Nutrigenomics in poultry nutrition

Size: px

Start display at page:

Download "Nutrigenomics in poultry nutrition"

Scot Fox
6 years ago
Views:

1 Nutrigenomics in poultry nutrition International Symposium Nutrition and gut health to manage today s challenges in poultry production. Wageningen, The Netherlands, Wednesday, 3 June 2009 Mari Smits

2 Overview Introduction Genomics Nutrigenomics Example 1 3 Conclusions

3 Nutrition and performance traits Variation in genome (DNA) Variation in nutrition Variation in performance traits

4 Knowledge profits Returns Developing improved animal feeds (knowledge based) Costs Breeding animals with the most profitable genes Making the profitable genes to work harder and better

5 Nutrigenomics Genomics Performance Nutrition Nutrigenomics

6 DNA is the carrier of all genetic information DNA RNA Protein Metabolites Structure Transport Regulation Communication

7 Genomics: analysis of all genes instead of one Sequencing Microarrays Proteomics Metabolomics DNA sequence Gene activity Proteins Metabolites Bioinformatics Knowledge Applications

DNA structure and variation AGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGCCTTTAAAAGGCT GCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGGCCAATAGAAACTGGGC CAATAGAAGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGCCTTTAA

GAAACTGGGCCAATAGAAGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRC GCGCCTTTAAAAGGCTGCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGG CCAATAGAAACTGGGCCAATAGA AGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGCCTTTAAAAGGCT

8 DNA structure and variation AGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGCCTTTAAAAGGCT GCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGGCCAATAGAAACTGGGC CAATAGAAGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGCCTTTAA AAGGCTGCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGGCCAATAGAAA TGGGCCAATAGAAGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGC TTTAAAAGGCTGCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGGCCAATA GAAACTGGGCCAATAGAAGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRC GCGCCTTTAAAAGGCTGCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGG CCAATAGAAACTGGGCCAATAGA AGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGCCTTTAAAAGGCT GCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGGCCAATAGAAACTGGGC CAATAGAAGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGCCTTTAA AAGGCTGCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGGCCAATAGAAA TGGGCCAATAGAAGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGC TTTAAAAGGCTGCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGGCCAATA GAAACTGGGCCAATAGAAGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRC GCGCCTTTGAAAGGCTGCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGG CCAATAGAAACTGGGCCAATAGA Effect on trait?

9 Genome sequence Gallus gallus Statistics Assembly: WASHUC2, May 2006 Genebuild: Ensembl, Aug 2006 Database version: 48.2f Known genes: 4,782 Projected genes: 7,432 Novel genes: 4,522 Pseudogenes: 96 RNA genes: 655 Genscan gene predictions: 40,505 Gene exons: 182,183 Gene transcripts: 22,291 SNPs: 3,202,570 WASHUC2 is an assembly of the Chicken, Red Jungle Fowl Base Pairs*: 1,050,947,331 We know all the genes and proteins including their structures

10 Transcriptomics, proteomics: analysis of all mrna, proteins,.. Sequencing Microarrays Proteomics Metabolomics DNA sequence Gene activity Proteins Metabolites Bioinformatics Knowledge Applications

11 Measuring gene activity A Diet A B Diet B B > A A > B A = B

12 Protein profiling snapshot of all proteins in sample

13 Functional genomics research Understanding biological processes leading to endpoint endpoint treatment functional genomic studies endpoint Tools to measure, monitor, modulate, develop

14 Nutrigenomics Nutrigenomics is the study of molecular relationships between nutrition and the response of genes. The aim of nutrigenomics is to extrapolate how nutritioninduced gene expression changes affect performance traits. Nutrigenomics focuses on the effect of nutrients on the genome, transcriptome, proteome, and metabolome. By determining the mechanism of the effects of nutrients or the effects of a nutritional regime, Nutrigenomics tries to define the relationship between these specific nutrients or specific nutrient regimes (diets) and performance traits. Nutrigenomics is a new science, still in its infancy but is expanding rapidly

15 Nutrigenomics

Energy partioning and metabolism Immune awareness and

16 Nutrigenomics studies - trends Food/Feed Host Microbes Gastro intestinal track Gastrointestinal functioning Energy partioning and metabolism Immune awareness and competence Healthy organism (human and animal) Healthy populations

17 Bioinformatics Storage, management, integration, interpretation Physiology data data Metabolomics data data data data Genetics Proteomics Genomics Microarrays Comparative genomics: Transfer of knowledge from one species to another

Genetic Regulation of Feed Intake and Energy Balance in Poultry A better understanding of the genes associated with controlling feed intake and energy balance

18 Genetic Regulation of Feed Intake and Energy Balance in Poultry A better understanding of the genes associated with controlling feed intake and energy balance and how their expression is regulated by nutritional and hormonal stimuli will offer new insights into current poultry nutrition, breeding and management practices.

