# of transcr ipts FDR q- value transcripts PGF,CTNNB1,AKT2,FARP2,VEGFB,PDGFRA,DRD 2,CSF1,CDH1,ITGB1,SRC,KRAS,RASGRP3,MAP2. Pathway

Size: px
Start display at page:

Download "# of transcr ipts FDR q- value transcripts PGF,CTNNB1,AKT2,FARP2,VEGFB,PDGFRA,DRD 2,CSF1,CDH1,ITGB1,SRC,KRAS,RASGRP3,MAP2. Pathway"

Transcription

1 Supplementary Table 9. Pathways and biological processes associated with transcripts specific to SEB in both the pre- and post- RASP leukocytes (transcripts included in the Reactome Function Interaction networks). Note: Single capitalized letters in braces indicate the sources of the enrichment: K from KEGG; R from Reactome; N from NCI PID; C from CellMap Pathways Pathway Rap1 signaling pathway(k) Focal adhesion(k) Bacterial invasion of epithelial cells(k) Pathways in cancer(k) # of transcr ipts FDR q- value transcripts PGF,CTNNB1,AKT2,FARP2,VEGFB,PDGFRA,DRD 2,CSF1,CDH1,ITGB1,SRC,KRAS,RASGRP3,MAP2 14 <1.000e- 03 K2 PGF,CTNNB1,AKT2,VEGFB,PDGFRA,IBSP,CAV2, 13 <5.000e- 04 COL2A1,ITGB1,SRC,DOCK1,ITGB8,BCL2 CTNNB1,RHOG,CAV2,CDH1,ITGB1,SRC,DOCK1, 8 <3.333e- 04 ARPC2 PGF,CTNNB1,MAX,AKT2,PLD1,SKP2,VEGFB,PD 14 <2.500e- 04 GFRA,TRAF2,CDH1,ITGB1,KRAS,BCL2,MAP2K2 PGF,PPP2R5D,AKT2,VEGFB,PDGFRA,IBSP,CSF1, COL2A1,ITGB1,KRAS,ITGB8,BCL2,MAP2K2,YW 14 <2.000e- 04 HAH PI3K- Akt signaling pathway(k) Nectin adhesion pathway(n) E- 04 CTNNB1,FARP2,CDH1,SRC,PVRL1 Syndecan- 2- mediated signaling events(n) E- 04 SDC2,CSF2,CAV2,ITGB1,SRC CXCR3- mediated signaling events(n) E- 04 CXCL10,CXCL9,SRC,KRAS,MAP2K2 L1CAM interactions(r) 7 KCNQ2,NCAM1,SCN1B,ITGB1,SRC,MAP2K2,SP 7.78E- 04 TBN1 TNFSF13,CXCL10,TNFRSF14,VEGFB,PDGFRA,CS F2,CSF1,CXCL9,TNFRSF8,CCL8,TNFSF4 Cytokine- cytokine receptor interaction(k) E- 04 E- cadherin signaling in keratinocytes(n) E- 03 CTNNB1,AKT2,CDH1,SRC SDC2,NCAM1,CDH1,CDH2,CDH3,ITGB1,PVRL1, ITGB8 Cell adhesion molecules (CAMs)(K) E- 03 Adherens junction(k) E- 03 FER,CTNNB1,FARP2,CDH1,SRC,PVRL1 FGF signaling pathway(n) E- 03 SDC2,NCAM1,CDH1,CDH2,SRC Alpha9 beta1 integrin signaling events(n) E- 03 ADAM8,CSF2,ITGB1,SRC Posttranslational regulation of adherens junction stability and dissassembly(n) E- 03 CTNNB1,CDH1,CDH2,SRC,HGS Signaling events mediated by Hepatocyte Growth Factor Receptor (c- Met)(N) E- 03 CTNNB1,AKT2,CDH1,SRC,MAP2K2,HGS Cell junction organization(r) E- 03 CTNNB1,CDH1,CDH2,CDH3,ITGB1,PVRL1 Signaling by EGFR(R) 8 PRKAR2A,AKT2,PDGFRA,SRC,KRAS,MAP2K2,PR 2.50E- 03 KAR1B,HGS Ras signaling pathway(k) 9 PGF,AKT2,PLD1,VEGFB,PDGFRA,CSF1,KRAS,RA 3.00E- 03 SGRP3,MAP2K2 Shigellosis(K) E- 03 RHOG,ITGB1,SRC,DOCK1,ARPC2 Alpha4 beta1 integrin signaling events(n) E- 03 ITGB1,SRC,DOCK1,PRKAR1B Arf6 trafficking events(n) E- 03 CTNNB1,PLD1,SPAG9,CDH1

