# of transcr ipts FDR q- value transcripts PGF,CTNNB1,AKT2,FARP2,VEGFB,PDGFRA,DRD 2,CSF1,CDH1,ITGB1,SRC,KRAS,RASGRP3,MAP2. Pathway
|
|
- Avice Audrey Park
- 5 years ago
- Views:
Transcription
1 Supplementary Table 9. Pathways and biological processes associated with transcripts specific to SEB in both the pre- and post- RASP leukocytes (transcripts included in the Reactome Function Interaction networks). Note: Single capitalized letters in braces indicate the sources of the enrichment: K from KEGG; R from Reactome; N from NCI PID; C from CellMap Pathways Pathway Rap1 signaling pathway(k) Focal adhesion(k) Bacterial invasion of epithelial cells(k) Pathways in cancer(k) # of transcr ipts FDR q- value transcripts PGF,CTNNB1,AKT2,FARP2,VEGFB,PDGFRA,DRD 2,CSF1,CDH1,ITGB1,SRC,KRAS,RASGRP3,MAP2 14 <1.000e- 03 K2 PGF,CTNNB1,AKT2,VEGFB,PDGFRA,IBSP,CAV2, 13 <5.000e- 04 COL2A1,ITGB1,SRC,DOCK1,ITGB8,BCL2 CTNNB1,RHOG,CAV2,CDH1,ITGB1,SRC,DOCK1, 8 <3.333e- 04 ARPC2 PGF,CTNNB1,MAX,AKT2,PLD1,SKP2,VEGFB,PD 14 <2.500e- 04 GFRA,TRAF2,CDH1,ITGB1,KRAS,BCL2,MAP2K2 PGF,PPP2R5D,AKT2,VEGFB,PDGFRA,IBSP,CSF1, COL2A1,ITGB1,KRAS,ITGB8,BCL2,MAP2K2,YW 14 <2.000e- 04 HAH PI3K- Akt signaling pathway(k) Nectin adhesion pathway(n) E- 04 CTNNB1,FARP2,CDH1,SRC,PVRL1 Syndecan- 2- mediated signaling events(n) E- 04 SDC2,CSF2,CAV2,ITGB1,SRC CXCR3- mediated signaling events(n) E- 04 CXCL10,CXCL9,SRC,KRAS,MAP2K2 L1CAM interactions(r) 7 KCNQ2,NCAM1,SCN1B,ITGB1,SRC,MAP2K2,SP 7.78E- 04 TBN1 TNFSF13,CXCL10,TNFRSF14,VEGFB,PDGFRA,CS F2,CSF1,CXCL9,TNFRSF8,CCL8,TNFSF4 Cytokine- cytokine receptor interaction(k) E- 04 E- cadherin signaling in keratinocytes(n) E- 03 CTNNB1,AKT2,CDH1,SRC SDC2,NCAM1,CDH1,CDH2,CDH3,ITGB1,PVRL1, ITGB8 Cell adhesion molecules (CAMs)(K) E- 03 Adherens junction(k) E- 03 FER,CTNNB1,FARP2,CDH1,SRC,PVRL1 FGF signaling pathway(n) E- 03 SDC2,NCAM1,CDH1,CDH2,SRC Alpha9 beta1 integrin signaling events(n) E- 03 ADAM8,CSF2,ITGB1,SRC Posttranslational regulation of adherens junction stability and dissassembly(n) E- 03 CTNNB1,CDH1,CDH2,SRC,HGS Signaling events mediated by Hepatocyte Growth Factor Receptor (c- Met)(N) E- 03 CTNNB1,AKT2,CDH1,SRC,MAP2K2,HGS Cell junction organization(r) E- 03 CTNNB1,CDH1,CDH2,CDH3,ITGB1,PVRL1 Signaling by EGFR(R) 8 PRKAR2A,AKT2,PDGFRA,SRC,KRAS,MAP2K2,PR 2.50E- 03 KAR1B,HGS Ras signaling pathway(k) 9 PGF,AKT2,PLD1,VEGFB,PDGFRA,CSF1,KRAS,RA 3.00E- 03 SGRP3,MAP2K2 Shigellosis(K) E- 03 RHOG,ITGB1,SRC,DOCK1,ARPC2 Alpha4 beta1 integrin signaling events(n) E- 03 ITGB1,SRC,DOCK1,PRKAR1B Arf6 trafficking events(n) E- 03 CTNNB1,PLD1,SPAG9,CDH1