19 Example 1 Effect of an oil byproduct from conjugated linoleic acid (CLA) purification on CLA accumulation and lipogenic gene expression in broilers J.H. Kim et al. J. Agric. Food Chem. 2009, 57,

20 Example 1 Research question Can CLB induce CLA accumulation in muscle without inducing ligogenesis in liver 2% CLA (conjugated linoleic acid) 2% CLB (CLA byproduct) 2% SAF (safflower oil) 2% CON (soybean oil) day-old male broiler chicks 4 weeks experimental feeding No alteration in performance among the test groups. CLA accumulation efficiency in the breast muscle did not differ significantly between the CLA- and CBP-fed groups Measured in liver gene activity for: sterol regulatory element binding protein 1 (SREBP1) fatty acid synthase (FAS) acetyl coenzyme A carboxylase (ACC) malic enzyme (ME)

21 Example 1 SREBP1 FAS ACC ME Conclusion: CBP could be an efficient dietary source that promotes CLA accumulation in broiler muscle without inducing lipogenesis in the liver

22 Example 2 (ASG experiment) 2 groups of 25 animals Group 1: diet A Group 2: diet B Analysis of gene activity in jejunum 5 pools of 5 animals 20K array Each pool tested twice

23 Example 2 (ASG experiment) Significant up-regulated genes in diet B compared to diet A No. Fold up ( 2 log) Homology Hemoglobin-α-chain ch CCLi ENSGALT chemokine ah Genome Hit Contig NDR-2 (human) weakly similar Early response to neural induction Nuclear receptor (NroB2), weakly similar Insulin-induced gene 1 (Insig-1) Immunoglobulin Heavy Chain F-Box/LRR repeat protein 3A Cytochrome P Hepatocyte growth factor like protein (HGFL) Thrombospondin receptor (CD#36) ENSGALT

24 Example 2 (ASG experiment) Significant down-regulated genes in diet B compared to diet A No. Fold up ( 2 log) Homology Genome Hit Contig Squalene mono-oxygenase Aceteacetyl-CoA-synthase isopentyl-diphosphate-deltaisomerase C4 methyl sterol oxidase B G protein precursor/mhc 3-G antigen Hypothetical Protein Hydroxysteroid (17 beta) dehydroxygenase ENSGALT ENSGALT ENSGALT ENSGALT Genome Hit Contig α2-macroglobulin precursor α soluble carrier family 1

25 Example 2: conclusions, biological interpretation Diets A and B affect gene expression patterns in jejunum Diet B downregulates cholesterol biosynthesis pathway through Insig-1 (B): inhibiting of SREBP1 CD36 (B) = receptor for LDL cholesterol uptake macrophages Some genes involved in immune functions are regulated B-G precursor protein (B)= MHC complex chemokine ah221 (B)= T-cel chemotaxis SREBP + SREBP Insig-1

2006 Mother diet: Influences eggs yolk composition Hatchability Mortality

26 Example 3 Maternal diet influences gene expression in intestine of offspring in chicken (Gallus gallus) Rebel et al Mother diet: Influences eggs yolk composition Hatchability Mortality offspring Villus length in intestine Susceptibility for MAS Circulating lymphocytes Hypothesis: Mother diet influences intestinal development

Example 3 Maternal diet influences gene expression in intestine of offspring in chicken (Gallus gallus) Exp approach: Week 18-30 high/low feedmix Week 29: collection of

27 Example 3 Maternal diet influences gene expression in intestine of offspring in chicken (Gallus gallus) Exp approach: Week high/low feedmix Week 29: collection of fertilized eggs Offspring reared under same conditions Day 3, 14, 15 intestinal sections taken RNA pools (5 animals per group) Measure gene actiivity Immunohistochemistry

