SUPPLEMENTARY INFORMATION
|
|
|
- Ami Hunt
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTARY INFORMATION Implication of Long noncoding RNAs in the endothelial cell response to hypoxia revealed y RNAsequencing. Voellenkle C., Garcia-Manteiga J. M., Pedrotti S., Perfetti A., De Toma I., Da Silva D., Maimone B., Greco S., Fasanaro P., Creo P., Zaccagnini, G., Gaetano C., Martelli F.
2 a c Annotated Genes Detected Genes Average Expression 24 % 21 % 2 % 11 % 5 % 4 % 9 % 27 % 24 % 24% 5% 21% 38 % 50% 50 % 85 % lncrna Protein coding Pseudogene sncrna Supplementary Figure S1. Distriution of genes etween classes and their percentage expression in HUVEC. Pie chart of the distriution of 4 gene classes as (a) annotated y Enseml 72 and () detected y RNA-sequencing. c) Distriution of the average expression per gene etween the 4 suclasses as measured y RNA-sequencing in HUVEC.
3 a Supplementary Figure S2. Enrichment Analysis of transcription factor inding site profiles (ChEA) of genes modulated in HUVEC upon hypoxia exposure. Top 10 transcription factors associated y Enrichr analysis tool to (a) up-modulated and () down-modulated hypoxic signatures. Positions are ordered y rank ased ranking. The Benjamini-Hocherg adjusted p-value <0.05 was used as significance threshold. The ar graph shows the transcription factor together with the PMID, cell type and species of the relevant study. The ars provide a visual representation of how significant each term is, the longer and lighter colored ars identifying more significant terms.
4 Fold change Fold change a. 3,000 p Genomic 141,220,000 p 141,221,000 p 141,222,000 p Location Normoxia Hypoxia Coverage (RNA-seq) predicted transcript_cuff Prediction (Cufflinks) MIR210 6 Promoter_miR-210 Validation (qpcr + Sequencing) Annotation (Refseq) ** *** *** ** Amplicon c *** ** 3 5 Amplicon Supplementary Figure S3. Putative transcript of mouse mir-210 Host Gene. a) IGV view of mir-210 region displaying the genomic location (hg19), the coverage in hypoxic and normoxic samples of differentiated 3T3-L1 cells (GSE35724) as derived y RNA-seq. Blue track: transcript predicted y cufflinks suite. Red tracks: expressed amplicons identified y qpcr and confirmed y Sanger sequencing. Black track: annotated MIR210 and its promoter region. Bar graphs show the fold changes of ) identified amplicons measured in normoxic (white ar) and hypoxic (lack ar) NIH3T3 mouse firolasts (n=3, **p<0.01, ***p<0.001) and c) identified amplicons at 7 days of ischemia, measured in a mouse model of hindlim ischemia (white ar, normoperfused contralateral muscle, lack ar, ischemic muscle; n= 3, **p<0.01, ***p<0.001).
5 a HRE Consensus Motif HRE Chr. Start End Sequence Score GGACGCGC GCAGGTGC AGACGTGC GGGCGTGG 90 Supplementary Figure S4. Conserved HIF-inding motifs identified in MIR210HG. a) Coverage plot of HIF1-alpha, HIF1-eta, and HIF2-alpha derived from ChIP-seq experiments in MCF-7 cultured in 0.5% oxygen for 16h (GSE28352). The region for MIR210HG region including 2 kp upstream of the transcription start site is shown (hg 18). The gene model for MIR210HG and MIR210 loci is shown; the arrows indicate the direction of transcription. The four lue oxes indicate putative HREs in the peak. ) Conserved HIF-inding motif and details on the four identified HRE, like genomic location (lift-over to hg 19), sequence and the minimum conservation score.
6 a c e 20µm d f Supplementary Figure S5. H19 is expressed in lood vessels in the skeletal muscle. Serial sections were derived from frozen opsies of human iceps rachii muscles. H19- ISH. a) Localization of H19 y using specific proes conjugated with alkaline phosphatase type 1 and fast lue sustrate. ) Counterstaining with Hoechst 3332 c) Merge. d) Endothelium- IHC. Incuation of the serial section with anti-human CD31 and iotinylated secondary antiody, followed y reaction of ABC complex with diaminoenzidine and counterstaining with Hematoxilin. e) Negative control for ISH performed using a proe for DapB of B. sutilis. f) Counterstaining with Hoechst H19 RNA is mostly expressed in the vascular tissue.