2 NCAM signaling for neurite out- growth(r) E- 03 NCAM1,SRC,KRAS,MAP2K2,SPTBN1 ErbB1 downstream signaling(n) E- 03 PLD1,SRC,KRAS,ARPC2,MAP2K2,YWHAH mtor signaling pathway(n) E- 03 PLD1,EIF4A1,KRAS,MAP2K2,YWHAH Trk receptor signaling mediated by PI3K and PLC- gamma(n) E- 03 SRC,KRAS,TRPC3,YWHAH CDC42 signaling events(n) E- 03 CTNNB1,PLD1,CDH1,SRC,ARPC2 Signaling by FGFR(R) 7 PRKAR2A,AKT2,PDGFRA,SRC,KRAS,MAP2K2,PR 5.15E- 03 KAR1B Signaling by ERBB2(R) 7 PRKAR2A,AKT2,PDGFRA,SRC,KRAS,MAP2K2,PR 5.31E- 03 KAR1B Alzheimer disease- presenilin pathway(p) E- 03 CTNNB1,APP,CDH1,CDH3,PVRL1,LRP1 Integrin signalling pathway(p) 7 COL2A1,ITGB1,SRC,KRAS,ARPC2,ITGB8,MAP2K 5.70E Urokinase- type plasminogen activator (upa) and upar- mediated signaling(n) E- 03 ITGB1,SRC,DOCK1,LRP1 Muscarinic acetylcholine receptor 2 and 4 signaling pathway(p) E- 03 PRKAR2A,PRKAR1B Regulation of actin cytoskeleton(k) 8 PDGFRA,ITGB1,SRC,KRAS,DOCK1,ARPC2,ITGB8 6.55E- 03,MAP2K2 PDGFR- beta signaling pathway(n) E- 03 SRC,KRAS,ARPC2,MAP2K2,LRP1,YWHAH regulation of bad phosphorylation(b) E- 03 PRKAR2A,BCL2,YWHAH Signalling by NGF(R) 9 PPP2R5D,PRKAR2A,NET1,AKT2,PDGFRA,SRC,K 7.84E- 03 RAS,MAP2K2,PRKAR1B Proteoglycans in cancer(k) 8 SDC2,CTNNB1,AKT2,CAV2,ITGB1,SRC,KRAS,MA 7.96E- 03 P2K2 regulation of ck1/cdk5 by type 1 glutamate receptors(b) E- 03 PRKAR2A,CDK5R1,DRD2 Signaling by PDGF(R) 7 PRKAR2A,AKT2,PDGFRA,SRC,KRAS,MAP2K2,PR 8.72E- 03 KAR1B Apoptosis(K) E- 03 PRKAR2A,AKT2,TRAF2,BCL2,PRKAR1B ECM- receptor interaction(k) E- 03 IBSP,COL2A1,ITGB1,ITGB8,GP1BA Gap junction(k) E- 02 PDGFRA,DRD2,SRC,KRAS,MAP2K2 Signaling events mediated by PTP1B(N) E- 02 FER,CSF1,CDH2,SRC Signaling by SCF- KIT(R) E- 02 FER,AKT2,PDGFRA,SRC,KRAS,MAP2K2 FGF signaling pathway(p) E- 02 PPP2R5D,AKT2,KRAS,MAP2K2,YWHAH IL2- mediated signaling events(n) E- 02 DOK2,KRAS,BCL2,MAP2K2 Endothelin signaling pathway(p) E- 02 PRKAR2A,AKT2,MAP2K2,PRKAR1B Pathogenic Escherichia coli infection(k) E- 02 CTNNB1,CDH1,ITGB1,ARPC2 Hepatitis B(K) E- 02 AKT2,SRC,KRAS,BCL2,MAP2K2,IKBKE VEGF signaling pathway(k) E- 02 AKT2,SRC,KRAS,MAP2K2 Myogenesis(R) E- 02 CTNNB1,SPAG9,CDH2 Extracellular matrix organization(r) 8 SDC2,ADAM8,NCAM1,IBSP,COL2A1,CDH1,ITG 1.68E- 02 B1,ITGB8 Alpha- synuclein signaling(n) E- 02 PPP2R5D,PLD1,SRC Toll- like receptor signaling pathway(k) E- 02 CXCL10,AKT2,CXCL9,MAP2K2,IKBKE Wnt signaling pathway(p) 8 PPP2R5D,CTNNB1,SMARCA1,EP400,CDH1,CDH 1.83E- 02 2,CDH3,CDH17 Semaphorin interactions(r) E- 02 RHOG,FARP2,CDK5R1,ITGB1 Netrin- mediated signaling events(n) E- 02 SRC,DOCK1,MAP2K2