2 NCAM signaling for neurite out- growth(r) E- 03 NCAM1,SRC,KRAS,MAP2K2,SPTBN1 ErbB1 downstream signaling(n) E- 03 PLD1,SRC,KRAS,ARPC2,MAP2K2,YWHAH mtor signaling pathway(n) E- 03 PLD1,EIF4A1,KRAS,MAP2K2,YWHAH Trk receptor signaling mediated by PI3K and PLC- gamma(n) E- 03 SRC,KRAS,TRPC3,YWHAH CDC42 signaling events(n) E- 03 CTNNB1,PLD1,CDH1,SRC,ARPC2 Signaling by FGFR(R) 7 PRKAR2A,AKT2,PDGFRA,SRC,KRAS,MAP2K2,PR 5.15E- 03 KAR1B Signaling by ERBB2(R) 7 PRKAR2A,AKT2,PDGFRA,SRC,KRAS,MAP2K2,PR 5.31E- 03 KAR1B Alzheimer disease- presenilin pathway(p) E- 03 CTNNB1,APP,CDH1,CDH3,PVRL1,LRP1 Integrin signalling pathway(p) 7 COL2A1,ITGB1,SRC,KRAS,ARPC2,ITGB8,MAP2K 5.70E Urokinase- type plasminogen activator (upa) and upar- mediated signaling(n) E- 03 ITGB1,SRC,DOCK1,LRP1 Muscarinic acetylcholine receptor 2 and 4 signaling pathway(p) E- 03 PRKAR2A,PRKAR1B Regulation of actin cytoskeleton(k) 8 PDGFRA,ITGB1,SRC,KRAS,DOCK1,ARPC2,ITGB8 6.55E- 03,MAP2K2 PDGFR- beta signaling pathway(n) E- 03 SRC,KRAS,ARPC2,MAP2K2,LRP1,YWHAH regulation of bad phosphorylation(b) E- 03 PRKAR2A,BCL2,YWHAH Signalling by NGF(R) 9 PPP2R5D,PRKAR2A,NET1,AKT2,PDGFRA,SRC,K 7.84E- 03 RAS,MAP2K2,PRKAR1B Proteoglycans in cancer(k) 8 SDC2,CTNNB1,AKT2,CAV2,ITGB1,SRC,KRAS,MA 7.96E- 03 P2K2 regulation of ck1/cdk5 by type 1 glutamate receptors(b) E- 03 PRKAR2A,CDK5R1,DRD2 Signaling by PDGF(R) 7 PRKAR2A,AKT2,PDGFRA,SRC,KRAS,MAP2K2,PR 8.72E- 03 KAR1B Apoptosis(K) E- 03 PRKAR2A,AKT2,TRAF2,BCL2,PRKAR1B ECM- receptor interaction(k) E- 03 IBSP,COL2A1,ITGB1,ITGB8,GP1BA Gap junction(k) E- 02 PDGFRA,DRD2,SRC,KRAS,MAP2K2 Signaling events mediated by PTP1B(N) E- 02 FER,CSF1,CDH2,SRC Signaling by SCF- KIT(R) E- 02 FER,AKT2,PDGFRA,SRC,KRAS,MAP2K2 FGF signaling pathway(p) E- 02 PPP2R5D,AKT2,KRAS,MAP2K2,YWHAH IL2- mediated signaling events(n) E- 02 DOK2,KRAS,BCL2,MAP2K2 Endothelin signaling pathway(p) E- 02 PRKAR2A,AKT2,MAP2K2,PRKAR1B Pathogenic Escherichia coli infection(k) E- 02 CTNNB1,CDH1,ITGB1,ARPC2 Hepatitis B(K) E- 02 AKT2,SRC,KRAS,BCL2,MAP2K2,IKBKE VEGF signaling pathway(k) E- 02 AKT2,SRC,KRAS,MAP2K2 Myogenesis(R) E- 02 CTNNB1,SPAG9,CDH2 Extracellular matrix organization(r) 8 SDC2,ADAM8,NCAM1,IBSP,COL2A1,CDH1,ITG 1.68E- 02 B1,ITGB8 Alpha- synuclein signaling(n) E- 02 PPP2R5D,PLD1,SRC Toll- like receptor signaling pathway(k) E- 02 CXCL10,AKT2,CXCL9,MAP2K2,IKBKE Wnt signaling pathway(p) 8 PPP2R5D,CTNNB1,SMARCA1,EP400,CDH1,CDH 1.83E- 02 2,CDH3,CDH17 Semaphorin interactions(r) E- 02 RHOG,FARP2,CDK5R1,ITGB1 Netrin- mediated signaling events(n) E- 02 SRC,DOCK1,MAP2K2

