Ph ton. The Journal of Toxicology and Health. Subchronic toxicological effects of pea protein isolate (nutralys) on wistar rats: A ninety-day dietary
|
|
- Rosamond Hawkins
- 6 years ago
- Views:
Transcription
1 he Journal of oxicology and Health. Photon ( - Original Research Article. ISJN: - he Journal of oxicology and Health Ph ton Subchronic toxicological effects of pea protein isolate (nutralys on wistar rats: A ninety-day dietary Chentouf Aouatif a, Philippe Looten a, Srinivasan M b*, Srinivas A b, Yogeshkumar V. Murkunde b a Biology and Nutrition Department, oxicology Service, Roquette Freres, Lestrem, France b International Institute of Biotechnology and oxicology (IIBA, Padappai-, amil Nadu, India Article history: Received: March, Accepted: March, Available online: August, Keywords: Pea Protein Isolate (Nutralys, subchronic toxicity, dietary,, NOAEL Abbreviations: OECD: Organization for Economic Co-operation and Development, No Observed Adverse Effect Level (NOAE Corresponding Author: Dr. Srinivasan M.* Senior Scientist sini@sify.com Phone: (o + - Dr. Chentouf Aouatif Senior Scientist aouatif.chentouf@roquette.com Phone: (o ( Philippe Looten oxicologist Phone: (o ( Dr. Srinivas A. Senior Scientist srinivas@iibat.com Phone: (o + -. Introduction Pea Protein Isolate (Nutralys is a water extract of dry pea (Pisum Sativum manufactured by Roquette in our Vic sur Aisne plant (located in Northern Paris. his product is spray-dried and granulated to ensure easy blending and use in food processing and is widely used for maintaining an ideal body weight. Proteins are nitrogen- containing substances that are formed by amino acids. hey serve as the major structural component of muscle and other tissues in the body. In addition, they are used to produce hormones, enzymes and hemoglobin. Proteins can also Dr. Yogeshkumar V. Murkunde HOD Yogeshkumar@iibat.com Phone: (o + - Abstract Pea protein isolate is a derivative of vegetable that has been used as a nutrient in foods. Since no information has been published about the safety of Pea protein isolate (Food Grade by Roquette Frères, a -day feeding study was conducted, using Wistar rats of either sex as experimental animals. Rats fed with dietary levels of low ( ppm, intermediate ( ppm and high ( ppm Pea protein isolate for days did not reveal any induced toxicological changes as their clinical signs, body weights, food consumption, water consumption, hematological, blood biochemical and urinalysis were comparable with concurrent control animals. Further, organ weights, gross and histological examinations did not reveal any systemic toxicity induced by Pea Protein consumption. aken together, under the current experimental conditions, the oral diet No Observed Adverse Effect Level (NOAE of Pea Protein Isolate for males and female rats were found to be % (equivalent to mg/kg b.w. for male rats and mg/kg b.w. for female rats respectively. Citation: Aouatif C., Looten P., Srinivasan M., Srinivas A., Murkunde Y.V.,. Subchronic toxicological effects of pea protein isolate (nutralys on wistar rats: A ninety-day dietary. he Journal of oxicology and Health. Photon, -. be used for energy; however, they are not the primary choice as an energy source. For proteins to be used by the body, they need to be metabolized into their simplest form, amino acids. here have been amino acids identified that are needed for human growth and metabolism. welve of these amino acids (eleven in children are termed nonessential, meaning that they can be synthesized by our body and do not need to be consumed in the diet (Hoffman and Michael,. he remaining amino acids cannot be synthesized in the body and are described as essential: Ph ton
2 meaning that they need to be consumed in our diets. he absence of any of these amino acids will compromise the ability of tissue growth, or its ability to repair or maintain. Pea Protein Isolate is composed of all essential amino acids and is recommended as a dietary supplement to compensate the daily protein requirements of the human body. As like any other commercial dietary product, extensive toxicological potential of the respective product needs to be evaluated before its use by humans. Hence in the current study, we have assessed the sub chronic toxic effect of Pea Protein Isolate when administered as a diet supplement for a period of days in Wistar rats as animal model. his study was conducted as per OECD est Guidelines number. Prior approval of Institutional Animal Ethics Committee (IAEC was obtained before the commencement of these in vivo studies at International Institute of Biotechnology and oxicology (IIBA, Chennai, India.. Materials and Methods he present study was conducted in accordance with the OECD Guideline for the esting of Chemicals, Repeated Dose -day Oral oxicity study in Rodents, (No., Adopted: st September,... Preparation of diet and stability of Pea Protein Isolate (Nutralys, in the diet Pea Protein Isolate (Nutralys manufactured and supplied by Roquette Freres, France is a high quality white powder source food grade with % Pea Protein content, extracted