3 TNF signaling pathway(k) E- 02 CXCL10,AKT2,TRAF2,CSF2,CSF1 Degradation of beta- catenin by the destruction complex(r) E- 02 PPP2R5D,CTNNB1,PSMB7,PSMB1 N- cadherin signaling events(n) E- 02 FER,CTNNB1,CDH2 Fc epsilon RI signaling pathway(k) E- 02 AKT2,CSF2,KRAS,MAP2K2 VEGF and VEGFR signaling network(n) E- 02 PGF,VEGFB Hedgehog signaling pathway(p) E- 02 PRKAR2A,PRKAR1B GP1b- IX- V activation signalling(r) E- 02 SRC,GP1BA RAF/MAP kinase cascade(r) E- 02 KRAS,MAP2K2 Signaling by VEGF(R) E- 02 PGF,VEGFB overview of telomerase protein component gene htert transcriptional regulation(b) E- 02 MAX,MXD1 Class I PI3K signaling events mediated by Akt(N) E- 02 AKT2,SRC,YWHAH a6b1 and a6b4 Integrin signaling(n) E- 02 CDH1,ITGB1,YWHAH Signaling events mediated by TCPTP(N) E- 02 CSF1,ITGB1,SRC Internalization of ErbB1(N) E- 02 SRC,KRAS,HGS B cell receptor signaling pathway(k) E- 02 AKT2,KRAS,RASGRP3,MAP2K2 Prolactin signaling pathway(k) E- 02 AKT2,SRC,KRAS,MAP2K2 PRKAR2A,AKT2,PDGFRA,KRAS,MAP2K2,PRKAR 1B DAP12 interactions(r) E- 02 E- cadherin signaling in the nascent adherens junction(n) E- 02 CTNNB1,CDH1,SRC Arrhythmogenic right ventricular cardiomyopathy (ARVC)(K) E- 02 CTNNB1,CDH2,ITGB1,ITGB8 Costimulation by the CD28 family(r) E- 02 PPP2R5D,AKT2,TNFRSF14,SRC Metabotropic glutamate receptor group II pathway(p) E- 02 PRKAR2A,PRKAR1B GMCSF- mediated signaling events(n) E- 02 CSF2,KRAS,MAP2K2 ErbB2/ErbB3 signaling events(n) E- 02 SRC,KRAS,MAP2K2 Signaling by Rho GTPases(R) E- 02 DLC1,RHOG,NET1,MYO9B,INPP5B Intrinsic Pathway for Apoptosis(R) E- 02 AKT2,BCL2,YWHAH Regulation of nuclear beta catenin signaling and target gene transcription(n) E- 02 CTNNB1,CDH1,CHD8,YWHAH role of mitochondria in apoptotic signaling(b) E- 02 BCL2,BIK transcription regulation by methyltransferase of carm1(b) E- 02 PRKAR2A,BCL2 Platelet Adhesion to exposed collagen(r) E- 02 ITGB1,GP1BA EGF receptor signaling pathway(p) E- 02 AKT2,KRAS,MAP2K2,YWHAH Netrin- 1 signaling(r) E- 02 SRC,DOCK1,TRPC3 Interleukin- 2 signaling(r) E- 02 CSF2,KRAS,MAP2K2 Chemokine signaling pathway(k) E- 02 CXCL10,AKT2,CXCL9,CCL8,SRC,KRAS ErbB signaling pathway(k) E- 02 AKT2,SRC,KRAS,MAP2K2 MAX,AKT2,PDGFRA,TRAF2,KRAS,RASGRP3,MA P2K2 MAPK signaling pathway(k) E- 02 Regulation of RhoA activity(n) E- 02 DLC1,NET1,MYO9B Insulin signaling pathway(k) E- 02 PRKAR2A,AKT2,KRAS,MAP2K2,PRKAR1B
4 Epstein- Barr virus infection(k) E- 02 AKT2,SKP2,TRAF2,POLR2C,BCL2,YWHAH Ceramide signaling pathway(n) E- 02 TRAF2,BCL2,MAP2K2 FoxO family signaling(n) E- 02 CTNNB1,SKP2,YWHAH role of nicotinic acetylcholine receptors in the regulation of apoptosis(b) E- 02 SRC,YWHAH GnRH signaling pathway(k) E- 02 PLD1,SRC,KRAS,MAP2K2 Cell surface interactions at the vascular wall(r) E- 02 DOK2,ITGB1,SRC,KRAS SHP2 signaling(n) E- 02 SDC2,KRAS,MAP2K2 Caspase cascade in apoptosis(n) E- 02 APP,TRAF2,BCL2 Signaling events mediated by Stem cell factor receptor (c- Kit)(N) E- 02 FER,BCL2,MAP2K2 Cadherin signaling pathway(p) E- 02 CTNNB1,CDH1,CDH3,CDH17 Estrogen signaling pathway(k) E- 02 AKT2,SRC,KRAS,MAP2K2 RAC1 signaling pathway(n) E- 02 CTNNB1,CDH1,ARPC2 Signaling events mediated by HDAC Class I(N) E- 02 