Count PSI AP Biology

Complete Blood Count PSI AP Biology Complete Blood Count PSI AP Biology Name: Objective Students will examine how the immunological response affects molecules in the blood. Students will analyze three complete blood counts and create diagnoses

More information

THE KENYA POLYTECHNIC UNIVERSITY COLLEGE

THE KENYA POLYTECHNIC UNIVERSITY COLLEGE THE KENYA POLYTECHNIC UNIVERSITY COLLEGE SCHOOL OF HEALTH SCIENCES AND TECHNOLOGY DEPARTMENT OF BIOMEDICAL LABORATORY SCIENCES AND TECHNOLOGY DIPLOMA IN MEDICAL LABORATORY SCIENCE END OF YEAR 1 EXAMINATION

More information

Haematological Responses of Heteroclarias Fed Dietary Levels of Alchornia Cordifolia Leaf Meal.

Haematological Responses of Heteroclarias Fed Dietary Levels of Alchornia Cordifolia Leaf Meal. International Journal of Research in Pharmacy and Biosciences Volume 2, Issue 6, July 2015, PP 11-15 ISSN 2394-5885 (Print) & ISSN 2394-5893 (Online) Haematological Responses of Heteroclarias Fed Dietary

More information

BLOOD RUNS THROUGH YOUR BODY

BLOOD RUNS THROUGH YOUR BODY BLOOD RUNS THROUGH YOUR BODY WORKSHEET A Your heart and blood vessels make up your blood system. At the centre of your blood system is your heart. Its job is to pump the blood around your body. The rest

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Haematology and Growth Performance of Clarias gariepinus (Burchell) to Diets Formulated with Aspatharia sinuata (L) Meal

Haematology and Growth Performance of Clarias gariepinus (Burchell) to Diets Formulated with Aspatharia sinuata (L) Meal American Journal of Biology and Life Sciences 2015; 3(6): 273-289 Published online December 8, 2015 (http://www.openscienceonline.com/journal/ajbls) ISSN: 2381-3784 (Print); ISSN: 2381-3792 (Online) Haematology

More information

What Does My Blood Test Mean

What Does My Blood Test Mean What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential

More information

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim

More information

Blood ESSENTIALS OF HUMAN ANATOMY & PHYSIOLOGY ELAINE N. MARIEB EIGHTH EDITION

Blood ESSENTIALS OF HUMAN ANATOMY & PHYSIOLOGY ELAINE N. MARIEB EIGHTH EDITION 10 Blood PowerPoint Lecture Slide Presentation by Jerry L. Cook, Sam Houston University ESSENTIALS OF HUMAN ANATOMY & PHYSIOLOGY EIGHTH EDITION ELAINE N. MARIEB Blood The only fluid tissue in the human

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

Blood. Biol 105 Lecture 14 Chapter 11

Blood. Biol 105 Lecture 14 Chapter 11 Blood Biol 105 Lecture 14 Chapter 11 Outline I. Overview of blood II. Functions of blood III. Composition of blood IV. Composition of plasma V. Composition of formed elements VI. Platelets VII. White blood

More information

Hematological Effects of Cadmium in Hybrid Isa brown

Hematological Effects of Cadmium in Hybrid Isa brown Available online at www.pelagiaresearchlibrary.com European Journal of Experimental Biology, 2012, 2 (6):2049-2054 Hematological Effects of Cadmium in Hybrid Isa brown * Imer Haziri 1, Bujar Mane 2, Arben

More information

Blood Lecture Outline : Fluid Connective Tissue Part I of the Cardiovascular Unit

Blood Lecture Outline : Fluid Connective Tissue Part I of the Cardiovascular Unit Blood Lecture Outline : Fluid Connective Tissue Part I of the Cardiovascular Unit General Characteristics: Extracellular matrix ph Volume Functions of the blood: 1. Transport 2. Regulation 3. Protection

More information

Activity Overview. P.L.E.P: Parts of Blood. Cast Your Net: Adventures With Blood. Activity 1A. Activity Objectives: Activity Description:

Activity Overview. P.L.E.P: Parts of Blood. Cast Your Net: Adventures With Blood. Activity 1A. Activity Objectives: Activity Description: P.L.E.P: Parts of Blood Activity 1A Activity Objectives: Students will be able to: Work in a collaborative group to complete a given task Examine the different parts of blood Identify the parts of blood

More information

Agenda. Components of blood. Blood is Fluid Connective Tissue. Blood: General functions

Agenda. Components of blood. Blood is Fluid Connective Tissue. Blood: General functions Agenda Chapter 19: Blood Major functions Major Components Structure of RBCs and WBCs ABO Blood Types, and Rh Factor Lab 34.1 and Blood Typing Blood: General functions Transport of dissolved gases, nutrients,

More information

Chapter 11. Lecture and Animation Outline

Chapter 11. Lecture and Animation Outline Chapter 11 Lecture and Animation Outline To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off. Please Note: Once you have