in water. o administer this Pea Protein via diet, it was minced to fine powder and mixed with Standard gamma irradiated diet supplied by M/s. etragon Chemie Pvt. Ltd., Bangalore, India, to the final feed formulations of., and w/w%. he stability of this pea protein in diet was examined periodically throughout the duration of the study. he Pea Protein Isolate (Nutralys, has shown to be very stable in the formulated diet. Homogeneity of Pea protein isolate (Nutralys, in the diet was found to be % and was maintained throughout the duration of the study... Animal husbandry One hundred and twenty healthy Wistar (Crl: WI rats of either sex aged - weeks were obtained from the animal house facility, IIBA during the year. Females used in the study were nulliparous and non pregnant. Animals were allowed to adapt to the animal room conditions for a week before the initiation of the study. Every five animals of the same sex were housed in stainless steel cages under controlled environmental conditions (temperature ±. C, humidity ±% and a h light/dark cycle. Pea Protein mixed diet and reverse osmosis water were available ad libitum... Objective of Research o find the sub chronic dietary toxicity (NOAE of the Pea Protein Isolate (Nutralys in Wistar rats and according to the OECD est Guideline and understand the mechanisms of toxicity if any, induced by Pea Protein Isolate (Nutralys... Study Design After acclimation, animals were randomly distributed, into six groups (consisting of males and females per group namely G - control, G - Low ( ppm, G - Intermediate ( ppm, G - ( ppm, G - control and G - high ( ppm. he test substance was administered daily by admixture with the diet for a period of days to the G, G, G and G animal groups. group (G and satellite control group (G of rats were similarly treated but without the test substance. Rats in satellite groups were given only diet without the test item for an additional days to evaluate any possible withdrawal effects. hey were individually observed once daily for clinical signs. Body weight of the animals was measured once weekly. Food intake and water of the animals were measured once daily and reported weekly... Hematological and biochemical Examination Following a ninety-day feeding, the animals were fasted overnight for h prior to the scheduled blood collection. hey were anesthetized with CO and about ml of blood was collected per animal from the retro-orbital venous plexus into pre-labelled EDA and heparinized vials for hematological and biochemical analysis respectively. Hematology analysis includes erythrocytes, hemoglobin, hematocrit, mean cell volume (MCV, mean carpuscular hemoglobin (MCH, mean carpuscular haemoglobin concentration (MCHC, platelet count, leukocytes and leukocyte differential count analyzed by using fully automated hematology analyzer (Advia, Siemens, USA. Prothrombin time was done by hromborel-s method and clotting time was done by capillary tube method. Ph ton
3 Heparinized plasma used for biochemical analysis was obtained by centrifugation at x g for min. Biochemical analysis includes glucose, urea, creatinine, total cholesterol, triglycerides, aspartate transaminase (AS, alanine transaminase (AL, alkaline phosphatase (ALP, total protein, albumin, calcium and phosphorus analyzed by using fully automated biochemistry analyzer (Dimension Xpand plus, Siemens, USA. Serum electrolytes (sodium and potassium were assayed using electrolyte analyzer (Humalyte, Human GmbH and Germany... Gross and Histopathology At autopsy, the liver, kidneys, adrenals, testes, epididymides, uterus, ovaries, thymus, spleen, brain and heart were removed and weighed. In addition, the liver, spleen, lungs, heart, aorta, kidneys, adrenals, brain, pituitary, trachea, thyroid, parathyroid, oesophagus, small intestine, large intestine, salivary glands, lymph nodes (Mandibular and mesenteric, spinal cord, thymus, stomach, pancreas, ovaries, uterus, accessory sex organs, female mammary gland, prostate, urinary bladder, peripheral nerve (Sciatic, bone marrow (sternum, skin were collected from all animals and preserved in % neutral buffered formalin, except testis, which was preserved in Modified Davidson s for hours and transferred in to % buffered formalin after minutes washing in running tap water. he lungs were inflated with % neutral buffered formalin before preservation. he organs were processed in vacuum infiltration tissue processor (Sakura issue-ek VIP M, Japan, embedded (Sakura issue-ek EC M, Japan with paraffin wax, sectioned (Microm GmbH, Germany at approximately µm thick, stained (Leica S Autostainer, Germany with hematoxylin and eosin, evaluated through light microscopy (Nikon i, Japan and images were captured through an image analyzer (Q Imaging systems, Canada. he identity and analysis of the pathology slides were blind to the pathologist... Statistical methods Body weight, food consumption, hematology, clinical biochemistry and organ weights were subjected for Modified-levene equal-variance test for homogeneity. Homogenous data was submitted to Analysis of Variance (ANOVA followed