3 TNF signaling pathway(k) E- 02 CXCL10,AKT2,TRAF2,CSF2,CSF1 Degradation of beta- catenin by the destruction complex(r) E- 02 PPP2R5D,CTNNB1,PSMB7,PSMB1 N- cadherin signaling events(n) E- 02 FER,CTNNB1,CDH2 Fc epsilon RI signaling pathway(k) E- 02 AKT2,CSF2,KRAS,MAP2K2 VEGF and VEGFR signaling network(n) E- 02 PGF,VEGFB Hedgehog signaling pathway(p) E- 02 PRKAR2A,PRKAR1B GP1b- IX- V activation signalling(r) E- 02 SRC,GP1BA RAF/MAP kinase cascade(r) E- 02 KRAS,MAP2K2 Signaling by VEGF(R) E- 02 PGF,VEGFB overview of telomerase protein component gene htert transcriptional regulation(b) E- 02 MAX,MXD1 Class I PI3K signaling events mediated by Akt(N) E- 02 AKT2,SRC,YWHAH a6b1 and a6b4 Integrin signaling(n) E- 02 CDH1,ITGB1,YWHAH Signaling events mediated by TCPTP(N) E- 02 CSF1,ITGB1,SRC Internalization of ErbB1(N) E- 02 SRC,KRAS,HGS B cell receptor signaling pathway(k) E- 02 AKT2,KRAS,RASGRP3,MAP2K2 Prolactin signaling pathway(k) E- 02 AKT2,SRC,KRAS,MAP2K2 PRKAR2A,AKT2,PDGFRA,KRAS,MAP2K2,PRKAR 1B DAP12 interactions(r) E- 02 E- cadherin signaling in the nascent adherens junction(n) E- 02 CTNNB1,CDH1,SRC Arrhythmogenic right ventricular cardiomyopathy (ARVC)(K) E- 02 CTNNB1,CDH2,ITGB1,ITGB8 Costimulation by the CD28 family(r) E- 02 PPP2R5D,AKT2,TNFRSF14,SRC Metabotropic glutamate receptor group II pathway(p) E- 02 PRKAR2A,PRKAR1B GMCSF- mediated signaling events(n) E- 02 CSF2,KRAS,MAP2K2 ErbB2/ErbB3 signaling events(n) E- 02 SRC,KRAS,MAP2K2 Signaling by Rho GTPases(R) E- 02 DLC1,RHOG,NET1,MYO9B,INPP5B Intrinsic Pathway for Apoptosis(R) E- 02 AKT2,BCL2,YWHAH Regulation of nuclear beta catenin signaling and target gene transcription(n) E- 02 CTNNB1,CDH1,CHD8,YWHAH role of mitochondria in apoptotic signaling(b) E- 02 BCL2,BIK transcription regulation by methyltransferase of carm1(b) E- 02 PRKAR2A,BCL2 Platelet Adhesion to exposed collagen(r) E- 02 ITGB1,GP1BA EGF receptor signaling pathway(p) E- 02 AKT2,KRAS,MAP2K2,YWHAH Netrin- 1 signaling(r) E- 02 SRC,DOCK1,TRPC3 Interleukin- 2 signaling(r) E- 02 CSF2,KRAS,MAP2K2 Chemokine signaling pathway(k) E- 02 CXCL10,AKT2,CXCL9,CCL8,SRC,KRAS ErbB signaling pathway(k) E- 02 AKT2,SRC,KRAS,MAP2K2 MAX,AKT2,PDGFRA,TRAF2,KRAS,RASGRP3,MA P2K2 MAPK signaling pathway(k) E- 02 Regulation of RhoA activity(n) E- 02 DLC1,NET1,MYO9B Insulin signaling pathway(k) E- 02 PRKAR2A,AKT2,KRAS,MAP2K2,PRKAR1B

4 Epstein- Barr virus infection(k) E- 02 AKT2,SKP2,TRAF2,POLR2C,BCL2,YWHAH Ceramide signaling pathway(n) E- 02 TRAF2,BCL2,MAP2K2 FoxO family signaling(n) E- 02 CTNNB1,SKP2,YWHAH role of nicotinic acetylcholine receptors in the regulation of apoptosis(b) E- 02 SRC,YWHAH GnRH signaling pathway(k) E- 02 PLD1,SRC,KRAS,MAP2K2 Cell surface interactions at the vascular wall(r) E- 02 DOK2,ITGB1,SRC,KRAS SHP2 signaling(n) E- 02 SDC2,KRAS,MAP2K2 Caspase cascade in apoptosis(n) E- 02 APP,TRAF2,BCL2 Signaling events mediated by Stem cell factor receptor (c- Kit)(N) E- 02 FER,BCL2,MAP2K2 Cadherin signaling pathway(p) E- 02 CTNNB1,CDH1,CDH3,CDH17 Estrogen signaling pathway(k) E- 02 AKT2,SRC,KRAS,MAP2K2 RAC1 signaling pathway(n) E- 02 CTNNB1,CDH1,ARPC2 Signaling events mediated by HDAC Class I(N) E- 02 MAX,MXD1,CHD4 T cell receptor signaling pathway(k) E- 02 AKT2,CSF2,KRAS,MAP2K2 Biological Processes Processes # of transcr ipts FDR q- value transcripts axon guidance 12 KCNQ2,RHOG,NCAM1,CDK5R1,SCN1B,COL2A1 3.00E- 03,SRC,KRAS,DOCK1,TRPC3,MAP2K2,SPTBN1 Ras protein signal transduction E- 03 PLD1,DOK2,SRC,KRAS,RASGRP3,MAP2K2 small GTPase mediated signal transduction 11 DLC1,RHOG,NET1,PLD1,GEM,MYO9B,KRAS,DO 7.67E- 03 CK1,RASGRP3,INPP5B,MAP2K2 tumor necrosis factor- mediated signaling pathway E- 01 TNFRSF14,TRAF2,TNFRSF8 cell adhesion 10 APP,NCAM1,IBSP,SCN1B,CDH3,SRC,PVRL1,ITG 1.43E- 01 B8,GP1BA,CDH17 positive regulation of podosome assembly E- 01 CSF2,SRC regulation of synaptic transmission, GABAergic E- 01 DRD2,KRAS neuron apoptotic process E- 01 MAX,APP,BCL2 heart morphogenesis E- 01 DLC1,COL2A1,TBX1 axonogenesis E- 01 APP,TOP2B,DRD2,BCL2 ATP- dependent chromatin remodeling E- 01 SMARCA1,CHD8 regulation of actin cytoskeleton organization E- 01 DLC1,CDK5R1,LRP1 epidermal growth factor receptor signaling pathway E- 01 PRKAR2A,PDGFRA,SRC,KRAS,MAP2K2,HGS response to iron ion E- 01 DRD2,BCL2 chemotaxis E- 01 FER,CXCL10,PLD1,CXCL9,CCL8 cell- cell adhesion E- 01 CTNNB1,ADAM8,PVRL1,BCL2 immune response E- 01 TNFSF13,CXCL10,TNFRSF14,GEM,CSF2,CXCL9, CCL8,PVRL1,TNFSF4,IKBKE