MAX,MXD1,CHD4 T cell receptor signaling pathway(k) E- 02 AKT2,CSF2,KRAS,MAP2K2 Biological Processes Processes # of transcr ipts FDR q- value transcripts axon guidance 12 KCNQ2,RHOG,NCAM1,CDK5R1,SCN1B,COL2A1 3.00E- 03,SRC,KRAS,DOCK1,TRPC3,MAP2K2,SPTBN1 Ras protein signal transduction E- 03 PLD1,DOK2,SRC,KRAS,RASGRP3,MAP2K2 small GTPase mediated signal transduction 11 DLC1,RHOG,NET1,PLD1,GEM,MYO9B,KRAS,DO 7.67E- 03 CK1,RASGRP3,INPP5B,MAP2K2 tumor necrosis factor- mediated signaling pathway E- 01 TNFRSF14,TRAF2,TNFRSF8 cell adhesion 10 APP,NCAM1,IBSP,SCN1B,CDH3,SRC,PVRL1,ITG 1.43E- 01 B8,GP1BA,CDH17 positive regulation of podosome assembly E- 01 CSF2,SRC regulation of synaptic transmission, GABAergic E- 01 DRD2,KRAS neuron apoptotic process E- 01 MAX,APP,BCL2 heart morphogenesis E- 01 DLC1,COL2A1,TBX1 axonogenesis E- 01 APP,TOP2B,DRD2,BCL2 ATP- dependent chromatin remodeling E- 01 SMARCA1,CHD8 regulation of actin cytoskeleton organization E- 01 DLC1,CDK5R1,LRP1 epidermal growth factor receptor signaling pathway E- 01 PRKAR2A,PDGFRA,SRC,KRAS,MAP2K2,HGS response to iron ion E- 01 DRD2,BCL2 chemotaxis E- 01 FER,CXCL10,PLD1,CXCL9,CCL8 cell- cell adhesion E- 01 CTNNB1,ADAM8,PVRL1,BCL2 immune response E- 01 TNFSF13,CXCL10,TNFRSF14,GEM,CSF2,CXCL9, CCL8,PVRL1,TNFSF4,IKBKE
5 visual learning E- 01 APP,DRD2,KRAS positive regulation of protein targeting to membrane E- 01 AKT2,CDK5R1 negative regulation of intrinsic apoptotic signaling pathway E- 01 SRC,BCL2 positive regulation of gene expression E- 01 CTCF,CSF2,LRRC32,CSF1,KRAS platelet activation E- 01 APP,RHOG,VEGFB,SRC,GP1BA,TRPC3 nerve growth factor receptor signaling pathway 7 PPP2R5D,PRKAR2A,NET1,PDGFRA,SRC,KRAS,M 1.32E- 01 AP2K2 regulation of small GTPase mediated signal transduction E- 01 DLC1,RHOG,NET1,MYO9B,INPP5B virus- host interaction 8 TNFRSF14,EIF4A1,PDGFRA,SRC,SF3B2,PVRL1,P 1.34E- 01 SMB1,FDPS striated muscle cell differentiation E- 01 SPAG9,KRAS aorta morphogenesis E- 01 TBX1,LRP1 PPP2R5D,PRKAR2A,APP,PDGFRA,TRAF2,LRRC3 2,CSF1,SRC,KRAS,DOCK1,BCL2,MAP2K2,IKBKE innate immune response E- 01 homophilic cell adhesion E- 01 CDH1,CDH2,CDH3,PVRL1,CDH17 SDC2,APP,NCAM1,PDGFRA,IBSP,COL2A1,ITGB 8 extracellular matrix organization E- 01 regulation of sodium ion transport E- 01 DRD2,YWHAH negative regulation of anoikis E- 01 SRC,BCL2 positive regulation of ERK1 and ERK2 cascade E- 01 VEGFB,PDGFRA,DRD2,SRC positive regulation of macrophage derived foam cell differentiation E- 01 CSF2,CSF1 fibroblast growth factor receptor signaling pathway E- 01 PRKAR2A,PDGFRA,SRC,KRAS,MAP2K2 myeloid dendritic cell differentiation E- 01 UBD,CSF2 negative regulation of neuron apoptotic process E- 01 ADAM8,VEGFB,KRAS,BCL2 blood coagulation E- 01 PRKAR2A,APP,RHOG,VEGFB,SRC,KRAS,DOCK1, GP1BA,TRPC3
6 .