by Student-Newman-Keul s test for post hoc comparison. If the data is heterogeneous it was subjected to nonparametric tests (NCSS, statistical software. Differences were considered to be significant when P value was less than... Results and Discussion he aim of the present study was to evaluate the safety of Pea Protein Isolate (Nutralys using a sub chronic toxicity study design. he in vivo toxicity studies are usually divided into four categories: acute, subacute, subchronic and chronic. Acute exposure is defined as exposure to a chemical for less than h and usually used for labeling and classification purpose. Subacute and sub chronic toxicity studies refers to repeated exposure to a chemical for in rodent or non rodent species generally for a period of days, days and more than three months respectively. hese studies are usually performed to attain NOAEL concentrations of the test compound at the respective duration period. Lack of sub chronic toxicity information of Pea Protein Isolate, which is used as a part of food supplement, stimulated us to conduct the current study in Wistar rats by oral route. Data obtained from this study can contribute substantially to the scientific fraternity, to understand the toxicity mechanisms of Pea Protein if any. he OECD Guidelines for esting of Chemicals, Section ( and United States Environmental Protection Agency Health Effects est Guidelines are preferred the rat as the standard rodent species. We need to evaluate the safety of Pea protein isolate (Nutralys in same species. herefore, a conscientious and careful safety evaluation of Pea protein isolate (Nutralys in rat is necessary. Additionally, there is no subchronic oral toxicity report to show that Pea protein isolate (Nutralys has been studied in rats. he rat has been one of the main mammalian species used in preclinical studies ranging from pharmacology and safety assessment. he use of rats as models in safety evaluations is currently required in international guidelines for both chemicals and pharmaceuticals (Hedrich,. FDA Guidelines for oxicological Principles for the Safety Assessment of Food Ingredients, Redbook, Chapter IV.C..a ( indicated that short- term toxicity studies are conducted with rats and mice. herefore, both male and female rats, which are healthy and have not been subjected to previous experimental procedures, should be used in sub chronic toxicity study. Ph ton
4 able-: Summary of Hematology Parameters Day- Sex: Male RBC Hb HC PL WBC N L E M B LUC C P /µl (% /µl ( /µl (% (% (% (% (% (% (Sec (Sec G G Low G Intermediate G * G G Data are expressed as Mean ± S.D.(n=, ype of analysis- one-way ANOVA test at. level of significance, G- -G- =* represents the statistical difference from G - - to G - Low (p<. In the current study, no mortality or clinical signs of toxicity was observed in any of the treated animals. Body weight gain (Fig. & and feed consumption (Fig. & in pea protein administered animals were comparable with untreated animals. A statistical significant difference was observed in water consumption of high male rats on th week when compared with that in the control group. However, this change was considered to be treatment related (data not shown. Estimation of hematological assays on Day, reveal a significant increase of eosinophils in male rats and prothrombin time in female rats of low group when compared with control animals (able-. Further, significant decrease in platelets and neutrophils and increase in lymphocyte counts were observed in female rats of high group (%-able-. On day, a statistically significant change was observed in prothrombin time of satellite high (G group males (able - and large unstained cells of females (able - when compared with satellite control (G group animals. Biochemical assays on Day, showed a significant increase in triglyceride levels in all the three treated groups of female rats (able - when compared with control animals. However these increased levels of triglycerides were not observed in male rats (able -. animals were bled on day to assess the reversal effects, AS levels in male rats(able - and glucose, urea, BUN, triglycerides and potassium levels in female rats(able - were significantly higher when compared to control animals. he liver, kidneys, adrenals, testes, epididymides, uterus, ovaries, thymus, spleen, brain and heart, and relative weights of these to body weights. he absolute weight of the testes of male rats in the low group was higher when compared to the control group, whereas such an increase was not found in other treated groups. Similarly, absolute weight of the spleen of female rats in the high group was increased significantly when compared to the control group. No significant differences in any of the organs were observed on Day in any treated animals, except a significant decrease of spleen in male rats. Gross pathological examination did not reveal any Pea Protein induced changes in the groups tested of either sex. Further, no adverse histo-pathological findings were observed in any of the treated animals of either sex. Ph ton
