Supplementary figure 1 (related to fig 1)
|
|
|
- Cuthbert Fletcher
- 5 years ago
- Views:
Transcription
1 Histological score linical Score Weight loss (%) olon length (cm) Supplementary figure (related to fig ) N ### ## ays on % E ### N ays on % $$ $$ # ## N. N N Supplementary figure : Lack of fibre in diet aggravates the development of colitis while high fibre and normal chow are protective -. linical score (), weight loss (), colon length () and histological score () were determined in mice fed on (n= mice), normal chow (N, n= mice) and diets (n= mice) for one week prior to days treatment with %. E. Representative H&E stained colonic sections of the mice fed on N, and prior and during days treatment with %. The results are shown as mean ± s.e.m and the experiment has been repeated twice. With p<., p<., p<. determined as group effect by NOV, # p<., ## p<., ### p<., p<. comparing N vs and $$ p<. comparing N to by Tukey s multiple comparison analysis, and p=., p<., p<. and p<. determined by t-test. Scale bar = m.
2 olon length (cm) Histological score Serum acetate concentration (mm) linical score Weight loss (%) Supplementary figure (related to fig ) 7 ays on the diet ays on % E ays on % # p=. F HO HO HO Supplementary figure : Lack of fibre in diet aggravates the development of colitis while diet enriched in resistant starch is protective. Serum acetate measured in serum of n= pooled mice fed on or resistant starch () diets for 7 and days. -E. linical score (), weight loss (), colon length () and histological score (E) were determined in mice fed on (n=) and (n=) for one week prior and during days treatment with %. F. Representative H&E stained colonic sections of the mice fed on and prior and during treatment with HO or %. The results are shown as mean ± s.e.m and the experiment has been repeated twice. The results are shown as mean±sem and the experiment has been repeated twice.. With p<., p=., p<. determined as group effect by NOV, # p<., p<. by onferroni s multiple comparison analysis and p<., p<. and p<. determined by t-test. Scale bar = m.
3 Weight loss (%) Weight loss (%) Supplementary figure (related to fig ) ays on % Gpr -/- Gpr -/ Gpr -/- - Gpr -/- - ays on % Gpr9 -/- Gpr9 -/- - - Gpr9 -/- - Gpr9 -/- - Supplementary figure : GPR and GPR9 are involved in the protective effect of high fibre diet from colitis,. Weight loss was determined in Gpr -/- () and in Gpr9 -/- () mice either fed on or on diets for a week prior to days of treatment with %.,. Representative H&E stained colonic in untreated Gpr -/- () and in Gpr9 -/- mice () fed on or on diet. The results are shown as mean ± s.e.m of n= mice per group and the experiment repeated twice. With p<., p<. and p<. determined by t-test. Scale bar = m.
4 olon length (cm) Histological score Supplementary figure (related to fig ) p=.7 LM into Gpr -/- LM into Gpr -/- water LM into Gpr -/- water LM into Gpr -/- LM into Gpr -/- Gpr -/- M into L water Gpr -/- M into L Gpr -/- M into L water Gpr -/- M into L Gpr -/- M into Gpr -/- - LM into L LM into Gpr -/- LM into Gpr -/- LM into Gpr -/- Gpr -/- M into L Gpr -/- M into L LM into L Gpr -/- M into Gpr -/- Gpr -/- M into L Gpr -/- M into L Supplementary figure : Expression of GPR in the non-hematopoietic compartment is necessary for the beneficial effects of high-fibre feeding in the colitis model.. olon length, and. histological score were determined in irradiated Gpr -/- mice reconstituted with bone marrow (M) cells (LM into Gpr -/- ) fed on (n=) or on (n=) diet, in irradiated mice reconstituted with Gpr -/- M cells (Gpr -/- M into L) fed (n=) or on diet (n=), in irradiated mice reconstituted with M cells (LM into L) fed on (n=) and in irradiated Gpr -/- mice reconstituted with Gpr -/- M cells (Gpr -/- M into Gpr -/- ) fed (n=) for a week and during the days treatment with % or water.. Representative H&E stained colonic sections of high-fibre fed irradiated Gpr -/- mice reconstituted with bone marrow cells (LM into Gpr -/- ), zero-fibre fed irradiated Gpr -/- mice reconstituted with bone marrow cells (LM into Gpr - /- ), high fibre fed mice reconstituted with Gpr -/- bone marrow cells (Gpr -/- M into L ) and zero fibre fed mice reconstituted with Gpr -/- bone marrow cells (Gpr -/- M into L ) treated with water. The results are shown as mean ± s.e.m. With p=.7, p<. p<., p<. and p<. determined by t-test. Scale bar = m.