7
8
9
10
Additional file 2 List of pathway from PID
Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent
More informationSupplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points
A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
More informationPathways of changes in hypermethylation in F1 offspring exposed to intrauterine hyperglycemia
Supplementary Table 1. Pathways of changes in hypermethylation in F1 offspring exposed to intrauterine hyperglycemia Pathway Enrichment Score (-log10[p value]) p-value genes Glycosaminoglycan degradation
More informationTable S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers
Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers ListHits ListTotal PopulationHits PopulationTotal Terms 3 72 10 1429 Glycolysis Pathway 3 72 11 1429 Regulation
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationLate regulation of immune genes and micrornas in circulating leukocytes in a pig model of
1 Supplementary material for: 2 3 4 5 6 Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of influenza A (H1N2) infection Louise Brogaard, Peter M. H. Heegaard, Lars
More informationCell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
More informationCell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
More informationPathway Map Reference Guide
Pathway Map Reference Guide Focus Attention-grabber Your Pathway The most popular cell signaling pathways Sample & Assay Technologies Table of contents AKT Signaling 4 camp Signaling 5 Cellular Apoptosis
More informationCell signaling. How do cells receive and respond to signals from their surroundings?
Cell signaling How do cells receive and respond to signals from their surroundings? Prokaryotes and unicellular eukaryotes are largely independent and autonomous. In multicellular organisms there is a
More informationSubject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
More informationIntercellular indirect communication
Intercellular indirect communication transmission of chemical signals: sending cell signal transmitting tissue hormone medium receiving cell hormone intercellular fluid blood neurocrine neurotransmitter
More informationTHE HALLMARKS OF CANCER
THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated
More informationCELL BIOLOGY - CLUTCH CH CELL JUNCTIONS AND TISSUES.
!! www.clutchprep.com CONCEPT: CELL-CELL ADHESION Cells must be able to bind and interact with nearby cells in order to have functional and strong tissues Cells can in two main ways - Homophilic interactions
More informationIdentification of Tissue-Specific Protein-Coding and Noncoding. Transcripts across 14 Human Tissues Using RNA-seq
Identification of Tissue-Specific Protein-Coding and Noncoding Transcripts across 14 Human Tissues Using RNA-seq Jinhang Zhu 1, Geng Chen 1, Sibo Zhu 1,2, Suqing Li 3, Zhuo Wen 3, Bin Li 1, Yuanting Zheng
More informationSupplementary Material. Part I: Sample Information. Part II: Pathway Information
Supplementary Material Part I: Sample Information Three NPC cell lines, CNE1, CNE2, and HK1 were treated with CYC202. Gene expression of 380 selected genes were collected at 0, 2, 4, 6, 12 and 24 hours
More information2013 W. H. Freeman and Company. 12 Signal Transduction
2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure
More informationUNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL. PhD THESIS
UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL PhD THESIS THE IMPORTANCE OF TUMOR ANGIOGENESIS IN CEREBRAL TUMOR DIAGNOSIS AND THERAPY ABSTRACT PhD COORDINATOR: Prof. univ. dr. DRICU Anica PhD
More information1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
More information1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?