More information

Sickle Cell Disease and impact on the society

Sickle Cell Disease and impact on the society Sickle Cell Disease and impact on the society Professor Z.A.Jeremiah Ph.D, FRCPath (London) Professor of Haematology and Blood Transfusion Science Niger Delta University, Wilberforce Island Outline What

More information

Chapter 19 Cardiovascular System Blood: Functions. Plasma

Chapter 19 Cardiovascular System Blood: Functions. Plasma Chapter 19 Cardiovascular System Blood: Functions 19-1 Plasma Liquid part of blood. Colloid: liquid containing suspended substances that don t settle out of solution 91% water. Remainder proteins, ions,

More information

Chapter 13 The Blood

Chapter 13 The Blood Chapter 13 The Blood Copyright 2015 Wolters Kluwer Health Lippincott Williams & Wilkins Overview Key Terms agglutination erythrocyte lymphocyte albumin fibrin megakaryocyte anemia hematocrit monocyte antigen

More information

What is the composition of blood, including blood cells? What organs and structures control the flow of blood throughout the body?

What is the composition of blood, including blood cells? What organs and structures control the flow of blood throughout the body? 3 Chapter 10: Circulatory System and Lymphatic System In this chapter, you will learn about the structure and function of the circulatory system and lymphatic system. What is the composition of blood,

More information

4/5/17. Blood. Blood. Outline. Blood: An Overview. Functions of Blood

4/5/17. Blood. Blood. Outline. Blood: An Overview. Functions of Blood Outline Blood Biol 105 Chapter 11 I. Overview of blood II. Functions of blood III. Composition of blood IV. Composition of plasma V. Composition of formed elements VI. Platelets VII. White blood cells

More information

Abnormal blood counts in children Dr Tina Biss Consultant Paediatric Haematologist Newcastle upon Tyne Hospitals NHS Foundation Trust

Abnormal blood counts in children Dr Tina Biss Consultant Paediatric Haematologist Newcastle upon Tyne Hospitals NHS Foundation Trust Abnormal blood counts in children Dr Tina Biss Consultant Paediatric Haematologist Newcastle upon Tyne Hospitals NHS Foundation Trust Regional Paediatric Specialty Trainees teaching 4 th July 2017 Scope

More information

Pearson's Comprehensive Medical Assisting Administrative and Clinical Competencies

Pearson's Comprehensive Medical Assisting Administrative and Clinical Competencies Pearson's Comprehensive Medical Assisting Administrative and Clinical Competencies THIRD EDITION CHAPTER 27 The Cardiovascular System Lesson 2: Composition and Function of Lesson Objectives Upon completion

More information

Cardiovascular System Blood

Cardiovascular System Blood Cardiovascular System Blood William T. Budd Virginia Commonwealth University Center for the Study of Biological Complexity Medical Careers College Objectives What is blood? Review metabolism Functions

More information

Blood. Blood Composition Plasma Red blood cells -RBCs White Blood Cells- WBCs (leucocytes) Blood Platelets PLT (thrombocytes)

Blood. Blood Composition Plasma Red blood cells -RBCs White Blood Cells- WBCs (leucocytes) Blood Platelets PLT (thrombocytes) Blood Blood Composition Plasma Red blood cells -RBCs White Blood Cells- WBCs (leucocytes) Blood Platelets PLT (thrombocytes) Functions of the blood 1. Respiration - transport of oxygen from the lungs to

More information

Unit 6: Circulatory System. 6.1 Blood

Unit 6: Circulatory System. 6.1 Blood Unit 6: Circulatory System 6.1 Blood Blood Function Function Nutritive Respiratory Excretory Regulatory Protective Effects on Body Transporting nutrient molecules (glucose, amino acids, fatty acids and

More information

Chapter 19: Cardiovascular System: Blood

Chapter 19: Cardiovascular System: Blood Chapter 19: Cardiovascular System: Blood I. Functions of Blood A. List and describe the seven major homeostatic functions of blood: 1. 2. 3. 4. 5. 6. 7. II. Plasma A. Composition 1. It is a fluid consisting

More information

Haematological effect of acute concentration of cypermethrin on juveniles of clarias gariepinus

Haematological effect of acute concentration of cypermethrin on juveniles of clarias gariepinus International Journal of Engineering Science Invention Volume Issue 3 ǁ March. 13 Haematological effect of acute concentration of cypermethrin on juveniles of clarias gariepinus R.O.Ojutiku, 1 F.P Asuwaju,

More information

Chapter 19: The Cardiovascular System: The Blood. Copyright 2009, John Wiley & Sons, Inc.