5 visual learning E- 01 APP,DRD2,KRAS positive regulation of protein targeting to membrane E- 01 AKT2,CDK5R1 negative regulation of intrinsic apoptotic signaling pathway E- 01 SRC,BCL2 positive regulation of gene expression E- 01 CTCF,CSF2,LRRC32,CSF1,KRAS platelet activation E- 01 APP,RHOG,VEGFB,SRC,GP1BA,TRPC3 nerve growth factor receptor signaling pathway 7 PPP2R5D,PRKAR2A,NET1,PDGFRA,SRC,KRAS,M 1.32E- 01 AP2K2 regulation of small GTPase mediated signal transduction E- 01 DLC1,RHOG,NET1,MYO9B,INPP5B virus- host interaction 8 TNFRSF14,EIF4A1,PDGFRA,SRC,SF3B2,PVRL1,P 1.34E- 01 SMB1,FDPS striated muscle cell differentiation E- 01 SPAG9,KRAS aorta morphogenesis E- 01 TBX1,LRP1 PPP2R5D,PRKAR2A,APP,PDGFRA,TRAF2,LRRC3 2,CSF1,SRC,KRAS,DOCK1,BCL2,MAP2K2,IKBKE innate immune response E- 01 homophilic cell adhesion E- 01 CDH1,CDH2,CDH3,PVRL1,CDH17 SDC2,APP,NCAM1,PDGFRA,IBSP,COL2A1,ITGB 8 extracellular matrix organization E- 01 regulation of sodium ion transport E- 01 DRD2,YWHAH negative regulation of anoikis E- 01 SRC,BCL2 positive regulation of ERK1 and ERK2 cascade E- 01 VEGFB,PDGFRA,DRD2,SRC positive regulation of macrophage derived foam cell differentiation E- 01 CSF2,CSF1 fibroblast growth factor receptor signaling pathway E- 01 PRKAR2A,PDGFRA,SRC,KRAS,MAP2K2 myeloid dendritic cell differentiation E- 01 UBD,CSF2 negative regulation of neuron apoptotic process E- 01 ADAM8,VEGFB,KRAS,BCL2 blood coagulation E- 01 PRKAR2A,APP,RHOG,VEGFB,SRC,KRAS,DOCK1, GP1BA,TRPC3

6 .

7

8

9

10

Additional file 2 List of pathway from PID

Additional file 2 List of pathway from PID Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent

More information

Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points

Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP

More information

Pathways of changes in hypermethylation in F1 offspring exposed to intrauterine hyperglycemia

Pathways of changes in hypermethylation in F1 offspring exposed to intrauterine hyperglycemia Supplementary Table 1. Pathways of changes in hypermethylation in F1 offspring exposed to intrauterine hyperglycemia Pathway Enrichment Score (-log10[p value]) p-value genes Glycosaminoglycan degradation

More information

Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers

Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers ListHits ListTotal PopulationHits PopulationTotal Terms 3 72 10 1429 Glycolysis Pathway 3 72 11 1429 Regulation

More information

Principles of Genetics and Molecular Biology

Principles of Genetics and Molecular Biology Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a

More information

Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of

Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of 1 Supplementary material for: 2 3 4 5 6 Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of influenza A (H1N2) infection Louise Brogaard, Peter M. H. Heegaard, Lars

More information

Cell Cell Communication

Cell Cell Communication IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

More information

Cell Cell Communication

Cell Cell Communication IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

More information

Pathway Map Reference Guide

Pathway Map Reference Guide Pathway Map Reference Guide Focus Attention-grabber Your Pathway The most popular cell signaling pathways Sample & Assay Technologies Table of contents AKT Signaling 4 camp Signaling 5 Cellular Apoptosis

More information

Cell signaling. How do cells receive and respond to signals from their surroundings?