1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal
More informationCytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
More informationSupplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
More informationSupplementary Files. Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis
Supplementary Files Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis Lei Xin 1 *, M.D., Jun Gao 1 *, Ph.D., Dan Wang 1 *, M.D., Jin-Huan Lin 1, M.D., Zhuan Liao 1,
More informationChapter 15: Signal transduction
Chapter 15: Signal transduction Know the terminology: Enzyme-linked receptor, G-protein linked receptor, nuclear hormone receptor, G-protein, adaptor protein, scaffolding protein, SH2 domain, MAPK, Ras,
More informationCellular Physiology (PHSI3009) Contents:
Cellular Physiology (PHSI3009) Contents: Cell membranes and communication 2 nd messenger systems G-coupled protein signalling Calcium signalling Small G-protein signalling o RAS o MAPK o PI3K RHO GTPases
More informationSynapse Formation. Steven McLoon Department of Neuroscience University of Minnesota
Synapse Formation Steven McLoon Department of Neuroscience University of Minnesota 1 Course News Midterm Exam Monday, Nov 13 9:30-11:30am Bring a #2 pencil!! 2 Course News Lecture schedule: Mon (Oct 31)
More informationSupporting Information
Supporting Information Retinal expression of small non-coding RNAs in a murine model of proliferative retinopathy Chi-Hsiu Liu 1, Zhongxiao Wang 1, Ye Sun 1, John Paul SanGiovanni 2, Jing Chen 1, * 1 Department
More informationCell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01
Cell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. For multiple choice questions,
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationNeoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath
Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis
More informationLecture 3: Cells and Tissues. Bio 219 Dr. Adam Ross
Lecture 3: Cells and Tissues Bio 219 Dr. Adam Ross Cell Physiology Cell Physiology Brief review of organelles Should be mostly review Cell surrounded by plasma membrane Lipid bilayer Also surrounds organelles
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/7/303/303ra139/dc1 Supplementary Materials for Magnetic resonance image features identify glioblastoma phenotypic subtypes with distinct molecular
More informationsilent epidemic,. (WHO),
Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining
More informationREACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation
A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802
More informationBL 424 Chapter 15: Cell Signaling; Signal Transduction
BL 424 Chapter 15: Cell Signaling; Signal Transduction All cells receive and respond to signals from their environments. The behavior of each individual cell in multicellular plants and animals must be
More informationNTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc.
NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc. Cytokines Properties of Cytokines Cytokines are proteins with specific roles
More informationDr Mahmood S Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering and Regenerative Medicine King Edward Medical University/Mayo
Integration of Cells into Tissues Dr Mahmood S Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering and Regenerative Medicine King Edward Medical University/Mayo Hospital Lahore 1. How
More informationulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236
Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine
More informationVirchow s Hypothesis lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation
Virchow s Hypothesis 1863 lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation Barrett s esophagus/ Esophageal adenocarcinoma PSC / Cholangiocarcinoma Viral hepatitis
More informationNegative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,
More informationground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were
Supplementary Figure 1. Characterization of EVs from intestine. (a, b) Intestinal tissues were ground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were isolated by
More informationSystems biology approaches and pathway tools for investigating cardiovascular disease
Systems biology approaches and pathway tools for investigating cardiovascular disease Craig E. Wheelock 1,2*, Åsa M. Wheelock 2,3,4, Shuichi Kawashima 5, Diego Diez 2, Minoru Kanehisa 2,5, Marjan van Erk
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationLIX1 APOD RRM2 FAIM2 MGST1 UHRF1 PPIA BEX1
C2orf80 1 C2orf80 A2M ANXA1 APOD ARL4A BEX1 C1S C3 CD44 CHI3L1 CHI3L2 CLU DPYD DSCAM EMP3 FN1 GBP1 GEM GLIPR1 GRIA2 IDH1 LIX1 MAP2 MDK MGST1 MIR3917 NAMPT PCMTD2 PPIA PTN PTPRZ1 S100B SCG3 SERPINA3 TCF12
More informationregulation of polarized membrane transport by rab GTPases Peter van der Sluijs;
regulation of polarized membrane transport by rab GTPases Peter van der Sluijs; p.vandersluijs@umcutrecht.nl cytotoxic T cell recognizes complex of viral peptide with MHC class I and kills infected cell
More informationVIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer
VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad
More informationBiomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers
Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest
More information* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
More informationPotential Role of Sphingosine 1-Phosphate in the. Pathogenesis of Rheumatoid Arthritis