7 Fold change Fold change Fold change Fold change a 1, , , , , ,2 0.2 * *** 0,0 0.0 H19 knockdown H19 knockdown c 1.2 1, , , , , , ,0 ** H19 knockdown (GapmeR (oligo #3) 3) d Empty Vector # H19 overexpressed Supplementary Figure S6. Efficient H19 knockdown or overexpression in endothelial cells. a) H19 knockdown y transfection with an antisense oligonucleotide (LNA GapmeRs) in HAOEC (n=4; * p-value<0.05). ) H19 knockdown y transfection with an antisense oligonucleotide (LNA GapmeRs) in HUVEC (n=3; *** p-value< 0.001). c) H19 knockdown y transfection using a different LNA GapmeRs (oligo #3) in HUVEC (n= 3; ** p-value< 0.01). d) H19 overexpression y infection of HUVEC with lentiviruses expressing H19 (n= 3; # p<0.0001).
8 Vascular Diseases Arteriosclerosis Arterial Occlusive Diseases 15 / / / 109 Cardiovascular Diseases Pathologic Processes Sepsis Septicemia Coronary Disease Coronary Artery Disease Neoplastic Processes 10 / / / / / / / log10 (adjp) Supplementary Figure S7. Enrichment Analysis for genes modulated y H19 knockdown in HAOEC. WeGestalt tool was used to identify significant association etween diseases and differentially expressed genes modulated y H19 knockdown in HAOEC. Top 10 diseases ranked y Benjamini- Hocherg adjusted p-value are shown. Numers eside the ars indicate numer of genes in common etween H19 knockdown signature and the category, together with the numer of all reference genes in the category. Significance threshold was set at adjusted p<0.05, shown as red line.
9 Fold change a 2 p16 * p18 c 1 S: *** H19_knockdown G0/G1: 49.3 G2/M: 26.3 p57 (1%) p16 (1%) p15 (1%) p18 (4%) p19 (1%) H19 knockdown S: 15.6 p27 (11%) G2/M: 27.5 p21 (81%) G0/G1: 56.9 Supplementary Figure S8. Impact of H19 knockdown on the cell cycle. HUVEC were transfected with an antisense LNA GapmeRs specific for H19 or with negative control a) 48 hrs after transfection, total RNA was extracted and the expression of the indicated genes was assayed y qpcr. Significantly differential expressed cell cycle inhiitors identified y qpcr (n=8; *p<0.05 ***p<0.001). ) Distriution of expression levels among tested cyclin/cdk inhiitors as identified y RNA-sequencing in normoxic and hypoxic HUVEC. c) 48 hours after transfection with H19 antisense oligonucleotide or negative control, HUVEC were first laelled with EdU, then fixed and permeailized. Incorporated EdU was revealed with an Alexa Fluor 647-ased reagent, and total DNA content with propidium iodide. (n= 6). Representative ell cycle profiles otained y FACS are shown, indicating a reduction of cells in S-phase and a proportional increase of cells in G0/G1.
10 Asorance 0.5 0,5 # 0.4 0, , ,2 * 0, ,0 Negative Ctrl H19 knockdown Positive Ctrl Supplementary Figure S9. Investigation of Apoptosis following H19 knockdown in HUVEC. 48 hours after transfection with H19 antisense LNA GapmeRs oligonucleotide or negative control, apoptosis was determined y quantifying fragmentation of cellular DNA y ELISA assay. Positive control is represented y HUVEC treated with 600uM H2O2 for 12 hours (n=3, *p<0.05, # p<0.0001).
11 No. ranches (relative to ctrl) Numer of Cells (x1000) a H19_knockdown (GapmeR (Oligo 3) 3) c ** ** h 24h 48h 72h 1,5 1.5 H19 LNA GapmeR ,5 0.5 *** 0.00 Negative Ctrl H19 knockdown 500µm Supplementary Figure S10. Inhiition of proliferation and capillary-like structure formation upon H19 inhiition with an independent antisense LNA-GapmeR. HUVEC were transfected with a different antisense oligonucleotide (LNA GapmeR 3) specific for H19 or negative control. a) Proliferation assays were performed 24h after transfection. Growth curves show a significant impact of H19 knockdown compared to control (n=3, **p<0.01). ) The aility to form capillary like structures was quantified y matrigel-assay 48h after transfection, revealing a significant reduction upon H19 knockdown versus control (n=3, ***p<0.001). c) Representative phase-contrast images of the organization into capillary-like structures are shown.