Cell signaling. How do cells receive and respond to signals from their surroundings? Cell signaling How do cells receive and respond to signals from their surroundings? Prokaryotes and unicellular eukaryotes are largely independent and autonomous. In multicellular organisms there is a

More information

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26 Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory

More information

Intercellular indirect communication

Intercellular indirect communication Intercellular indirect communication transmission of chemical signals: sending cell signal transmitting tissue hormone medium receiving cell hormone intercellular fluid blood neurocrine neurotransmitter

More information

THE HALLMARKS OF CANCER

THE HALLMARKS OF CANCER THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated

More information

CELL BIOLOGY - CLUTCH CH CELL JUNCTIONS AND TISSUES.

CELL BIOLOGY - CLUTCH CH CELL JUNCTIONS AND TISSUES. !! www.clutchprep.com CONCEPT: CELL-CELL ADHESION Cells must be able to bind and interact with nearby cells in order to have functional and strong tissues Cells can in two main ways - Homophilic interactions

More information

Identification of Tissue-Specific Protein-Coding and Noncoding. Transcripts across 14 Human Tissues Using RNA-seq

Identification of Tissue-Specific Protein-Coding and Noncoding. Transcripts across 14 Human Tissues Using RNA-seq Identification of Tissue-Specific Protein-Coding and Noncoding Transcripts across 14 Human Tissues Using RNA-seq Jinhang Zhu 1, Geng Chen 1, Sibo Zhu 1,2, Suqing Li 3, Zhuo Wen 3, Bin Li 1, Yuanting Zheng

More information

Supplementary Material. Part I: Sample Information. Part II: Pathway Information

Supplementary Material. Part I: Sample Information. Part II: Pathway Information Supplementary Material Part I: Sample Information Three NPC cell lines, CNE1, CNE2, and HK1 were treated with CYC202. Gene expression of 380 selected genes were collected at 0, 2, 4, 6, 12 and 24 hours

More information

2013 W. H. Freeman and Company. 12 Signal Transduction

2013 W. H. Freeman and Company. 12 Signal Transduction 2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure

More information

UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL. PhD THESIS

UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL. PhD THESIS UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL PhD THESIS THE IMPORTANCE OF TUMOR ANGIOGENESIS IN CEREBRAL TUMOR DIAGNOSIS AND THERAPY ABSTRACT PhD COORDINATOR: Prof. univ. dr. DRICU Anica PhD

More information

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

More information

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7

More information

Supplementary Files. Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis

Supplementary Files. Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis Supplementary Files Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis Lei Xin 1 *, M.D., Jun Gao 1 *, Ph.D., Dan Wang 1 *, M.D., Jin-Huan Lin 1, M.D., Zhuan Liao 1,

More information

Chapter 15: Signal transduction

Chapter 15: Signal transduction Chapter 15: Signal transduction Know the terminology: Enzyme-linked receptor, G-protein linked receptor, nuclear hormone receptor, G-protein, adaptor protein, scaffolding protein, SH2 domain, MAPK, Ras,

More information

Cellular Physiology (PHSI3009) Contents:

Cellular Physiology (PHSI3009) Contents: Cellular Physiology (PHSI3009) Contents: Cell membranes and communication 2 nd messenger systems G-coupled protein signalling Calcium signalling Small G-protein signalling o RAS o MAPK o PI3K RHO GTPases

More information

Synapse Formation. Steven McLoon Department of Neuroscience University of Minnesota

Synapse Formation. Steven McLoon Department of Neuroscience University of Minnesota Synapse Formation Steven McLoon Department of Neuroscience University of Minnesota 1 Course News Midterm Exam Monday, Nov 13 9:30-11:30am Bring a #2 pencil!! 2 Course News Lecture schedule: Mon (Oct 31)

More information

Supporting Information

Supporting Information Supporting Information Retinal expression of small non-coding RNAs in a murine model of proliferative retinopathy Chi-Hsiu Liu 1, Zhongxiao Wang 1, Ye Sun 1, John Paul SanGiovanni 2, Jing Chen 1, * 1 Department

More information

Cell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01

Cell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01 Cell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. For multiple choice questions,

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis

More information

Lecture 3: Cells and Tissues. Bio 219 Dr. Adam Ross

Lecture 3: Cells and Tissues. Bio 219 Dr. Adam Ross Lecture 3: Cells and Tissues Bio 219 Dr. Adam Ross Cell Physiology Cell Physiology Brief review of organelles Should be mostly review Cell surrounded by plasma membrane Lipid bilayer Also surrounds organelles

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/7/303/303ra139/dc1 Supplementary Materials for Magnetic resonance image features identify glioblastoma phenotypic subtypes with distinct molecular

More information

silent epidemic,. (WHO),

silent epidemic,. (WHO), Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining

More information

REACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation

REACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802

More information

BL 424 Chapter 15: Cell Signaling; Signal Transduction

BL 424 Chapter 15: Cell Signaling; Signal Transduction BL 424 Chapter 15: Cell Signaling; Signal Transduction All cells receive and respond to signals from their environments. The behavior of each individual cell in multicellular plants and animals must be

More information

NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc.

NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc. NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc. Cytokines Properties of Cytokines Cytokines are proteins with specific roles

More information

Dr Mahmood S Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering and Regenerative Medicine King Edward Medical University/Mayo

Dr Mahmood S Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering and Regenerative Medicine King Edward Medical University/Mayo Integration of Cells into Tissues Dr Mahmood S Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering and Regenerative Medicine King Edward Medical University/Mayo Hospital Lahore 1. How

More information

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236 Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine

More information

Virchow s Hypothesis lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation

Virchow s Hypothesis lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation Virchow s Hypothesis 1863 lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation Barrett s esophagus/ Esophageal adenocarcinoma PSC / Cholangiocarcinoma Viral hepatitis

More information

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,

More information

ground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were

ground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were Supplementary Figure 1. Characterization of EVs from intestine. (a, b) Intestinal tissues were ground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were isolated by

More information

Systems biology approaches and pathway tools for investigating cardiovascular disease

Systems biology approaches and pathway tools for investigating cardiovascular disease Systems biology approaches and pathway tools for investigating cardiovascular disease Craig E. Wheelock 1,2*, Åsa M. Wheelock 2,3,4, Shuichi Kawashima 5, Diego Diez 2, Minoru Kanehisa 2,5, Marjan van Erk

More information

Supplementary Figure 1:

Supplementary Figure 1: Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas

More information

LIX1 APOD RRM2 FAIM2 MGST1 UHRF1 PPIA BEX1

LIX1 APOD RRM2 FAIM2 MGST1 UHRF1 PPIA BEX1 C2orf80 1 C2orf80 A2M ANXA1 APOD ARL4A BEX1 C1S C3 CD44 CHI3L1 CHI3L2 CLU DPYD DSCAM EMP3 FN1 GBP1 GEM GLIPR1 GRIA2 IDH1 LIX1 MAP2 MDK MGST1 MIR3917 NAMPT PCMTD2 PPIA PTN PTPRZ1 S100B SCG3 SERPINA3 TCF12

More information

regulation of polarized membrane transport by rab GTPases Peter van der Sluijs;

regulation of polarized membrane transport by rab GTPases Peter van der Sluijs; regulation of polarized membrane transport by rab GTPases Peter van der Sluijs; p.vandersluijs@umcutrecht.nl cytotoxic T cell recognizes complex of viral peptide with MHC class I and kills infected cell

More information

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad

More information

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest

More information

* Kyoto Encyclopedia of Genes and Genomes.

* Kyoto Encyclopedia of Genes and Genomes. Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited

More information

Potential Role of Sphingosine 1-Phosphate in the. Pathogenesis of Rheumatoid Arthritis

Potential Role of Sphingosine 1-Phosphate in the. Pathogenesis of Rheumatoid Arthritis Potential Role of Sphingosine 1-Phosphate in the Pathogenesis of Rheumatoid Arthritis COMMENTARY for Zhao, C., Fernandes, M.J., Turgeon, M., Tancrede, S., Di Battista, J., Poubelle, P.E. and Bourgoin,

More information

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

More information

Brain Development III

Brain Development III Brain Development III Neural Development In the developing nervous system there must be: 1. The formation of different regions of the brain. 2. The ability of a neuron to differentiate. 3. The ability

More information

Deregulation of signal transduction and cell cycle in Cancer

Deregulation of signal transduction and cell cycle in Cancer Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324

More information

Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach

Impact of NM23-M1 knock-out on metastatic potential of hepatocellular carcinoma: a transgenic approach Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach NM23-M1 "knock- out" mice (without NDPK A) Experimental models of hepatocarcinogenesis Chemical

More information

Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt

Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt

More information

Thanks to: Signal Transduction. BCB 570 "Signal Transduction" 4/8/08. Drena Dobbs, ISU 1. An Aging Biologist s. One Biologist s Perspective

Thanks to: Signal Transduction. BCB 570 Signal Transduction 4/8/08. Drena Dobbs, ISU 1. An Aging Biologist s. One Biologist s Perspective BCB 570 "" Thanks to: One Biologist s Perspective Drena Dobbs BCB & GDCB Iowa State University Howard Booth Biology Eastern Michigan University for Slides modified from his lecture Cell-Cell Communication

More information

Contents. Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX

Contents. Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX Contents Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX 1 General Aspects of Signal Transduction and Cancer Therapy 1 1.1 General Principles of Signal Transduction

More information

BCM 226 LECTURE SALEMCITY, A.J

BCM 226 LECTURE SALEMCITY, A.J BCM 226 LECTURE SALEMCITY, A.J BIOLOGICAL MEMBRANE Biological membranes are composed of proteins associated with a lipid bilayer matrix. They are the molecular gateway to the cell. Viewed under electron

More information

11/8/16. Cell Signaling Mechanisms. Dr. Abercrombie 11/8/2016. Principal Parts of Neurons A Signal Processing Computer

11/8/16. Cell Signaling Mechanisms. Dr. Abercrombie 11/8/2016. Principal Parts of Neurons A Signal Processing Computer Cell Signaling Mechanisms Dr. Abercrombie 11/8/2016 Principal Parts of Neurons A Signal Processing Computer A Multitude of Synapses and Synaptic Actions Summation/Synaptic Integration 1 The Synapse Signal

More information

BIPN140 Lecture 13: Synapse Formation (Synaptogenesis)