5 able-: Summary of Hematology Parameters Day- Sex: Female RBC Hb HC PL WBC N L E M B LUC C P /µl (% /µl ( /µl (% (% (% (% (% (% (Sec (Sec G G Low G Intermediate G G G * *..*.* able - RBC /µ l Hb HC MC V Summary of Hematology Parameters Day- MCH (% (f (pg MCH C ( PL / µl WB C ( / µl N L E M B LU C C (% (% (% (% (% (% (Sec Sex : Male P (Se c G G... * Data are expressed as Mean ± S.D.(n= ype of analysis- one-way ANOVA test at. level of significance G- -G- =* represents the statistical difference from G - - to G - (p<. Data are expressed as Mean ± S.D.(n= ype of analysis- one-way ANOVA test at. level of significance G- -G- =* represents the statistical difference from G - - to G - (p< he results of the present study not only provide scientific evidences to evaluate the safety of Pea protein isolate (Nutralys, using a subchronic toxicity study design in rats, but also to find the range of Pea protein isolate (Nutralys, for the subsequent studies in rats, such as carcinogenicity study. Furthermore, this is the first time Pea protein isolate (Nutralys, has been studied in sub chronic oral toxicity in rats. observation that were attributable to Pea protein isolate (Nutralys, ingestion. Feed consumption during the study was found to be normal in wither sex. Further, a gradual increase in body weights were observed in rats fed with Pea Protein throughout the duration of the study. Similar findings were noticed by Mejia., a&b, where rats were fed with cruciferin-rich protein isolate PurateinQ for weeks. (Plass,, he also reported similar findings. During the feeding period, there were no deaths or signs of toxicity on gross Ph ton
6 able - Summary of Hematology Parameters Day- Sex : Female HC MC MC WB RBC Hb MCH PL N L E M B LUC C P V HC C ( /µl (% (f (pg ( (Sec (S /µl (% (% (% (% (% (% /µl ec G * G Data are expressed as Mean ± S.D.(n= ype of analysis- one-way ANOVA test at. level of significance G- -G- =* represents the statistical difference from G - - to G - (p<. Data are expressed as Mean ± S.D.(n= ype of analysis- one-way ANOVA test at. level of significance G- -G- =* represents the statistical difference from G - - to G - (p<. able - G G Low G Intermedia te G G G Glu Urea BUN Cre Cho ri d Summary of Clinical Biochemistry Parameters Day- AS (U/ AL (U/ ALP Pro Alb Cal (U/ Ph os GG (U/ Sex : Male * Data are expressed as Mean ± S.D.(n= ype of analysis- one-way ANOVA test at. level of significance G- -G- =Not significant(p>. G- -G- = Not significant(p>. G- -G- = Not significant(p>. G- -G- =* represents the statistical difference from G -- to G - (p<. Na m ol/ K m ol/. able - Summary of Clinical Biochemistry Parameters Day- Sex : Female Ph ton
7 G G Low G Intermed iate Glu Urea BUN Cre Cho ri AS AL ALP Pro Alb Cal (U/ (U/ (U/ * * ( Ph os GG (U/ Na m ol/ K mol / G G G * * * Data are expressed as Mean ± S.D.(n= ype of analysis- one-way ANOVA test at. level of significance G- -G- =* represents the statistical difference from G - - to G -Low (p<. G- -G- =* represents the statistical difference from G - - to G - Intemediate (p<. G- -G- =* represents the statistical difference from G - - to G - (p<. G- -G- =* represents the statistical difference from G - - to G - (p< able G G Glu Urea BUN Cre Cho ri g / Summary of Clinical Biochemistry Parameters Day- g / AS (U/L AL (U/ AL P (U/L Pro Alb Cal Phos (L (L GG (U/L Na m ol/ Sex : Male ± ± * ± ± Data are expressed as Mean ± S.D.(n= ype of analysis- one-way ANOVA test at. level of significance G- -G- =* represents the statistical difference from G - - to G - (p<. Data are expressed as Mean ± S.D.(n= ype of analysis- one-way ANOVA test at. level of significance G- -G- =* represents the statistical difference from G - - to G - (p<.. K m ol/. Ph ton
8 able Summary of Clinical Biochemistry Parameters Day- Glu Urea BUN Cre Cho ri AS AL ALP Pro Alb Cal d (U/ (U/ (U/ Ph os. G G (U /L. Sex : Female G ± ± G. * * * *. * ± ± Data are expressed as Mean ± S.D.(n= ype of analysis- one-way ANOVA test at. level of significance G- -G- =* represents the statistical difference from G - - to G - (p<. Data are expressed as Mean ± S.D.(n= ype of analysis- one-way ANOVA test at. level of significance G- -G- =* represents the statistical difference from G - - to G - (p<. Na mo l/. K mo l/. dependent manner. Further, gross and histological examinations of these animals did not reveal any abnormal findings in these organs. Ophthalmoscopic examination and data of the functional observational battery tests did not reveal any neurological toxicity induced by Pea Protein dietary administration. Further, though minor significant changes occurred with a few biochemical assays like, AS, BUN, glucose and triglycerides, these changes were not test compound dependent and overall, Pea Protein Isolate administration in rats did not alter any liver or kidney function. Similarly, no hematological alterations were observed, which suggests that these test compounds when administered as food supplement may not have any adverse effect on hemopoietic system. he absolute organ nor the relative organ weights, in Pea protein isolate (Nutralys, ingested