SediVue Dx Urine Sediment Analyser. Fresh samples / Revolutionary technology / A new standard of care. The Complete Diagnostic Solution
|
|
- Bennett Eaton
- 6 years ago
- Views:
Transcription
1 SediVue Dx Urine Sediment Analyser Fresh samples / Revolutionary technology / A new standard of care
2 SediVue Dx Urine Sediment Analyser Improving the standard of care Automation ensures consistent, accurate results from only 165 μl (4 5 drops) of urine. Examines the equivalent of 45 high-power fields in approximately 3 minutes to thoroughly analyse each sample. Leveraging cutting-edge convolutional neural network technology to identify and classify elements within the sediment. Produces high-resolution, high-contrast digital images from a fresh sample, for dependable results that can be shared in real time. Results for the most clinically relevant elements in canine and feline urine to support preventive, acute, and chronic care. Dimensions and weight Width: 32 cm (320 mm) Depth: 32 cm (320 mm) Height: 34 cm (340 mm) Weight: 15 kg
3 Powered by three cutting-edge technologies Conventional centrifugation 2,000 RCF* SediVue Dx Urine Sediment Analyser 260 RCF* Precision centrifugation for preservation of fragile structures The onboard gravitational centrifuge spins at a significantly lower force than most in-house centrifuges to preserve delicate casts. Spins for precisely 30 seconds to gently deposit formed elements into a monolayer at the bottom of the cartridge. Inverted microscopy for optimal evaluation of the monolayer Utilises the gold standard microscopy technique for urine sediment evaluation. Examines the equivalent of 45 high-power fields from beneath the sample to maximize visibility of clinically relevant elements. Captures 70 high-resolution images using the latest in high speed digital camera technology. Autofocuses on each shot for crisp images. Adjusts exposure with each image to ensure optimal contrast. Convolutional neural network for the identification of elements This artificial intelligence is specially calibrated to identify, classify and count the elements present in each sample. Uses a proprietary image processing algorithm similar to facial recognition software. Trained for consistent and sensitive recognition of clinically relevant particles, and to discern them from debris. The algorithm prioritises the images based on the medical importance of the formed elements observed. *Relative centrifugal force.
4 Results for most clinically relevant elements Cells Bacteria Casts Crystals Blood cells Red blood cells (RBCs) White blood cells (WBCs) Epithelial cells Squamous (originating from the distral urethra or beyond) Nonsquamous (originating from locations above and including the bladder e.g. Transitional cells) Rods Cocci Hyaline Nonhyaline (e.g., cellular casts, granular casts) Struvite (coffin lids) Calcium oxalate dihydrate (Scottish flags) Unclassified (all other crystals) High-resolution, high-contrast images with tools for enhanced viewing Zoom in and out for a more detailed view of elements. Tagging can be turned on as required to help identify cells, casts and crystals.
5 Perform all 3 parts of a Complete Urinalysis faster and with greater accuracy than ever before With IDEXX all this happens in 3 minutes Sediment analysis with SediVue Dx Chemical analysis with VetLab UA Analyser Pipette 165 μl urine 2 mins Dispense urine onto IDEXX UA strip. Insert strip in IDEXX VetLab UA Analyser. Press start button and walk away 3 mins Dispense sample Physical analysis conducted as normal Enter physical findings in the IDEXX VetLab station Press start button and walk away 1 min Identify when deeper insights are needed. Confidently send away for specialised testing. IDEXX SDMA IDEXX Advantage programs Rapid & Accurate Microbiology *Times indicated above are a guide only and are representative for the analysis of a typical sample.
6 A smart solution for challenging samples SediVue Dx automatically generates alerts and messages to prompt further review or action when samples are overcrowded or include suspect elements. Examples of sample dilution messages Overlapping cells, crystals, or debris. Examples of bacteria messages Review images to classify elements. Re-run using equal parts sample:diluent Review images to confirm bacteria visually Review images to confirm bacteria visually IDEXX Support Our customer support team are available to answer any questions related to your results, simply call (option 2, option 2). Our professional services team are available to provide written or verbal interpretation of results, simply call to find out more.