BIPN140 Lecture 13: Synapse Formation (Synaptogenesis) BIPN140 Lecture 13: Synapse Formation (Synaptogenesis) 1. Neuromuscular Junction (NMJ) Development 2. Synaptogenesis at Central Synapses Su (FA16) Ultrastructural Image of an NMJ Active Zone Basal Lamina

More information

The Tissue Engineer s Toolkit

The Tissue Engineer s Toolkit The Tissue Engineer s Toolkit Stimuli Detection and Response Ken Webb, Ph. D. Assistant Professor Dept. of Bioengineering Clemson University Environmental Stimulus-Cellular Response Environmental Stimuli

More information

(A) Transgenic targeting vector that was electroporated into the ES cells for the

(A) Transgenic targeting vector that was electroporated into the ES cells for the Akbay et al 1 SUPPLEMENTARY MATERIAL Supplementary Figure 1. Generation of transgenic mice and IDH2 expression in R140 and R172K transgenic mice. (A) Transgenic targeting vector that was electroporated

More information

HOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade)

HOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade) HOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade) 1. Mesenchymal stem cells (MSC) cultured on extracellular matrices with different stiffness exhibit diverse lineage commitment

More information

Herpesviruses. Virion. Genome. Genes and proteins. Viruses and hosts. Diseases. Distinctive characteristics

Herpesviruses. Virion. Genome. Genes and proteins. Viruses and hosts. Diseases. Distinctive characteristics Herpesviruses Virion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics Virion Enveloped icosahedral capsid (T=16), diameter 125 nm Diameter of enveloped virion 200 nm Capsid

More information

Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds

Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds Supplementary figure legends Supplementary Figure 1 Fah + hepatocytes in a Fah -/- mouse transplanted with sorted cells. Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed

More information

QUIZ/TEST REVIEW NOTES SECTION 7 NEUROPHYSIOLOGY [THE SYNAPSE AND PHARMACOLOGY]

QUIZ/TEST REVIEW NOTES SECTION 7 NEUROPHYSIOLOGY [THE SYNAPSE AND PHARMACOLOGY] QUIZ/TEST REVIEW NOTES SECTION 7 NEUROPHYSIOLOGY [THE SYNAPSE AND PHARMACOLOGY] Learning Objectives: Explain how neurons communicate stimulus intensity Explain how action potentials are conducted along

More information

Computational Systems Biology: Biology X

Computational Systems Biology: Biology X Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#10:(November-22-2010) Cancer and Signals 1 1 Micro-Environment Story How does the rest of our body influences the cancer cell?

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

CXC chemokine (ligand/receptor)

CXC chemokine (ligand/receptor) List of abbreviations -MEM alpha-modified minimal essential AKT protein kinase B (also abbreviated PKB) AMC 7-amino-4-methylcoumarin AP-1 activator protein 1 ARF ADP-ribosylation factor, a small GTP-binding

More information

The Role of Microenvironment in the Control of Tumor Angiogenesis

The Role of Microenvironment in the Control of Tumor Angiogenesis The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,

More information

Lecture 14 - The cell cycle and cell death

Lecture 14 - The cell cycle and cell death 02.17.10 Lecture 14 - The cell cycle and cell death The cell cycle: cells duplicate their contents and divide The cell cycle may be divided into 4 phases The cell cycle triggers essential processes (DNA

More information

Molecular biology :- Cancer genetics lecture 11

Molecular biology :- Cancer genetics lecture 11 Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to

More information

Lipids and Membranes

Lipids and Membranes Lipids and Membranes Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Membrane transport D. Endocytosis and Exocytosis

More information

Table S7C- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 non-expressers

Table S7C- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 non-expressers Table S7C- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 non-expressers Terms ListHits ListTotal PopulationHits PopulationTotal Hypoxia and p53 in the Cardiovascular system

More information

Considering a new paradigm for Alzheimer s disease research a response

Considering a new paradigm for Alzheimer s disease research a response Considering a new paradigm for Alzheimer s disease research a response Martin Hofmann Apitius Department of Bioinformatics Fraunhofer Institute for Algorithms and Scientific Computing (SCAI) BioMed 21

More information

Animal Tissue Culture SQG 3242 Biology of Cultured Cells. Dr. Siti Pauliena Mohd Bohari

Animal Tissue Culture SQG 3242 Biology of Cultured Cells. Dr. Siti Pauliena Mohd Bohari Animal Tissue Culture SQG 3242 Biology of Cultured Cells Dr. Siti Pauliena Mohd Bohari The Culture Environment Changes of Cell s microenvironment needed that favor the spreading, migration, and proliferation

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

Advanced Cell Biology. Lecture 36

Advanced Cell Biology. Lecture 36 Advanced Cell Biology. Lecture 36 Alexey Shipunov Minot State University May 3, 2013 Shipunov (MSU) Advanced Cell Biology. Lecture 36 May 3, 2013 1 / 43 Outline Questions and answers Cellular communities

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our

More information

Tissue repair. (3&4 of 4)

Tissue repair. (3&4 of 4) Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid

More information

Tissue renewal and Repair. Nisamanee Charoenchon, PhD Department of Pathobiology, Faculty of Science