by the rats were normal, except an increase in the absolute weight of the spleen in females and decrease of the testes organ in male rats of the high and low respectively. hese minimal alterations can be attributed to intra animal variation and can not be imparted to test compound induced toxicity as these changes are not consistent in a here were no adverse lesions observed in gross and histological examinations of other vital organs. aken together, as no adverse effects were observed in any of the rats administered with Pea Protein Isolate of different concentrations, NOAEL of this test compound in Wistar rats can be defined as, ppm of diet (equivalent to for male and for female mg/kg b.w/day under the present experimental conditions. Based on our findings, Pea Protein can be considered as non toxic when administered through diet and is recommended for oral consumption as a food supplement. Conflict of interest he authors declared no conflicts of interest. Acknowledgements he authors are grateful to the IIBA management and for Roquette Freres, France supporting for this work. We thank M. Goparaju for his cooperation in statistical analysis and O. Barathkumar for their contribution to the laboratory work.. Author s Contribution and Competing Interests All authors have equally contributed for this work. Ph ton
9 References Grice H C., Heggtveiet H.A.,. he relevance of humans of myocardial lesions induced by rats by marine and rapeseed oils. In: and low erucic rapeseed oils. Production, usage, chemisty and toxicological examinations. (Ed. J.K.G. Kramer, F.D. Sauer & W.J. Pigden Academic Press, oronto, Canada. Hedrich H.J.,(ed (. Genetic monitoring of Inbred Strains of Rats.Gustav Fischer, New York. Hoffman Michael J,.. International Society of Sports Nutrition Journal of Sports Science and Medicine., -. Mejia L.A., b. A -week dietary toxicity study in rats of a napin-rich canola protein isolate. Reg. oxicology & Pharmacology,, -. OECD Guidelines for the esting of Chemicals, No., Adopted: st September,. Plass R.,. oxicological evaluation of rapeseed products in a sub- acute feeding study in rats. Dietary Nahrung :-. Ph ton
SHRIRAM INSTITUTE FOR INDUSTRIAL RESEARCH
IN RATS SUB CHRONIC ORAL TOXICITY WITH NHH 44 Bt-COTTON SEEDS Report for: UNIVERSITY OF AGRICULTURAL SCIENCES AGRICULTURAL RESEARCH STATION DHARWAD-580007 KARNATAKA Guidelines: DBT, Guidelines for Toxicity
More informationStudy of the main chemical components of Ganoderma lucidum
Study of the main chemical components of Ganoderma lucidum Yasuo Komota et al Tokyo Medical and Dental University [Purpose] As part of the means for exerting quality control on Ganoderma lucidum 50% ethanol
More informationInternational Journal of Medicine and Health Profession Research
Research Article ISSN: 2394 7403 International Journal of Medicine and Health Profession Research Journal home page: www.ijmhpr.com TOXICITY STUDY OF VAIVILANGAM CHOORANAM E. M. Manikgantan* 1 and R. Pattarayan
More informationStudy of the main chemical components of Ganoderma lucidum
Study of the main chemical components of Ganoderma lucidum Yasuo Komota et al Tokyo Medical and Dental University [Purpose] As part of the means for exerting quality control on Ganoderma lucidum 50% ethanol
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationSummary of Feed Carcinogenicity Study. of Diphenylamine. in F344 Rats
Summary of Feed Carcinogenicity Study of Diphenylamine in F344 Rats August 2011 Japan Bioassay Research Center Japan Industrial Safety and Health Association PREFACE The tests were contracted and supported
More informationof 3-Aminophenol in B6D2F1 Mice
Summary of Drinking Water Carcinogenicity Study of 3-Aminophenol in B6D2F1 Mice July 2012 Japan Bioassay Research Center Japan Industrial Safety and Health Association PREFACE The tests were contracted
More informationBiochemical alterations induced by the acute exposure to combination of chlorpyrifos and lead in Wistar rats
Biochemical alterations induced by the acute exposure to combination of chlorpyrifos and lead in Wistar rats 1 H Krishna*, 2 AV Ramachandran 1 Dhirubhai Ambani Life Sciences Centre, Reliance Life Sciences
More informationMT09 - Normal Human Tissue Microarray, FDA
Reveal Biosciences offers Histochemical Staining, Immunohistochemistry (IHC), In Situ Hybridization (ISH), Whole Slide Imaging, and Quantitative Image Analysis on any TMA MT09 - Normal Human Tissue Microarray,
More informationIMPC phenotyping SOPs in JMC
IMPC phenotyping SOPs in JMC Tissue Embedding and Block Banking IMPC_BLK_001 Purpose Collect and fix a standard list of tissues from the complete necropsy (see IMPC Gross Pathology & Tissue Collection
More informationSummary of Inhalation Carcinogenicity Study. of Isopropyl Acetate. in F344 Rats
Summary of Inhalation Carcinogenicity Study of Isopropyl Acetate in F344 Rats March 2009 Japan Bioassay Research Center Japan Industrial Safety and Health Association PREFACE The tests were contracted
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationRoutine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationClinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine
Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA
More informationAcute and subchronic toxicity study of the water extract from Tiliacora triandra (Colebr.) Diels in rats
Songklanakarin J. Sci. Technol. 30 (5), 611-619, Sep. - Oct. 2008 http://www.sjst.psu.ac.th Original Article Acute and subchronic toxicity study of the water extract from Tiliacora triandra (Colebr.) Diels
More information-Renad Habahbeh. -Shahd Alqudah. - Saleem. 1 P a g e
-1 -Renad Habahbeh -Shahd Alqudah - Saleem 1 P a g e Introduction: *Hematology and lymph system (MLS): it is a branch of medicine concerned with the study, diagnosis, prevention and treatment of blood
More informationMulti-normal human tissues, FDA, 96 samples, 35 organs/sites from three individuals (1.5mm)
ab178228 Multi-normal human tissues, FDA, 96 samples, 35 organs/sites from three individuals (1.5mm) Instructions for Use Designed for antibody cross reactivity analysis and IHC or ISH based protein or
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationNutrition and Foods Safety Agency of the Centre for Disease Prevention and Control, People s Republic of China. Testing Report
Ministry Health approved Natural Health Products Testing Agency Issued by: Public Health Inspections, Ministry Health (1996) Publication # 53 Nutrition and Foods Safety Agency the Centre for Disease Prevention
More informationINTERNATIONAL JOURNAL OF PHYTOTHERAPY RESEARCH ISSN Research article
Research article EVALUATION OF SAFETY OF VETTUMARAN GUTIKA THROUGH SUB ACUTE TOXICITY STUDY IN WISTAR RATS Sanjaya Kumar Y.R*, Sushant S Parekar, Thamizh Selvam N, Sanal Gopi C.G and Sudarsanan Nair PK
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More information7/4/2018. Key Objectives. A and P 2401 Lecture 2 TWO MECHANISMS USED TO MAINTAIN HOMEOSTASIS. Negative Feedback Examples. Review of Homeostasis
Key Objectives Review of Homeostasis Negative Feedback Mechanisms Positive Feedback Mechanisms Body Systems and Function A and P 2401 Lecture 2 HOMEOSTASIS TWO MECHANISMS USED TO MAINTAIN HOMEOSTASIS The
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationControl Data of Rat
BrlHan:WIST@Tac(GALAS) Control Data of BrlHan:WIST@Tac(GALAS) Rat Taconic Biosciences -1- BrlHan:WIST@Tac(GALAS) Environmental Conditions and Investigation Items Environmental Conditions (Isolated Barrier
More informationAspartame induces lymphomas and leukaemias in rats Aspartame, a leukaemogenic compound
Aspartame induces lymphomas and leukaemias in rats Aspartame, a leukaemogenic compound 1 European Journal of Oncology, Vol. 10, No. 2, pp. 00-00, 2005 IN PRESS Morando Soffritti, Fiorella Belpoggi, Davide
More informationSAFETY ASPECTS OF MIDAZOLAM
Br. J. clin. Pharmac. (1983), 16, 37S-41S Biological Pharmaceutical Research Department, F. Hoffmann-La Roche & Co Ltd, CH-4002 Basle, Switzerland 1 The LD50 in the rat and the mouse is about 1600 mg/kg
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationChapter 19(1) An Introduction to the Circulatory System and Blood
Chapter 19(1) An Introduction to the Circulatory System and Blood Circulatory System VS Cardiovascular System circulatory system = heart, blood vessels and blood cardiovascular system = heart and blood
More informationOverview of Anatomy & Physiology
Overview of Anatomy & Physiology Anatomy the study of the structure of body parts and their relationships to one another Gross or macroscopic Microscopic Developmental Physiology the study of the function
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationHEMOTOLOGY. B. Helps stabilize body temperature -heats up and cools down slowly which moderates body temp
I. Body H 2 O = HEMOTOLOGY A. Variable quantities 1. sweating and urination ( ) decreases H 2 O 2. drinking H 2 O increases B. Water is found in two compartments 1. contains 2/3 of all water in your body
More informationIndividual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product:
SYNOPSIS Fresenius Title of the study: A double-blind, randomized study comparing the safety and torelance of SMOFlipid 20% and Intralipid 20% in long-term treatment with parenteral nutrition Coordinating
More informationChapter 19(1) An Introduction to the Circulatory System and Blood
Chapter 19(1) An Introduction to the Circulatory System and Blood Circulatory System circulatory system = heart, blood vessels and blood cardiovascular system = heart and blood vessels hematology = the
More informationBIOCHEMISTRY OF BLOOD
BCH 471 BIOCHEMISTRY OF BLOOD Amal Alamri Experiment 1 Separation of Plasma and Serum from Whole Blood Whole Blood It is living tissue that circulates through the heart, arteries, veins, and capillaries
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationBlood Physiology. Rodolfo T. Rafael, M.D.,CFP
Blood Physiology Rodolfo T. Rafael, M.D.,CFP http://clinical-updates.blogspot.com rtrafaelmd@gmail.com +639212147558 July 26, 2006 1 Blood Physiology General Consideration Plasma Cellular Elements of the