7 Offering diagnostic insights in real-time Providing evidence for pet owners and opportunities for consensus Here are some real world examples of how the SediVue Dx has enhanced clinical investigations. Observed elements in the sediment using the SediVue Dx What was the outcome facilitated by the SediVue Dx analysis? Red blood cells, white blood cells, and bacteria rods Confirmed urinary tract infection even before the patient exhibited clinical signs. Calcium oxalate dihydrate crystals Alerted to the possibility of kidney stones, triggering an ultrasound. The presence of uroliths on ultrasound determined that surgical removal was necessary. Numerous casts Identified kidney injury and a follow up with an IDEXX SDMA test and UPC. Nonsquamous epithelial cells Follow up with stained, cytological slide preparation and further classified cells as transitional cell carcinoma.
8 - AUS Integrated solutions for better medicine and an enhanced client experience Timely analysis of a fresh sample is the GOLD Standard, and only IDEXX delivers lab based technology for an accurate and comprehensive patient report in 15 minutes. Client: Hunt, Tina (23189) Patient Name: Kaiser Species: Canine Breed: German Shepherd Gender: Male / Castrated Weight: 35kg Age: 8 years Doctor: Smith, Susan Avenue Veterinary Hospital 12 The Avenue, Sydney NSW 2000 Test Results Reference Interval LOW NORMAL HIGH LaserCyte 14/05/2010 3:57 PM 1/12/2009 1:11 PM RBC HCT HGB MCV MCH MCHC RDW %RETIC RETIC WBC %NEU %LYM %MONO %EOS %BASO NEU LYM MONO EOS BASO PLT MPV PDW PCT 4.09 x10^12/l LOW 29.2 % LOW 8.9 g/dl LOW 71.4 fl pg 30.5 g/dl 19.2 % HIGH 3.6 % K/μL x10^9/l HIGH 80.8 % 3.3 % 15.3 % 0.3 % 0.3 % x10^9/l HIGH 0.84 x10^9/l 3.89 x10^9/l HIGH 0.08 x10^9/l LOW 0.08 x10^9/l 120 K/μL LOW fl 19.3 % 0.3 % ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) Catalyst Dx 14/05/2010 3:57 PM 1/12/2009 1:11 PM GLU BUN CREA PHOS BUN/CREA Ca TP ALB GLOB ALB/GLOB ALT ALKP GGT TBIL CHOL AMYL LIPA 6.10 mmol/l 8.9 mmol/l 150 μmol/l 2.10 mmol/l mmol/l 55 g/l 23 g/l 32 g/l U/L 480 U/L 10 U/L 8.6 μmol/l 6.63 mmol/l 707 U/L 365 U/L HIGH HIGH HIGH ( ) ( ) (44 159) ( ) ( ) (52 82) (23 40) (25 45) (10 100) (23 212) (0 7) ( ) ( ) ( ) ( ) Integrated patient report Comprehensive Chemistry Analysis with TT4 A CBC with absolute reticulocyte count Urine sediment analysis Urine chemistry analysis Physical analysis of the urine minutes minutes minutes minutes minute
9 Connected solutions to support your clinical decision making IDEXX VetConnect PLUS provides quick and convenient access to all your diagnostic information for a timely, informed, and confident assessment of patient health. Stay up to date on every case for better patient care and more responsive client service The personalized IDEXX VetConnect PLUS mobile app for iphone or Android devices instantly alerts you when a patient s results are available. Quickly and easily access complete diagnostic information anytime, anywhere. View combined historical diagnostic results anywhere, anytime Easily access digital images and results from IDEXX inhouse analysers and IDEXX SNAP point-of-care tests as well as diagnostic test results and pathology imaging results from IDEXX Reference Laboratories. Quickly spot abnormalities with easy-tointerpret images, graphs, and side-by-side past and current diagnostic result comparisons Simply share a patient s diagnostic results with other practices, specialists or your clients Easily link patients results with other practices and/or referring specialists.