12 No. Branches (relative to ctrl) Numer of Cells (x1000) a H19_overexpressed c Empty Vector , h 24h 48h 72h H19 overexpressed 1, , , , , µm 0,0 0.0 Empty vector H19 OEX Supplementary Figure S11. H19 overexpression does not affect HUVEC proliferation and capillary-like structure formation. HUVEC were staly infected with lentiviruses expressing H19 or empty vector. a) Cell numers were determined at different time points and growth curves were plotted (n=9). No significant differences in proliferation could e oserved. ) Aility to form capillary like structures was analyzed y matrigelassays. Quantitative assessment y counting the numer of ranches formed y HUVEC overexpressing H19 (H19 OEX) or empty vector revealed no significant difference (n=3). c) Representative phase-contrast images of the organization into capillary-like structures are shown.
13 Supplementary Tale S1: Next-Generation Sequencing Statistics. HUVEC samples exposed to Hypoxia (24 h or 48 h) or Normoxia (24 h) were sequenced. Quality control of sequenced reads was performed using FastQCsuite with default parameters. Fragments constituted y correct pairing of forward and reverse reads (R1 and R2) and aligning to exons of Enseml (GRCh37/ hg19, Fe2009, Version 72) were estimated y SoapSplice alignment and HTseq-count software. SAMPLE SEQUENCED READS (R1+R2) QC AND UNIQUELY ALIGNED READS QC ALIGNED [%] ALIGNED PAIRED ALIGNED UNPAIRED PROPERLY PAIRED [%] FRAGMENTS MAPPED TO ANNOTATED EXONS Normoxia. 24 h 164,263, ,483, ,242,633 9,240, ,838,282 Normoxia. 24 h 157,789, ,922, ,249,130 8,672, ,118,251 Hypoxia. 24 h 249,734, ,836, ,717,549 18,119, ,023,577 Hypoxia. 24 h 160,244, ,349, ,407,929 10,941, ,591,751 Normoxia. 24 h 286,029, ,665, ,088,573 20,576, ,773,694 Normoxia. 24 h 128,896, ,758, ,721,333 9,036, ,306,518 Hypoxia. 48 h 150,136, ,137, ,597,388 8,540, ,157,219 Hypoxia. 48 h 145,036, ,759, ,014,524 7,745, ,307,925
14 Supplementary Tale S2. Genes and lncrnas detected in normoxic and hypoxic HUVEC y RNA-sequencing. Numers of all genes and the comprised lncrna fraction as annotated in Enseml version 72 compared to numer of transcripts detected y HTSeq-Count at different expression levels. Differentially expressed (DE) genes and lncrnas genes were identified y DESeq2. Genes lncrna Enseml 72 (GRCh37/ hg19) 54,668 13,300 detected (> 0 mean normalized counts) considered for DE ( 9.0 mean normalized counts) DE (ctrl vs. Hypoxia) (adjusted P <5e-5) 34,773 7,381 19,596 2,458 2,
15 Supplementary Tale S5. Investigation of HIF transcription factor occupancy of lncrnas differentially expressed upon Hypoxia. For this purpose, pulicly availale ChIP-seq data for HIF1-alpha, HIF1-eta, and HIF2-eta on hypoxic reast cancer MCF-7 cells were used. lncrnas displaying at least one significant peak for one of the HIF proteins within the region of gene ody and promoter (5 kp upstream the TSS) are shown. The numer of identified HREs are indicated for different conservation score levels (expressed in percentage). The fold change for each lncrna as identified y RNAsequencing is shown, up-regulation is highlighted in red, down-regulation in green. lncrna validated y qpcr are highlighted in grey. GeneName HRE (80) HRE (85) HRE (90) HRE (95) log2fc MIR210HG RP11-77P CTC-378H H RP11-344E AP AC RP11-354K LINC RP11-347E SLC2A1-AS ADORA2A-AS HIF1A-AS AC RP3-510D LINC RP5-995J RP3-399L MEG RP11-540A MEG LINC RP11-235E AC OPLAH LINC Z LINC RP11-93L RP11-818F RP11-492E PSMG3-AS CTC-205M AC TPT1-AS AP MALAT AC LINC PCBP1-AS BAIAP2-AS TMCC1as RP11-111M KB-1732A PRIM AC BCYRN RECQL RP11-132A UHRF USP2as
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Table S1. Total and mapped reads produced for each ChIP-seq sample
Tale S1. Total and mapped reads produced for each ChIP-seq sample Sample Total Reads Mapped Reads Col- H3K27me3 rep1 125662 1334323 (85.76%) Col- H3K27me3 rep2 9176437 7986731 (87.4%) atmi1a//c H3K27m3
Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
Sirt1 Hmg20b Gm (0.17) 24 (17.3) 877 (857)
3 (0.17) 24 (17.3) Sirt1 Hmg20 Gm4763 877 (857) c d Suppl. Figure 1. Screen validation for top candidate antagonists of Dot1L (a) Numer of genes with one (gray), two (cyan) or three (red) shrna scored
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
Supplementary Table S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort. Chr. # of Gene 2. Chr. # of Gene 1
Supplementary Tale S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort TCGA Case ID Gene-1 Gene-2 Chr. # of Gene 1 Chr. # of Gene 2 Genomic coordiante of Gene 1 at fusion junction Genomic
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease
1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak
SUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer
1 SUPPLEMENTAL FILE 2 3 mir-22 and mir-29a are members of the androgen receptor cistrome modulating LAMC1 and Mcl-1 in prostate cancer 4 5 6 Lorenza Pasqualini 1, Huajie Bu 1,2, Martin Puhr 1, Narisu Narisu
HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.
HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency
Nature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
Supplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
Figure S1, Beyer et al.
Figure S1, eyer et al. Pax7 Myogenin si sitrl Hoechst T = 72h 14 1.8.6.4.2 12 1 8 6 4 2 24h 48h 96h diff. sitrl siset1 212 72h diff. b1 td r t Se km MyH Vinculin Myogenin β-ctin Vinculin MW b1 ka td r
RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays
Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
Supplemental information
Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies
a Anti-Dab2 RGD Merge
a Anti-Da Merge *** ** Percentage of cells adhered 8 6 4 RGE RAD RGE RAD Supplementary Figure Da are localized at clusters. (a) Endogenous Da is localized at clusters. (), ut not RGE nor RAD peptides can
NC bp. b 1481 bp
Kcna3 NC 11 178 p 1481 p 346 p c *** *** d relative expression..4.3.2.1 CD4 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna Kcna6 Kcna7 Kcnn4 relative expression..4.3.2.1 CD8 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Hidenobu Kanda, Rebecca Newton, Russell Klein, Yuka Morita, Michael D. Gunn & Steven D. Rosen
Autotaxin, a lysophosphatidic acid-producing ectoenzyme, promotes lymphocyte entry into secondary lymphoid organs Hidenou Kanda, Reecca Newton, Russell Klein, Yuka Morita, Michael D. Gunn & Steven D. Rosen
* * A3027. A4623 e A3507 A3507 A3507
a c L A327 d e A37 A37 A37 Supplementary Figure 1. Clinical manifestations of individuals with mutations. (a) Renal ultrasound of right kidney in A327 reveals small renal cysts, loss of corticomedullary
Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
Neocortex Zbtb20 / NFIA / Sox9
Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive
% of Nestin-EGFP (+) cells
8 7 6 3 Nestin CD % of Nestin-EGFP (+) ells 8 6 Nestin-EGFP Marge Nestin-EGFP Marge Expression levels of Expression levels of Tumorigeniity y stemness markers ifferentiation markers limiting ilution assay
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
High Throughput Sequence (HTS) data analysis. Lei Zhou
High Throughput Sequence (HTS) data analysis Lei Zhou (leizhou@ufl.edu) High Throughput Sequence (HTS) data analysis 1. Representation of HTS data. 2. Visualization of HTS data. 3. Discovering genomic
York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
Supplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated
Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,
SUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
cis-regulatory enrichment analysis in human, mouse and fly
cis-regulatory enrichment analysis in human, mouse and fly Zeynep Kalender Atak, PhD Laboratory of Computational Biology VIB-KU Leuven Center for Brain & Disease Research Laboratory of Computational Biology
NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
MIR retrotransposon sequences provide insulators to the human genome
Supplementary Information: MIR retrotransposon sequences provide insulators to the human genome Jianrong Wang, Cristina Vicente-García, Davide Seruggia, Eduardo Moltó, Ana Fernandez- Miñán, Ana Neto, Elbert
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
Results. Abstract. Introduc4on. Conclusions. Methods. Funding
. expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole
Accessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
A prostate cancer susceptibility allele at 6q22 increases RFX6 expression by modulating HOXB13 chromatin binding
Supplementary Information A prostate cancer susceptibility allele at 6q22 increases RFX6 expression by modulating HOXB13 chromatin binding Qilai Huang 1,2*, Thomas Whitington 3,4*, Ping Gao 1,2, Johan
MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing
Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by
(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells
Immunity, Volume 46 Supplemental Information Genomic Characterization of Murine Monocytes Reveals C/EBPb Transcription Factor Dependence of Ly6C Cells Alexander Mildner, Jörg Schönheit, Amir Giladi, Eyal
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
100 μm. Axon growth cones. Tubulin (red) + scr (green)
Supplementary Figures mirorna-9 regulates axon extension an ranhing y targeting Map1 in mouse ortial neurons Dajas-Bailaor, F., Bonev, B., Garez, P., Stanley, P., Guillemot, F., Papalopulu, N. a 2 μm 1