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More informationBiology Anatomy and Physiology I. Learn and Understand. What is Biology? bios = life -ology = study of
Biology 2331 Anatomy and Physiology I "If you want something you've never had, then you've got to do something you've never done." Learn and Understand A new language At this stage, science drives the
More informationCAYUGA COMMUNITY COLLEGE Division of Computer Science, Mechanical Technology, Electrical Technology, GIS, Math, Nursing, Science
CAYUGA COMMUNITY COLLEGE Division of Computer Science, Mechanical Technology, Electrical Technology, GIS, Math, Nursing, Science Anatomy and Physiology II - Biology 204 4 Credit Hours CATALOG DESCRIPTION
More informationINTERNATIONAL JOURNAL OF PHARMACEUTICAL RESEARCH AND BIO-SCIENCE
INTERNATIONAL JOURNAL OF PHARMACEUTICAL RESEARCH AND BIO-SCIENCE EVALUATION OF ACUTE AND SUB ACUTE TOXICIY STUDY OF KANDANGKATHIRI KIRUTHAM (GHEE OF SOLANUM XANTHOCARPUM) IN ANIMAL MODEL. DR. S. CHITRA
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More informationWELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationSummary of Inhalation Carcinogenicity Study. of Tetrachloroethylene. in BDF 1 Mice
Summary of Inhalation Carcinogenicity Study of Tetrachloroethylene in BDF 1 Mice March 1993 Japan Bioassay Laboratory Japan Industrial Safety and Health Association PREFACE The tests were contracted and
More informationRead Across with Metabolomics for Phenoxy Herbicides a Case Study with MCPP BASF SE
Read Across with Metabolomics for Phenoxy Herbicides a Case Study with MCPP BASF SE Prof. Dr. Bennard van Ravenzwaay, BASF, Ludwigshafen, Germany Experimental Toxicology and Ecology 1 Introduction: Case
More informationHYPOGLYCAEMIC ACTION OF THE FLAVONOID FRACTION OF ARTOCARPUS HETEROPHYLLUS LEAF
42 Research Paper ISSN 0189-6016 2006 Afr. J. Traditional, Complementary and Alternative Medicines www.africanethnomedicines.net HYPOGLYCAEMIC ACTION OF THE FLAVONOID FRACTION OF ARTOCARPUS HETEROPHYLLUS
More informationCOMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationInspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
More informationUnit Seven Blood and Immunity
Unit Seven Blood and Immunity I. Introduction A. Definition Blood is a sticky fluid that is heavier and thicker than water. Blood is a type of, whose cells and suspended in a liquid intercellular material.
More informationWhat is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of
Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such
More informationOverview of Anatomy and Physiology
1 The Human Body: An Orientation Overview of Anatomy and Physiology Anatomy the study of the structure of body parts and their relationships to one another Gross or macroscopic Microscopic Developmental
More informationCHRONIC TOXICITY STUDY OF GARBHPAL RAS, AN AYURVEDIC MEDICINE
Journal of Herbal Medicine and Toxicology 3 (1) 13-17 (2009) ISSN : 0973-63 Original Article CHRONIC TOXICITY STUDY OF GARBHPAL RAS, AN AYURVEDIC MEDICINE D. MISHRA 1, M. SINHA 1, M. KUMAR 2 AND V. KUMAR
More informationLIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:!
LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:! Spinal cord and peripheral nerves! Eyes, Inner ear, nasal
More informationANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationCopyright 2010 Pearson Education, Inc. Blood Vessel Structure
Blood Vessel Structure Structure of Blood Vessel Walls Arteries and veins Tunica intima, tunica media, and tunica externa Lumen Central blood-containing space Capillaries Endothelium with sparse basal
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationWarm Up Where in a flower would you find xylem and phloem? 2. Where in a flower would you find palisade cells?
Body Systems Warm Up 4-4-16 1. Where in a flower would you find xylem and phloem? 2. Where in a flower would you find palisade cells? 3. Where in a flower would you find root hair cells? 4. What organelle
More informationSample received from: Botali International Enterprise Co., Ltd Tianjin Port Free Trade Zone
Nutrition and Foods Safety Agency of the Centre for Disease Prevention and Control, People s Republic of China Xi Yuan Hospital of China Academy of Traditional Chinese Medicine Testing Report Sample processing
More informationBIO 116 Practice Assignment 1 The Endocrine System and Blood This is not a required assignment but it is recommended.
BIO 116 Practice Assignment 1 The Endocrine System and Blood This is not a required assignment but it is recommended. 1. Match the following glands of the endocrine system with the appropriate label 1.
More informationEvaluation of Acute and Subacute toxicity of Siddha Polyherbal formulation Chitramutti Nei
International Journal of Advanced Research in Biological Sciences ISSN: 2348-8069 www.ijarbs.com DOI: 10.22192/ijarbs Coden: IJARQG(USA) Volume 5, Issue 9-2018 Research Article DOI: http://dx.doi.org/10.22192/ijarbs.2018.05.09.002
More informationWhat Does My Blood Test Mean
What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
More informationAcute and Subacute Toxicities of the Ethanol Extract from Alternanthera philoxeroides Griseb.