10 The SediVue Dx enables the minimum database to be obtained within the consult period A full chemistry profile including electrolytes, a complete blood count (CBC), and a complete urinalysis (physical examination, chemical examination, and sediment examination) should be part of the minimum database for a wide range of signalments and preventive care cases. A complete urinalysis (physical examination, chemical examination, and sediment examination) provides insight that a blood chemistry or CBC alone may miss. That s why a complete urinalysis is a valuable diagnostic for patients.
11 For general information about anaemia, dehydration, inflammation and infection. For specific information about the underlying health of the kidney, liver and pancreas. Complete Blood Count Modern Chemistry Panel Complete Urinalysis Disease Specific Tests For assessment of kidneys and urinary tract. For accurate interpretation of Complete Blood Count, Chemistry and Electrolytes. For critical information about the metabolic status of the patient.
12 IDEXX Laboratories Pty Ltd. Unit 6 / South St Rydalmere NSW IDEXX Laboratories, Inc. All rights reserved iphone is a trademark of Apple Inc., registered in the United States and other countries. Android is a trademark of Google Inc. All other /TM marks are owned by IDEXX Laboratories, Inc. or its affiliates in the United States and/or other countries. The IDEXX Privacy Policy is available at idexx.com.
SediVue Dx Urine Sediment Analyzer. Revolutionary urinalysis. Load-and-go efficiency. High-resolution digital images.
SediVue Dx Urine Sediment Analyzer Revolutionary urinalysis. Load-and-go efficiency. High-resolution digital images. SediVue Dx Urine Sediment Analyzer The new standard for urine sediment analysis Results
More informationColor: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
More informationHM5. Hematology Analyzer BETTER. ACTUALLY.
HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter
More informationAdvanced Hematology Five-Part Differential. Simple Operation
HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior
More informationMeet Moxie. Moxie looks great. Looks can be deceiving. Moxie is visible through die-cut.
Practice what s possible with support from IDEXX Focused on veterinary practices For over 20 years, IDEXX has been a pet health company dedicated to serving you and your staff. The industry s broadest
More informationColor: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.
5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC
More informationNOTE: This table will be discontinued after this lot.
AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6
More informationDate By Code Description Qty (Variance) Photo
Shield Stone Pet Hospital 1610 East Shields Avenue Fresno, CA 93704 559-222-2800 Patient Chart Printed: 08-09-18 at 12:21p CLIENT INFORMATION Name JOSE SILVA (12823) Address 3940 N MAROA FRESNO, CA 93704
More informationYOUR COMPLETE VETERINARY SUPPLY AND SUPPORT SOLUTION CATALOGUE
YOUR COMPLETE VETERINARY SUPPLY AND SUPPORT SOLUTION CATALOGUE ABOUT EUROVETS EUROVETS IS YOUR COMPLETE VETERINARY SUPPLY & SUPPORT SOLUTION Eurovets, established in 2001 has become the Middle East's foremost
More informationCELL-DYN 3700 Strength in Technology, Proven Reliability
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationCELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Veterinary Emergency and Critical Care Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours
More informationAbaxis Piccolo xpress TM
Abaxis Piccolo xpress TM A breakthrough in point-of care diagnostics A breakthrough in point of care diagnostics Fast, easy, accurate on-site testing The Piccolo xpress TM is a fully automated system,
More informationThe Minimum Diagnostic Database: Urinalysis
The Minimum Diagnostic Database: Urinalysis Jeff Niziolek, DVM Professional Services Veterinarian IDEXX Laboratories, Inc. 208 Bay Meadows Drive Holland, MI 49424 The minimum database includes three types
More informationGuide to the 1-3 Minute Blood Film Microscopic Review: Why and How?
Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary
More informationGENERAL URINE EXAMINATION (URINE ANALYSIS)
GENERAL URINE EXAMINATION (URINE ANALYSIS) Physiology Lab-8 December, 2018 Lect. Asst. Zakariya A. Mahdi MSc Pharmacology Background Urine (from Latin Urina,) is a typically sterile liquid by-product of
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationthe wait is over... screen for endocrine disorders in as little as 6 minutes
the wait is over... screen for endocrine disorders in as little as 6 minutes IDEXX SNAP Reader Quantitative results for T 4 and cortisol Finally, you can screen T 4 and cortisol levels on all symptomatic
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationPresented by: Dr. Giuseppe Molinaro Dr. Davide De Biase
Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationDate Time By Code Description Qty (Variance) Photo
Adobe Animal Hospital 6331 Haven Ave., Suite 4 Rancho Cucamonga, CA 91737 909-483-3535 Patient Chart Printed: 03-16-17 at 9:44a CLIENT INFORMATION Name Ms. Amanda Barber (1394) Address 10850 Church St.
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationBLOOD IS COMPLEX ANALYZING IT SHOULDN T BE DxH 500 * *Not available for sale in the U.S.
BLOOD IS COMPLEX ANALYZING IT SHOULDN T BE DxH 500 * *Not available for sale in the U.S. Introducing the DxH 500, an Open-vial Hematology System *. Quality 5-part Differential in a Compact Design The first
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationComplete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
More informationHematology TOONYA TURNER. IDEXX Services: Senior Profile with Heartworm -Standard CBC. RBC M/µL. Hematocrit
TOONYA TURNER PET OWNER: TURNER SPECIES: Cnine BREED: GENDER: Femle AGE: 1 Yers PATIENT ID: 17047 Fmily Pet Helth Cre 3623 Indin Hills Rod Dectur, Albm 35603 256-341-0200 ACCOUNT #: 87040 ATTENDING VET:
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationIDEXX Laboratories. Renal Disease Case Studies
IDEXX Laboratories Renal Disease Case Studies Authors Dennis DeNicola, DVM, PhD, DACVP Chief Veterinary Educator, Clinical Pathologist, IDEXX Laboratories Dr. DeNicola completed his DVM in 1978 and his
More informationA. SAP is the D-Lab's name for a specific set of serum biochemical tests.
Understanding CBC, SAP, UA/Laura J. Steadman, DVM I. CBC - Complete Blood Count A. Three major types of cells are counted 1. Red Blood Cells 2. White Blood Cells 3. Platelets B. Cells are counted at the
More informationInvestigating the recheck rules for urine analysis in children
Investigating the recheck rules for urine analysis in children Y.M. He*, S.W. Yao*, Y.J. Huang, B.S. Liang and H.Y. Liu Clinical Laboratory, Guangzhou Women and Children s Medical Center, Guangzhou Medical
More informationINFECTION/ INFLAMMATION
HAEMATOLOGY OCTOBER 2017* WHITE PAPER INFECTION/ INFLAMMATION Novel haematological parameters for rapidly monitoring the immune system response Patients with inflammatory disease are common on hospital
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationA Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL
More information3. Blood Cell Histograms:
LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationApplication Note. Light Microscopic Analysis of Urine ZEISS Primo Star and ZEISS Axio Lab.A1
Application Note Light Microscopic Analysis of Urine ZEISS Primo Star and ZEISS Axio Lab.A1 Application Note Light Microscopic Analysis of Urine ZEISS Primo Star and ZEISS Axio Lab.A1 Author: Carl Zeiss
More informationSet-up and special features
Set-up and special features Set Time 2 : 45 Set Date 23 Apr 202 Choose to keep your Verio IQ simple or customise it to your desire with its various features Alerts On Of f Please set with care. In the
More informationPET CARE VETERINARY CARE CENTER 2009 W SLAUSON AVE ACCOUNT #: ATTENDING VET: ANDERSON, DVM, JOY
Text KISMET EVENTOFF PET OWNER: EVENTOFF SPECIES: Feline BREED: GENDER: Female AGE: 2 Months PATIENT ID: PET CARE VETERINARY CARE CENTER 2009 W SLAUSON AVE 323-294-4030 ACCOUNT #: 93530 ATTENDING VET:
More informationAge: 14 Houston TX 77007
Patient Medical History HEIGHTS HOSPITAL FOR ANIMALS Bernie Rogers Patient: JACK DOB: 08/26/1999 720 Courtlandt St. Species: FELINE Age: 14 Houston TX 77007 Breed: Domestic Shorthair Sex: MN Color: Black
More informationLight yellow to dark golden yellow Clear ph range Specific gravity Sediments
#11 Objectives: Understand specific gravity and identify normal specific gravity values for urine Learn to use a urine hydrometer to measure specific gravity Define specific gravity and identify normal
More informationKathleen Finnegan MS MT(ASCP)SHCM
Kathleen Finnegan MS MT(ASCP)SHCM Discuss the history of hematology automation and digital differentials. Discuss the HemoFAXS Hematology Analysis System by Tissue Gnostics. Review automated microscopy
More informationIt s not just water! What is Urinalysis?