Tissue renewal and Repair. Nisamanee Charoenchon, PhD   Department of Pathobiology, Faculty of Science Tissue renewal and Repair Nisamanee Charoenchon, PhD Email: nisamanee.cha@mahidol.ac.th Department of Pathobiology, Faculty of Science Topic Objectives 1. Describe processes of tissue repair, regeneration

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression

Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Supplementary information for: Community detection for networks with. unipartite and bipartite structure. Chang Chang 1, 2, Chao Tang 2

Supplementary information for: Community detection for networks with. unipartite and bipartite structure. Chang Chang 1, 2, Chao Tang 2 Supplementary information for: Community detection for networks with unipartite and bipartite structure Chang Chang 1, 2, Chao Tang 2 1 School of Life Sciences, Peking University, Beiing 100871, China

More information

Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis

Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis MUDr. Jiří Vachtenheim, CSc. CELL CYCLE - SUMMARY Basic terminology: Cyclins conserved proteins with homologous regions; their cellular

More information

Guide to Signal Pathways in Immune Cells

Guide to Signal Pathways in Immune Cells Guide to Signal Pathways in Immune Cells E. Nigel Wardle, MD Guide to Signal Pathways in Immune Cells E. Nigel Wardle The Royal Society of Medicine London, W1G 0AE United Kingdom nigel@edwinwardle.freeserve.co.uk

More information

Supplementary Figure 1. PCA separated RA and OA FLS isolated from (a) knees and (b) hips. by corresponding DMLs.

Supplementary Figure 1. PCA separated RA and OA FLS isolated from (a) knees and (b) hips. by corresponding DMLs. Supplementary Figure 1. PCA separated RA and OA FLS isolated from (a) knees and (b) hips by corresponding DMLs. Supplementary Table 1. Enriched biological pathways identified between 19 RA and 5 OA in

More information

Generation of post-germinal centre myeloma plasma B cell.

Generation of post-germinal centre myeloma plasma B cell. Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused

More information

Chapter 3 The Induced Responses of Innate Immunity

Chapter 3 The Induced Responses of Innate Immunity Chapter 3 The Induced Responses of Innate Immunity Pattern recognition by cells of the innate immune system Pattern recognition by cells of the innate immune system 4 main pattern recognition receptors

More information

ROLE OF INFLAMMATION IN HYPERTENSION. Dr Barasa FA Physician Cardiologist Eldoret

ROLE OF INFLAMMATION IN HYPERTENSION. Dr Barasa FA Physician Cardiologist Eldoret ROLE OF INFLAMMATION IN HYPERTENSION Dr Barasa FA Physician Cardiologist Eldoret Outline Inflammation in CVDs the evidence Basic Science in Cardiovascular inflammation: The Main players Inflammation as

More information

INTEGRIN SIGNALLING DURING TUMOUR PROGRESSION

INTEGRIN SIGNALLING DURING TUMOUR PROGRESSION INTEGRIN SIGNALLING DURING TUMOUR PROGRESSION Wenjun Guo and Filippo G. Giancotti Abstract During progression from tumour growth to metastasis, specific integrin signals enable cancer cells to detach from

More information

The Role of micrornas in Pain. Phd Work of: Rehman Qureshi Advisor: Ahmet Sacan

The Role of micrornas in Pain. Phd Work of: Rehman Qureshi Advisor: Ahmet Sacan The Role of micrornas in Pain Phd Work of: Rehman Qureshi Advisor: Ahmet Sacan 1 Motivation for molecular analysis of Pain Chronic pain one of the most common causes for seeking medical treatment Approximate

More information

Independent Study Guide The Innate Immune Response (Chapter 15)

Independent Study Guide The Innate Immune Response (Chapter 15) Independent Study Guide The Innate Immune Response (Chapter 15) I. General types of immunity (Chapter 15 introduction) a. Innate i. inborn ii. pattern recognition b. Adaptive i. "learned" through exposure

More information

Growth and Differentiation Phosphorylation Sampler Kit

Growth and Differentiation Phosphorylation Sampler Kit Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit

More information

Basis of Immunology and

Basis of Immunology and Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie

More information

EGF receptor transactivation is crucial for cholinergic MAP kinase signaling in human keratinocytes

EGF receptor transactivation is crucial for cholinergic MAP kinase signaling in human keratinocytes 1st Electronic Conference on Molecular Science EGF receptor transactivation is crucial for cholinergic MAP kinase signaling in human keratinocytes Wymke Ockenga, Sina Kühne, Antje Banning and Ritva Tikkanen

More information

Laura Smart 9/22/2011

Laura Smart 9/22/2011 Laura Smart 9/22/2011 Fibrosis is a wound healing response in which damaged regions are encapsulated by an extracellular matrix or scar. Fibrosis develops in almost all patients with chronic liver injury

More information

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma

More information

Fc receptors, phagocytosis role 128

Fc receptors, phagocytosis role 128 Subject Index Adaptive immunity dependence on innate immunity 9, 10 evolution 10 Aging anti-inflammatory agents in counteraction 202 beneficial polymorphisms 199 201 definition 18, 189 innate immunity

More information