Potential Role of Sphingosine 1-Phosphate in the Pathogenesis of Rheumatoid Arthritis COMMENTARY for Zhao, C., Fernandes, M.J., Turgeon, M., Tancrede, S., Di Battista, J., Poubelle, P.E. and Bourgoin,
More informationReceptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
More informationBrain Development III
Brain Development III Neural Development In the developing nervous system there must be: 1. The formation of different regions of the brain. 2. The ability of a neuron to differentiate. 3. The ability
More informationDeregulation of signal transduction and cell cycle in Cancer
Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324
More informationImpact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach
Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach NM23-M1 "knock- out" mice (without NDPK A) Experimental models of hepatocarcinogenesis Chemical
More informationIntroduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
More informationThanks to: Signal Transduction. BCB 570 "Signal Transduction" 4/8/08. Drena Dobbs, ISU 1. An Aging Biologist s. One Biologist s Perspective
BCB 570 "" Thanks to: One Biologist s Perspective Drena Dobbs BCB & GDCB Iowa State University Howard Booth Biology Eastern Michigan University for Slides modified from his lecture Cell-Cell Communication
More informationContents. Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX
Contents Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX 1 General Aspects of Signal Transduction and Cancer Therapy 1 1.1 General Principles of Signal Transduction
More informationBCM 226 LECTURE SALEMCITY, A.J
BCM 226 LECTURE SALEMCITY, A.J BIOLOGICAL MEMBRANE Biological membranes are composed of proteins associated with a lipid bilayer matrix. They are the molecular gateway to the cell. Viewed under electron
More information11/8/16. Cell Signaling Mechanisms. Dr. Abercrombie 11/8/2016. Principal Parts of Neurons A Signal Processing Computer
Cell Signaling Mechanisms Dr. Abercrombie 11/8/2016 Principal Parts of Neurons A Signal Processing Computer A Multitude of Synapses and Synaptic Actions Summation/Synaptic Integration 1 The Synapse Signal
More informationBIPN140 Lecture 13: Synapse Formation (Synaptogenesis)
BIPN140 Lecture 13: Synapse Formation (Synaptogenesis) 1. Neuromuscular Junction (NMJ) Development 2. Synaptogenesis at Central Synapses Su (FA16) Ultrastructural Image of an NMJ Active Zone Basal Lamina
More informationThe Tissue Engineer s Toolkit
The Tissue Engineer s Toolkit Stimuli Detection and Response Ken Webb, Ph. D. Assistant Professor Dept. of Bioengineering Clemson University Environmental Stimulus-Cellular Response Environmental Stimuli
More information(A) Transgenic targeting vector that was electroporated into the ES cells for the
Akbay et al 1 SUPPLEMENTARY MATERIAL Supplementary Figure 1. Generation of transgenic mice and IDH2 expression in R140 and R172K transgenic mice. (A) Transgenic targeting vector that was electroporated
More informationHOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade)
HOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade) 1. Mesenchymal stem cells (MSC) cultured on extracellular matrices with different stiffness exhibit diverse lineage commitment
More informationHerpesviruses. Virion. Genome. Genes and proteins. Viruses and hosts. Diseases. Distinctive characteristics
Herpesviruses Virion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics Virion Enveloped icosahedral capsid (T=16), diameter 125 nm Diameter of enveloped virion 200 nm Capsid
More informationFormalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds
Supplementary figure legends Supplementary Figure 1 Fah + hepatocytes in a Fah -/- mouse transplanted with sorted cells. Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed
More informationQUIZ/TEST REVIEW NOTES SECTION 7 NEUROPHYSIOLOGY [THE SYNAPSE AND PHARMACOLOGY]
QUIZ/TEST REVIEW NOTES SECTION 7 NEUROPHYSIOLOGY [THE SYNAPSE AND PHARMACOLOGY] Learning Objectives: Explain how neurons communicate stimulus intensity Explain how action potentials are conducted along
More informationComputational Systems Biology: Biology X
Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#10:(November-22-2010) Cancer and Signals 1 1 Micro-Environment Story How does the rest of our body influences the cancer cell?
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More informationCXC chemokine (ligand/receptor)
List of abbreviations -MEM alpha-modified minimal essential AKT protein kinase B (also abbreviated PKB) AMC 7-amino-4-methylcoumarin AP-1 activator protein 1 ARF ADP-ribosylation factor, a small GTP-binding
More informationThe Role of Microenvironment in the Control of Tumor Angiogenesis
The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,
More informationLecture 14 - The cell cycle and cell death
02.17.10 Lecture 14 - The cell cycle and cell death The cell cycle: cells duplicate their contents and divide The cell cycle may be divided into 4 phases The cell cycle triggers essential processes (DNA
More informationMolecular biology :- Cancer genetics lecture 11
Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to
More informationLipids and Membranes
Lipids and Membranes Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Membrane transport D. Endocytosis and Exocytosis
More informationTable S7C- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 non-expressers