It s not just water! An introduction to Urinalysis What is Urinalysis? Urinalysis or the analysis of urine is one of the oldest laboratory procedures in the practice of medicine. It is a good test for
More informatione-figure 1. The design of the study.
e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Veterinary Emergency and Critical Care Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours
More informationKoostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev
Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte
More informationFold out for normal dot plot comparison
Fold out for normal dot plot comparison IDEXX Laboratories Ltd. Milton Court, Churchfield Road Chalfont St Peter, Buckinghamshire SL9 9EW, UK www.idexx.co.uk 28 IDEXX Laboratories, Inc. All rights reserved.
More informationIDEXX Catalyst One Chemistry Analyzer for In-house Measurement of Total Thyroxine (TT 4 ) Concentration in Serum from Dogs and Cats
IDEXX Catalyst One Chemistry Analyzer for In-house Measurement of Total Thyroxine (TT 4 ) Concentration in Serum from Dogs and Cats Authors: Kate Cote, Ph.D., Graham Bilbrough, MA, VetMB, CertVA, MRCVS,
More informationPart No. J04498 Cat No Performance Verifiers: Training Module
Cat No. 680 0325 : Training Module Export authorized under general license GTDA (General Technical Data Available) IMPORTANT The information contained herein is based on the experience and knowledge relating
More informationi. Where is the participant seen?
PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant
More informationAustralian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationSystem overview Installation System Description System Default Settings and Loading I-Button Tests Components/Kits /Accessories Maintenance & Cleaning
SQA-VISION TRAINING Content of Presentation System overview Installation System Description System Default Settings and Loading I-Button Tests Components/Kits /Accessories Maintenance & Cleaning SQA-Vision
More informationAVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC)
AVCPT FMULA GUIDE HEMATOLOGY Test Formula Example Mean Corpuscular Volume (MCV) PCV x RBC = MCV (fl) Patient Information: RBC = 7.50 x 6 /µl 45 x 7.50 = 60.0 fl MCV = 60.0 fl Mean Corpuscular Hemoglobin
More informationURGENT FIELD SAFEY NOTICE
April x, 2015 URGENT FIELD SAFETY NOTICE Software Anomaly using VITROS 5,1 FS Chemistry Systems Dear Customer, As part of a Field Safety Corrective Action, the purpose of this notification is to inform
More informationVITROS MicroSlide Assay Summary
ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670
More informationLABORATORY 3: Microscopic Urinalysis
LABORATORY 3: Microscopic Urinalysis Objectives Upon completion of this laboratory exercise, the student will be able to: 1. Perform microscopic examinations on a minimum of five urine specimens, obtaining
More informationSmart & Simple Mobile Solutions.