28 Example 3 Maternal diet influences gene expression in intestine of offspring in chicken (Gallus gallus) Composition of breeder feed Weight of broilers Low feed mix High feed mix weight of broilers 1800 Vitamin A 7500 IU 15,000 IU 1600 Vitamin D 2500 IU 3000 IU 1400 Vitamin E 10 IU 200 IU 1200 Vitamin C Vitamin B1 Vitamin B2 Not added 3mg/kg 8mg/kg 100 mg/kg 6mg/kg 16 mg/kg weight in grams broilers of breeders low broilers of breeders high Zinc 40 mg/kg 70 mg/kg 200 Copper Selenium 7.5 mg/kg mg/kg 15 mg/kg 0.25 mg/kg time in days

Example 3 Maternal diet influences gene expression in intestine of offspring in chicken (Gallus gallus) In the intestines of the offspring, 11 genes were

29 Example 3 Maternal diet influences gene expression in intestine of offspring in chicken (Gallus gallus) In the intestines of the offspring, 11 genes were found to be differentially expressed at day 3 and 11 after hatch. Genes higher expressed in the high mix mothers are involved in epithelial turnover and maturation.

30 Maternal diet influences gene expression and cell proliferation patterns In all three areas investigated, the decrease in number of proliferating cells from day 3 to day 14 is less in the offspring of the high mix group. Conclusion: mother diet influences intestinal development in offspring

31 Maternal diet influences gene expression..and host respons to MAS Experimental MAS challenge Mother feed high and offspring regular Mother feed regular and offspring regular Offspring inoculated with MAS or Saline at day 1 of age Sampling 1,3,7,14, 21 days pi Nprmal Time PI Lesions Low mix High mix cystic crypt + ++ Day 3 villus atrophy Pmn inf cystic crypt Day 7 villus atrophy Pmn inf MAS: Flattened crypt epithelium, cystic crypt, villus atrophy cystic crypt Day 14 villus atrophy Pmn inf cystic crypt ++ 0 Day21 villus atrophy + + Pmn inf + 0

32 Examples of recent nutrigenomic studies in poultry Effect of an oil byproduct from conjugated linoleic acid (CLA) purification on CLA accumulation and lipogenic gene expression in broilers. Effects of 1alpha-hydroxycholecalciferol on growth performance, parameters of tibia and plasma, meat quality, and type IIb sodium phosphate cotransporter gene expression of one- to twenty-oneday-old broilers. Short term changes in the expression of lipogenic genes in broilers (Gallus gallus). Dietary supplementation of glycine modulates inflammatory response indicators in broiler chickens Effects of source and level of magnesium on catalase activity and its gene expression in livers of broiler chickens Effects of daidzein on messenger ribonucleic acid expression of gonadotropin receptors in chicken ovarian follicles. Expression of the chicken peroxisome proliferator-activated receptor-gamma gene is influenced by aging, nutrition, and agonist administration. An examination of the role of feeding regimens in regulating metabolism during the broiler breeder grower period. 1. Hepatic lipid metabolism. Effect of early feed restriction on myofibre types and expression of growth-related genes in the gastrocnemius muscle of crossbred broiler chickens Effect of diet containing phytate and phytase on the activity and mrna expression of carbohydrase and transporter in chickens. Effects of dehydroepiandrosterone (DHEA) on hepatic lipid metabolism parameters and lipogenic gene mrna expression in broiler chickens Dietary nitrogen intake regulates hepatic malic enzyme messenger ribonucleic acid expression Effect of manganese supplementation and source on carcass traits, meat quality, and lipid oxidation in broilers

33 Conclusions Nutrigenomics approaches become more important in animal nutrition research Nutrigenomics approaches provide deeper insight into the relationships between nutrition and the response of genes Nutrigenomics approaches provide deeper insight into the mechanisms how nutrition-induced gene expression changes affect performance traits Nutrigenomics tools can be used to measure the physiological effects of specific nutrients or specific nutrient regimes In the future, knowledge obtained by nutrigenomics approaches may be applied to specifically modulate performance traits by nutrition In the future knowledge obtained by nutrigenomics approaches may be applied to develop new (more knowledge based) animal feeds / nutrient regimes

34 Thanks for your attention

NEW TRIAL PERFORMANCE ON COLOR CHICKENS AND GUT HEALTH SITUATION

NEW TRIAL PERFORMANCE ON COLOR CHICKENS AND GUT HEALTH SITUATION Nguyen Quang Thieu*, Thikhamporn Charoenwai**, Carsten Pedersen** *Nong Lam University, Hochiminh City, Vietnam. **Hamlet Protein A/S nguyen.quangthieu@hcmuaf.edu.vn