Table S7C- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 non-expressers Terms ListHits ListTotal PopulationHits PopulationTotal Hypoxia and p53 in the Cardiovascular system
More informationConsidering a new paradigm for Alzheimer s disease research a response
Considering a new paradigm for Alzheimer s disease research a response Martin Hofmann Apitius Department of Bioinformatics Fraunhofer Institute for Algorithms and Scientific Computing (SCAI) BioMed 21
More informationAnimal Tissue Culture SQG 3242 Biology of Cultured Cells. Dr. Siti Pauliena Mohd Bohari
Animal Tissue Culture SQG 3242 Biology of Cultured Cells Dr. Siti Pauliena Mohd Bohari The Culture Environment Changes of Cell s microenvironment needed that favor the spreading, migration, and proliferation
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More informationAdvanced Cell Biology. Lecture 36
Advanced Cell Biology. Lecture 36 Alexey Shipunov Minot State University May 3, 2013 Shipunov (MSU) Advanced Cell Biology. Lecture 36 May 3, 2013 1 / 43 Outline Questions and answers Cellular communities
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our
More informationTissue repair. (3&4 of 4)
Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid
More informationTissue renewal and Repair. Nisamanee Charoenchon, PhD Department of Pathobiology, Faculty of Science
Tissue renewal and Repair Nisamanee Charoenchon, PhD Email: nisamanee.cha@mahidol.ac.th Department of Pathobiology, Faculty of Science Topic Objectives 1. Describe processes of tissue repair, regeneration
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More informationMolecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationSupplementary information for: Community detection for networks with. unipartite and bipartite structure. Chang Chang 1, 2, Chao Tang 2
Supplementary information for: Community detection for networks with unipartite and bipartite structure Chang Chang 1, 2, Chao Tang 2 1 School of Life Sciences, Peking University, Beiing 100871, China
More informationCell cycle, signaling to cell cycle, and molecular basis of oncogenesis
Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis MUDr. Jiří Vachtenheim, CSc. CELL CYCLE - SUMMARY Basic terminology: Cyclins conserved proteins with homologous regions; their cellular
More informationGuide to Signal Pathways in Immune Cells
Guide to Signal Pathways in Immune Cells E. Nigel Wardle, MD Guide to Signal Pathways in Immune Cells E. Nigel Wardle The Royal Society of Medicine London, W1G 0AE United Kingdom nigel@edwinwardle.freeserve.co.uk
More informationSupplementary Figure 1. PCA separated RA and OA FLS isolated from (a) knees and (b) hips. by corresponding DMLs.
Supplementary Figure 1. PCA separated RA and OA FLS isolated from (a) knees and (b) hips by corresponding DMLs. Supplementary Table 1. Enriched biological pathways identified between 19 RA and 5 OA in
More informationGeneration of post-germinal centre myeloma plasma B cell.
Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused
More informationChapter 3 The Induced Responses of Innate Immunity
Chapter 3 The Induced Responses of Innate Immunity Pattern recognition by cells of the innate immune system Pattern recognition by cells of the innate immune system 4 main pattern recognition receptors
More informationROLE OF INFLAMMATION IN HYPERTENSION. Dr Barasa FA Physician Cardiologist Eldoret
ROLE OF INFLAMMATION IN HYPERTENSION Dr Barasa FA Physician Cardiologist Eldoret Outline Inflammation in CVDs the evidence Basic Science in Cardiovascular inflammation: The Main players Inflammation as
More informationINTEGRIN SIGNALLING DURING TUMOUR PROGRESSION
INTEGRIN SIGNALLING DURING TUMOUR PROGRESSION Wenjun Guo and Filippo G. Giancotti Abstract During progression from tumour growth to metastasis, specific integrin signals enable cancer cells to detach from
More informationThe Role of micrornas in Pain. Phd Work of: Rehman Qureshi Advisor: Ahmet Sacan
The Role of micrornas in Pain Phd Work of: Rehman Qureshi Advisor: Ahmet Sacan 1 Motivation for molecular analysis of Pain Chronic pain one of the most common causes for seeking medical treatment Approximate
More informationIndependent Study Guide The Innate Immune Response (Chapter 15)
Independent Study Guide The Innate Immune Response (Chapter 15) I. General types of immunity (Chapter 15 introduction) a. Innate i. inborn ii. pattern recognition b. Adaptive i. "learned" through exposure
More informationGrowth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
More informationBasis of Immunology and
Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie
More informationEGF receptor transactivation is crucial for cholinergic MAP kinase signaling in human keratinocytes
1st Electronic Conference on Molecular Science EGF receptor transactivation is crucial for cholinergic MAP kinase signaling in human keratinocytes Wymke Ockenga, Sina Kühne, Antje Banning and Ritva Tikkanen
More informationLaura Smart 9/22/2011
Laura Smart 9/22/2011 Fibrosis is a wound healing response in which damaged regions are encapsulated by an extracellular matrix or scar. Fibrosis develops in almost all patients with chronic liver injury
More informationEnzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
More informationFc receptors, phagocytosis role 128
Subject Index Adaptive immunity dependence on innate immunity 9, 10 evolution 10 Aging anti-inflammatory agents in counteraction 202 beneficial polymorphisms 199 201 definition 18, 189 innate immunity
More information