Higher Measuring Accuracy Smart & Simple Mobile Solutions. Test Simply. Live Better. FORA Diamond lets you connect all your Bluetooth devices. *Also available with a Micro USB. ifora Diabetes Manager All
More informationSquamous epithelial cells in urine 0-5
Toggle navigation Squamous epithelial cells in urine 0-5 13-10-2017 Finding epithelial cells in urine is a diagnostic result found during urinalysis and may raise some red flags for physicians to several
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationDirect Response Diagnostics
Direct Response Diagnostics Overview of Point-of-care Systems www.sysmex.nl www.sysmex.be Introduction Product overview/table of contents In 2003 Sysmex launched the poch-100i. It was the first Sysmex
More informationAlign Gluco-Monitoring System (BG1) Quick Start Guide
EN Align Gluco-Monitoring System (BG1) Quick Start Guide WELCOME Welcome to your ihealth Align Gluco-Monitoring System (the ihealth system). The ihealth system is designed to be used with the free ihealth
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationTable of Contents. Contour Diabetes App User Guide
Table of Contents Introduction... 3 About the CONTOUR Diabetes App... 3 System and Device Requirements... 3 Intended Use... 3 Getting Started... 3 Downloading CONTOUR... 3 Apple... 3 Android... 4 Quick
More informationFull Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory
More informationAlign Gluco-Monitoring System (BG1) Quick Start Guide
EN Align Gluco-Monitoring System (BG1) Quick Start Guide WELCOME Welcome to your ihealth Align Gluco-Monitoring System (the ihealth system). The ihealth system is designed to be used with the free ihealth
More informationHAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore
HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia
More informationVetScan UA Urine Analyzer Clinical Performance Larry Lem, PhD & Andrew Rosenfeld, DVM, ABVP
VetScan UA Urine Analyzer Clinical Performance Larry Lem, PhD & Andrew Rosenfeld, DVM, ABVP Abstract Background: The VetScan UA urine strip reader is an analyzer designed to provide semi-quantitative and
More informationLabDriver Audit Trail Example
LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: 0902168 Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009
More information& CBC Analysis. Getting the Most from the. Session 3. Foundations of Functional Blood Chemistry Analysis Session 3 Dr.
Functional Blood Chemistry & CBC Analysis Session 3 Li L:iver and Gallbladder Markers SGOT/AST, SGPT/ALT & GGTP Getting the Most from the Liver Panel http://www.fmtown.com 1 Liver Panel Reference Ranges
More informationThe inflow. Active Data Collection. The inflow Patient Support System (PSS)
The inflow Active Data Collection The inflow Patient Support System (PSS) Female Indication Urinary for Prosthesis Use inflow device Internal valve-pump Activator remote control How Indication the inflow
More informationHematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist
Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White
More informationHematuria. Ramzi El-Baroudy (ESPNT)
Hematuria Ramzi El-Baroudy (ESPNT) Hematuria is the presence of RBCs in urine. If the amount of blood in urine is big enough, the urine will, then, look red. Something which is, undoubtedly, terrifying.
More informationMass Spectrometry Made Simple for Clinical Diagnostic Labs
Mass Spectrometry Made Simple for Clinical Diagnostic Labs The SCIEX Topaz System with FDA-Cleared Topaz Vitamin D 200M Assay Kit Mass Spectrometry Made Simple SCIEX Topaz System for Clinical Diagnostics
More informationThe Minimum Diagnostic Database: Chemistry
The Minimum Diagnostic Database: Chemistry Jeff Niziolek, DVM Professional Services Veterinarian IDEXX Laboratories, Inc. 208 Bay Meadows Drive Holland, MI 49424 Biochemical profiling is a wide and important
More informationHYPERCALCEMIC GOLDEN RETRIEVER
Presenter: Laura Martínez 1, 2 HYPERCALCEMIC GOLDEN RETRIEVER Contributors: Laia Solano-Gallego 2, Josep Pastor 2, Alberto J. Marco 3, María Cuvertoret-Sanz 3, Rosa Novellas 1,2, Anna Vila 1, 2, Xavier
More informationCare for Patients Wherever They Are, Wherever You Are.