Chapter 19: The Cardiovascular System: The Blood. Copyright 2009, John Wiley & Sons, Inc. Chapter 19: The Cardiovascular System: The Blood Blood Liquid connective tissue 1. Transportation - Gases, nutrients, hormones, and waste. 2. Regulation - ph, body temperature, and blood pressure. 3. Protection

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

Australian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1

Australian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1 Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after

More information

NOTES: CH 43, part 1 The Immune System - Nonspecific & Specific Defenses ( )

NOTES: CH 43, part 1 The Immune System - Nonspecific & Specific Defenses ( ) NOTES: CH 43, part 1 The Immune System - Nonspecific & Specific Defenses (43.1-43.2) The lymphatic system is closely associated with the cardiovascular system. LYMPHATIC PATHWAYS Lymphatic capillaries

More information

Investigation Into Haematological Characteristics Of Parasite Infested Farmed African Catfish At Owerri North L.G.A, IMO State

Investigation Into Haematological Characteristics Of Parasite Infested Farmed African Catfish At Owerri North L.G.A, IMO State AGRICULTURE AND BIOLOGY JOURNAL OF NORTH AMERICA ISSN Print: 2151-7517, ISSN Online: 2151-7525, doi:10.5251/abjna.2017.8.5. 187.192 2017, ScienceHuβ, http://www.scihub.org/abjna Investigation Into Haematological

More information

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:

More information

Components of the Blood

Components of the Blood Bởi: OpenStaxCollege Hemoglobin is responsible for distributing oxygen, and to a lesser extent, carbon dioxide, throughout the circulatory systems of humans, vertebrates, and many invertebrates. The blood

More information

Blood Physiology. Rodolfo T. Rafael, M.D.,CFP

Blood Physiology. Rodolfo T. Rafael, M.D.,CFP Blood Physiology Rodolfo T. Rafael, M.D.,CFP http://clinical-updates.blogspot.com rtrafaelmd@gmail.com +639212147558 July 26, 2006 1 Blood Physiology General Consideration Plasma Cellular Elements of the

More information

Uncorrected Proofs. Original Article. Effect of cassava based diet on some heamatological parameters in albino rats fed petroleum contaminated diet

Uncorrected Proofs. Original Article. Effect of cassava based diet on some heamatological parameters in albino rats fed petroleum contaminated diet International Journal of Applied Research in Natural Products Vol. 5 (1), pp. 22-26. April-May 2012 Directory of Open Access Journals 2012. IJARNP-HS Publication Original Article Effect of cassava based

More information

PNH Glossary of Terms

PNH Glossary of Terms AA Absolute neutrophil count Alendronate Allergen ALT Anemia Antibodies Anticoagulant Anticoagulation Antigen Antithymocyte globulin (ATG) Aplastic Aplastic anemia Band Bilirubin Blast cells Bone marrow

More information

The Cardiovascular System: Blood

The Cardiovascular System: Blood C h a p t e r 11 The Cardiovascular System: Blood PowerPoint Lecture Slides prepared by Jason LaPres Lone Star College - North Harris Introduction to the Cardiovascular System A circulating transport system

More information

Effects of Omega-3 Fatty Acids in Fish Feeds on Haematological Profile of Heterobranchus bidorsalis (Geoffrey St. Hillaire, 1809)

Effects of Omega-3 Fatty Acids in Fish Feeds on Haematological Profile of Heterobranchus bidorsalis (Geoffrey St. Hillaire, 1809) J. Agric. Food. Tech., 1(3) 6-30, 011 010, TextRoad Publication ISSN 090 44X Journal of Agriculture and Food Technology www.textroad.com Effects of Omega-3 Fatty Acids in Fish Feeds on Profile of Heterobranchus

More information

Blood. BIOLOGY OF HUMANS Concepts, Applications, and Issues. Judith Goodenough Betty McGuire

Blood. BIOLOGY OF HUMANS Concepts, Applications, and Issues. Judith Goodenough Betty McGuire BIOLOGY OF HUMANS Concepts, Applications, and Issues Fifth Edition Judith Goodenough Betty McGuire 11 Blood Lecture Presentation Anne Gasc Hawaii Pacific University and University of Hawaii Honolulu Community

More information

EFFECT OF CYPERMETHRIN ON LIPID LEVEL OF FRESHWATER CRAB P. JACQUEMONTII HEPATOPANCREAS AND MUSCLE

EFFECT OF CYPERMETHRIN ON LIPID LEVEL OF FRESHWATER CRAB P. JACQUEMONTII HEPATOPANCREAS AND MUSCLE EFFECT OF CYPERMETHRIN ON LIPID LEVEL OF FRESHWATER CRAB P. JACQUEMONTII HEPATOPANCREAS AND MUSCLE Parate S K Department of Zoology, B. B. Arts, N. B. Commerce and B.P. Science College Digras, Dist. Yavatmal-445203

More information

Acute and sub-acute toxicity studies of methanol leaf extracts of Annona squamosa linn. in mice

Acute and sub-acute toxicity studies of methanol leaf extracts of Annona squamosa linn. in mice Sky Journal of Biochemistry Research Vol. 3(7), pp. 053 059, October, 2014 Available online http://www.skyjournals.org/sjbr ISSN 2315-8786 2014 Sky Journals Full Length Research Paper Acute and sub-acute

More information