Mahidol University Journal of Pharmaceutical Sciences 2005; 32(1-2): 7-14. Original Article Acute and Subacute Toxicities of the Ethanol Extract from Alternanthera philoxeroides Griseb. S. Thanabhorn,
More informationPresented by: Dr. Giuseppe Molinaro Dr. Davide De Biase
Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE
More informationNarendra Deshmukh INTOX Pvt. Ltd. Pune, India
Narendra Deshmukh INTOX Pvt. Ltd. Pune, India GM-FOODS: NEW SUBSTANCES Genetic engineering can result in the synthesis of new substances in plants; Toxicological testing is required for such substances
More informationINTRODUCTION TO ANIMALS
AP BIOLOGY ANIMALS ACTIVITY #1 NAME DATE HOUR INTRODUCTION TO ANIMALS LEVELS OF ORGANIZATION Animals Activity #1 page 1 HOMEOSTASIS: DEFINITION IMPORTANCE MECHANISMS FOR MAINTAINING HOMEOSTASIS: Animals
More informationThe Blood Chemistry Panel Explained
The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems
More informationNervous System. Skeletal System. Muscular System. Reproductive System. Circulatory System. Endocrine System. Respiratory System. Integumentary System
The Human Body Skeletal System Muscular System Circulatory System Respiratory System Digestive System Nervous System Reproductive System Endocrine System Integumentary System Excretory System Lymphatic/Immune
More information8. POST- MORTEM PROTOCOL (John Trupkiewicz)
8. POST- MORTEM PROTOCOL (John Trupkiewicz) 8.1. GENERAL COMMENTS Those individuals who may be charged with performing a necropsy examination should formulate a plan of action in the case of the sudden,
More informationToxicological Profiling of Novel Siddha Formulation Kalladaippu Chooranam by Acute and Sub-Acute Toxicity Studies
International Journal of Advanced Research in Biological Sciences ISSN: 2348-8069 www.ijarbs.com DOI: 10.22192/ijarbs Coden: IJARQG(USA) Volume 5, Issue 9-2018 Research Article DOI: http://dx.doi.org/10.22192/ijarbs.2018.05.09.008
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationACUTE AND SUB ACUTE TOXICITY STUDIES OF HERBO- METALLIC FORMULATION VANGA CHENDURAM
Research Article International Ayurvedic Medical Journal ISSN:2320 5091 ACUTE AND SUB ACUTE TOXICITY STUDIES OF HERBO- METALLIC FORMULATION VANGA CHENDURAM R. Kayal vizhi, 1 P.Muralidharan 2 S.Kaniraja,
More informationA repeated dose 28-day oral toxicity study of β-bromostyrene in rats
Fundamental Toxicological Sciences (Fundam. Toxicol. Sci.) Vol.2, No.4, 191-200, 2015 191 Original Article A repeated dose 28-day oral toxicity study of β-bromostyrene in rats Atsushi Ono 1, Katsumi Kobayashi
More informationStudy. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
More informationTranslatability of cytokine data: from animals to humans. Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal
Translatability of cytokine data: from animals to humans Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal Presentation outline Overview of cytokines Factors related
More informationA test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.
Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These
More informationObjectives. Objectives 9/11/2012. Chapter 7 Body Systems. Define term connective tissue. Identify five body cavities
Chapter 7 Body Systems Objectives Define term connective tissue Identify five body cavities Define terms joints, cartilage, ligaments, tendons Identify two major divisions of skeletal system and describe
More informationEffect of Vidahi-Tikshna-Ushna-Snigdh Ahara on Raktavaha Srotas An Experimental Study
Effect of Vidahi-Tikshna-Ushna-Snigdh Ahara on Raktavaha Srotas An Experimental Study Vd. Hitesh Vyas Dr. Anil D. Avhad Department of Basic Principles Institute for Post Graduate Teaching and Research
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationStability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationRapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours. Animal Form. AP Biology Rapid Learning Series
Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours *AP is a registered trademark of the College Board, which does not endorse,
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationReport, BSL BIOSERVICE Study No page 2 of 110 Version: Final List of Tables Preface... 6
Report, BSL BIOSERVICE Study No. 112936 page 2 of 110 1. Contents 1. Contents... 2 2. List of Tables and Figures... 4 2.1. List of Tables... 4 3. Preface... 6 3.1. Abbreviations... 6 3.2. General... 8
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationBody Systems Notes. Nervous, Integumentary, Immune/Lymphatic, Circulatory, Skeletal, Respiratory, Digestive, Excretory, Endocrine, Reproductive
Body Systems Notes Nervous, Integumentary, Immune/Lymphatic, Circulatory, Skeletal, Respiratory, Digestive, Excretory, Endocrine, Reproductive Homeostasis: maintaining a balance. Examples: temperature,
More informationChapter 11. Lecture and Animation Outline
Chapter 11 Lecture and Animation Outline To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off. Please Note: Once you have
More informationLaboratory Investigation 24A Chapter 24A: Human Skin
Name Class Date Station # Laboratory Investigation 24A Chapter 24A: Human Skin Human Anatomy & Physiology: Integumentary System You may refer to pages 415-421 in your textbook for a general discussion
More informationAcute and Sub-Acute Toxicity Study of Compound Siddha Drug Lagu Seena Chooranam for the Management of Scabies
Human Journals Research Article September 2015 Vol.:4, Issue:2 All rights are reserved by A.Silambarasan et al. Acute and Sub-Acute Toxicity Study of Compound Siddha Drug Lagu Seena Chooranam for the Management
More informationEvaluation of the Subchronic Toxicity of Dietary Administered Equisetum arvense in F344 Rats
J Toxicol Pathol 2010; 23: 245 251 Original Evaluation of the Subchronic Toxicity of Dietary Administered Equisetum arvense in F344 Rats Yoshiyuki Tago 1, Min Wei 1, Naomi Ishii 1, Anna Kakehashi 1, and
More information