Care for Patients Wherever They Are, Wherever You Are. Patients want the latest healthcare technology with the least impact on their daily lives. The AliveCor System helps you to partner with your patients
More informationSeptember Focus: In-House vs. Reference Lab Testing, Part II
SEPTEMBER, 2011 September Focus: In-House vs. Reference Lab Testing, Part II We hope you enjoy this issue of ANTECH Insights. Please pass it along! In our July issue of ANTECH Insights, we examined the
More informationTRUE Meter Guide. Accurate and precise results for managing your diabetes effectively and affordably. because it fits your lifestyle!
TRUE Meter Guide Accurate and precise results for managing your diabetes effectively and affordably because it fits your lifestyle! Choosing the right TRUE meter to fit your needs and lifestyle... TRUE
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationLavender Top Management SUCCESS BEYOND FINANCES
Lavender Top Management Alfonso Ziccardi Ass.Lab.Operation Manager for AP/CP/Safety Officer New York Hospital Medical Center of Queens SUCCESS BEYOND FINANCES 1 . VISION Mission/ Vision To successfully
More informationScoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens
Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated
More informationData Management System (DMS) User Guide
Data Management System (DMS) User Guide Eversense and the Eversense logo are trademarks of Senseonics, Incorporated. Other brands and their products are trademarks or registered trademarks of their respective
More informationSpecimen / Instructions. 2mls Serum, 1 LTT ACTH Stim, Aldosterone, Prog, Androst., Estrod.
Test Name Test Number Specimen / Instructions Turn Around Time int. codes Adrenal Panel (UT) 621 2mls Serum, 1 LTT ACTH Stim, Aldosterone, Prog, Androst., Estrod. 7-10 Days Allergen Panel A 922A 40 Customized
More informationLavender Top Management SUCCESS BEYOND FINANCES. Mission/ Vision
Lavender Top Management Alfonso Ziccardi Lab.Operation Manager for AP/CP/Safety Officer New York Hospital Medical Center of Queens SUCCESS BEYOND FINANCES Mission/ Vision. VISION To successfully develop
More informationQuick Reference Guide. Sensor Smart Transmitter Mobile App
Quick Reference Guide Sensor Smart Transmitter Mobile App Refer to the Eversense CGM User Guide for more detailed information. For a Spanish version of the User Guide and Quick Reference Guide, please
More informationVIA ELECTRONIC MAIL ONLY MICHAEL LANGAN, M.D. December 28, 2012
JACOB HAFTER, Esq. jhafter@hafterlaw.com Admitted to Practice Law in Nevada, Pennsylvania, New Jersey, and before the U.S. Patent & Trademark Office VIA ELECTRONIC MAIL ONLY Robert Harvey, Esq. Physician
More informationBiodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery
Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing
More informationLABORATORY 5: The Complete Urinalysis
LABORATORY 5: The Complete Urinalysis Notes 1. This lab combines the objectives and activities of the macroscopic and microscopic lab activities. Students are expected to review those labs for reference.
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationEvaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube
Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated
More informationGlucose Meter. User Guide. Veterinary Monitoring System. For dog and cat use only
Glucose Meter User Guide Veterinary Monitoring System For dog and cat use only Gpet instruction Manual 31/5/09 18:06 Page 2 Gpet instruction Manual 31/5/09 18:06 Page 3 TABLE OF CONTENTS Your g-pet system
More informationCase Log Number(s) Veterinarian or VTS Accurately report test results, using appropriate units of measurement Quality Control/Assurance Date Mastered
AVCPT Skills List Candidate: Understanding of test methodology, techniques and ability to perform testing must be applied to each skill. The overall goal is to provide accurate and valid results to assist
More informationBest practices for a successful wellness screening program
Health & Wellness Best practices for a successful wellness screening program Identify risk. Increase engagement. Incite change. Identifying health risks in your employee population People at risk for chronic
More informationXN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016
XN series Case interpretation Gebruikersdag Vlaanderen- 6 oktober 2016 Fluorescence flow cytometry RET channel PLT-F channel WDF channel WPC channel WNR channel Case 1 Case 1: Initial measurement Patient
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More information