Supplementary Material
Supplementary Material HLA-DM Captures Partially Empty HLA-DR Molecules for Catalyzed Peptide Removal Anne-Kathrin Anders, Melissa J. Call, Monika-Sarah E. D. Schulze, Kevin D. Fowler, David A. Schuert,
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p Analysis of the peroxisome proliferator-activated receptor-β/δ (PPARβ/δ) cistrome reveals novel co-regulatory role of ATF4
Khozoie et al. BMC Genomics 2012, 13:665 RESEARCH ARTICLE Open Access Analysis of the peroxisome proliferator-activated receptor-β/δ (PPARβ/δ) cistrome reveals novel co-regulatory role of ATF4 Combiz Khozoie
Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
Supplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
tom tom 24hpf tom tom 48hpf tom 60hpf tom tom 72hpf tom
a 24hpf c 48hpf d e 60hpf f g 72hpf h i j k ISV ISV Figure 1. Vascular integrity defects and endothelial regression in mutant emryos. (a,c,e,g,i) Bright-field and (,d,f,h,j) corresponding fluorescent micrographs
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
Supplemental Figure S1. A. Venn diagram depicting overlap between anti-correlated genes of
Supplemental Figure S1. A. Venn diagram depicting overlap between anti-correlated genes of 1,000 most differentially expressed genes with NKX2-1 amplification in lung adenocarcinoma cell lines and anti-correlated
Circular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
Computational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory
Computational aspects of ChIP-seq John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory ChIP-seq Using highthroughput sequencing to investigate DNA
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.
Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment
Supplementary information
Supplementary information High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss Majken Siersbæk, Lyuba Varticovski, Shutong Yang,
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,
Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1
a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical
Nature Genetics: doi: /ng.3731
Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver
SUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Negative correlation between mir-375 and its predicted target genes, as demonstrated by gene set enrichment analysis (GSEA). 1 The correlation between
Dioxin induces Ahr-dependent robust DNA demethylation of the Cyp1a1 promoter via Tdg in the mouse liver
Dioxin induces Ahr-dependent robust DNA demethylation of the Cypa promoter via Tdg in the mouse liver Hesbon Z. Amenya, Chiharu Tohyama, Seiichiroh Ohsako Laboratory of Environmental Health Sciences, Center
Cluster Dendrogram. dist(cor(na.omit(tss.exprs.chip[, c(1:10, 24, 27, 30, 48:50, dist(cor(na.omit(tss.exprs.chip[, c(1:99, 103, 104, 109, 110,
A Transcriptome (RNA-seq) Transcriptome (RNA-seq) 3. 2.5 2..5..5...5..5 2. 2.5 3. 2.5 2..5..5...5..5 2. 2.5 Cluster Dendrogram RS_ES3.2 RS_ES3. RS_SHS5.2 RS_SHS5. PS_SHS5.2 PS_SHS5. RS_LJ3 PS_LJ3..4 _SHS5.2
Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first
Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first intron IGLL5 mutation depicting biallelic mutations. Red arrows highlight the presence of out of phase
SUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION GO term analysis of differentially methylated SUMIs. GO term analysis of the 458 SUMIs with the largest differential methylation between human and chimp shows that they are more
SUPPLEMENTARY FIGURE 1: f-i
SUPPLEMENTARY FIGURE 1: Comparisons of the biological replicates of ChIP-seq, Input and Bisulfite-seq. (a) Density plot of MeCP2 ChIP-seq genome coverage (calculated using tiled 15 bp windows) shows high
EPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Heintzman, ND, Stuart, RK, Hon, G, Fu, Y, Ching, CW, Hawkins, RD, Barrera, LO, Van Calcar, S, Qu, C, Ching, KA, Wang, W, Weng, Z, Green, RD,
Heintzman, ND, Stuart, RK, Hon, G, Fu, Y, Ching, CW, Hawkins, RD, Barrera, LO, Van Calcar, S, Qu, C, Ching, KA, Wang, W, Weng, Z, Green, RD, Crawford, GE, Ren, B (2007) Distinct and predictive chromatin
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).