5 linical score olon length (cm) Histological score Supplementary figure (related to fig ) Gpr9 -/- M into L Gpr9 -/- M into L ays on % HO -HO - -HO Supplementary figure : Expression of GPR9 in the hematopoietic compartment is not necessary for the beneficial effects of high-fibre feeding in colitis -. linical score (), colon length () and histological score () of irradiated mice reconstituted with Gpr9 -/- bone marrow (M) cells fed on (Gpr9 -/- M into L), or on (Gpr9 -/- M into L ) diets for a week prior to days treatment with %.. Representative H&E stained colonic sections fed mice reconstituted with Gpr9 -/- M cells and fed mice reconstituted with Gpr9 -/- M cells () treated with % for days a week after the start of the diet. The results are shown as mean ± s.e.m of n= mice in water groups and n= mice in treated groups. With p<. determined as group effect by NOV, p<. by Tukey s multiple comparison analysis and with p<., p<. determined by t-test. Scale bar = m.
6 olon length (cm) Supplementary figure (related to fig ) Nlrp -/- Nlrp -/- Nlrp -/- Supplementary figure : Expression of NLRP is not necessary for the beneficial effects of high fibre feeding in colitis. Representative H&E stained colonic sections of and Nlrp -/- mice fed on and prior to treatment with %.. olon length measured from mice fed on or on diets and from Nlrp -/- mice fed on or on diets prior to days treatment on %. The results are shown as mean ± s.e.m of n= mice per group. With p<. and p<. as determined by t-test. Scale bar = m.
7 verage clinical sore linical score Percent weight change Number of tumors per colon Tumor size (mm) model Supplementary figure 7 (related to fig ) tumor number (total) publication polyp size I dr Gpr -/- 7 ay Gpr -/- Gpr -/- E () (LF) Gpr -/- Gpr -/- Gpr -/- () Gpr -/- (LF) Supplementary figure 7. High fibre feeding protects from colon cancer through GPR. Weight loss measurement in (n= mice) and in Gpr -/- mice (n= mice) injected once with OM (at day ) prior to three rounds of.% for days (as indicated), with weeks recovery in between. -. Number () and diameter () of macroscopic polyps () determined at the endpoint. E. ancer clinical score in and in Gpr -/- mice fed on or diets. Results are shown as the mean ± s.e.m. With p<. determined by two-way NOV as a group effect and p<., p <., p<. as determined by t-test.
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
SUPPLEMENTARY INFORMATION
a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages
Gut microbiota, bacterial metabolites and metabolite sensing GPCRs protect against food allergy
Gut microbiota, bacterial metabolites and metabolite sensing GPCRs protect against food allergy Laurence Macia, PhD 5 th European Immunology & Innate Immunity Increased prevalence of inflammatory diseases
Supplemental Materials
Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 NLRP12 is downregulated in biopsy samples from patients with active ulcerative colitis (UC). (a-g) NLRP12 expression in 7 UC mrna profiling studies deposited in NCBI GEO database.
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
Grade of steatosis. group Case No. Supplementary Figure 1:
a Supplementary Figure 1: b group Case No Grade of steatosis 15m AL 2746 NN 1 15m AL 2746 BN 1 15m AL 2638 2LN 3 15m AL 2638 2RN 3 12m AL 2640 RN 0 12m AL 2640 BN 1 12m AL 2640 LN 2 12m AL 2635 NN 2 12m
D CD8 T cell number (x10 6 )
IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p
Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.
C D E F Mock 17 Mock 4.1 CD38 57 CD8 23.7 HLA-DR Ki67 G H I Cheng et al. Fig.S1 Supplementary Figure 1. persistent infection leads to human T cell depletion and hyper-immune activation. Humanized mice
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance
Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather
Supplementary Material
Supplementary Material Fig. S1. Gpa33 -/- mice do not express Gpa33 mrna or GPA33 protein. (A) The Gpa33 null allele contains a premature translational stop codon (STOP) in exon 2, and almost all of the
Supplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
SUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
Formula A: Percentage Wound Closure: % C = percentage wound closure, A0 = Area of wound at day 0, Ai = Area of wound at 7 days.
Formulae for Wound Closure and Stereology (15, 16, 20) Formula A: Percentage Wound Closure: % C = percentage wound closure, A0 = Area of wound at day 0, Ai = Area of wound at 7 days. A0 Ai 100 %C = x A0
pro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki
a TMRM FI (Median) b TMRM FI (Median) c 20 15 10 5 0 8 6 4 2 0 pro-b large pre-b small pre-b 0 10 20 30 40 50 60 70 80 90 100 TMRM (nm) pro-b large pre-b small pre-b 0 1 2 4 8 16 32 64 128 256 CCCP (mm)
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
Nature Medicine doi: /nm.3150
Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
Chronic variable stress activates hematopoietic stem cells
SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
The Enzyme Cyp26b1 Mediates Inhibition of Mast-Cell Activation by Fibroblasts to Maintain Skin-Barrier Homeostasis
Immunity, Volume Supplemental Information The Enzyme yp6b1 Mediates Inhibition of Mast-ell ctivation by Fibroblasts to Maintain Skin-Barrier Homeostasis Yosuke Kurashima, Takeaki miya, Kumiko Fujisawa,
Supplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
Reviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): The manuscript by Sun et al., provide data showing that short-chain fatty acids produced by intestinal microbiota act through GPR43 to induced
Tissue factor-par2 signaling promotes diet-induced obesity and adipose
Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya
Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.
Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50
Pearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
Supplementary Materials
Supplementary Materials Supplementary figure 1. Taxonomic representation summarized at genus level. Fecal microbiota from a separate set of Jackson and Harlan mice prior to irradiation. A taxon was included
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
Appendix Figure S1 A B C D E F G H
ppendix Figure S1 C D E F G H ppendix Figure S1. RT and chemotherapy alter PD-L1 expression in PDC cells. Flow cytometric analysis of PD-L1 expression in () KPC and () Pan02 cells following treatment with
SUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients
SUPPLEMENTARY INFORMATION CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative breast cancer patients Lefort S. 1,2, Thuleau A. 3, Kieffer Y. 1,2, Sirven P. 1,2, Bieche I. 4, Marangoni E.
Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
Supplementary Material
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2018 Supplementary Material 1 Supplemental Figures Supplemental Figure S1. Mechanical properties
1. Supplementary Prevention Experiment Additional Results
1. Supplementary 1. 1. Prevention Experiment Additional Results Figure 1 presents the NMR measurements of tibiae and femurs bones, which were measured 6 weeks post operation at the central zone of bone
islets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
SDC (Supplemental Digital Content) Figure S1. Percentages of Granzyme B expressing CD8 + T lymphocytes
Figure S1. Percentages of Granzyme expressing D8 + T lymphocytes 13.5% 1.4%.6% 77% 21% 24% 76% 8 8 Granzyme + (%) 6 4 2 Granzyme + (%) 6 4 2 D8 + Tnaive Tcm Tem Temra D8 + D8 + D28 + D8 + D28 null We analyzed
(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,
1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of
Supplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol
ell Metabolism, Volume 7 Supplemental Information The Hormone Stimulates Water Drinking in Response to Ketogenic Diet and lcohol Parkyong Song, hristoph Zechner, Genaro Hernandez, José ánovas, Yang Xie,
a b c periosteum parietal bone bone marrow dura periosteum suture mesenchyme osteogenic front suture mesenchyme 1
coronary suture sagittal suture DOI: 10.1038/ncb3139 a b c e parietal bone suture mesenchyme parietal bone bone marrow ura ura ura f parietal bone ura suture mesenchyme bone g ura osteogenic front suture
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
Supplementary Figure 1
Supplementary Figure 1 # nonsynonymous mutations (tngs, 1561 genes) 600 p=0.056 500 250 200 150 100 50 0 HLA-DR (-) HLA-DR (+) Supplementary Figure 1: HLA-DR(+) melanoma cell lines are associated with
Supplemental Data Tamoxifen administration to Vil-Scap- mice.
Supplemental Data FIGURE S1. Tamoxifen administration to Vil-Scap - mice. In the experiments shown in Fig. 1 to Fig. 5, tamoxifen (2 mg per dose) was dissolved in corn oil and administered by orogastric
Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic
COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06310 SUPPLEMENTARY INFORMATION www.nature.com/nature 1 www.nature.com/nature 2 www.nature.com/nature 3 Supplementary Figure S1 Spontaneous duration of wake, SWS and REM sleep (expressed
Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A
Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for
Dietary Zinc Alters the Microbiota and Decreases Resistance to Clostridium difficile Infection
1 Dietary Zinc Alters the Microbiota and Decreases Resistance to Clostridium difficile Infection 2 3 4 5 Joseph P. Zackular 1, Jessica L. Moore 2,3, Ashley T. Jordan 1, Lillian J. Juttukonda 1, Michael
Supplemental Digital Content 1. Endoscopic and histolological findings in INR and FR study subjects
Supplemental Digital Content 1. Endoscopic and histolological findings in INR and FR study subjects Patient Group Macroscopic examination Ileum Histology Colon/rectum Histology 1 INR Normal Acute and chronic
Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment
Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia
Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
Canberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were
Supplemental Materials and Methods Mice Female C57BL/6 (B6, I-E null, H-2 b ), BALB/c (H-2 d ) + ), FVB/N (H-2 q, I-E null, CD45.1 + ), and B6D2F1 (H-2 b/d ) mice were purchased from the Animal Resources
Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless
University of Ulsan College of Medicine, Seoul 05505, Republic of Korea.
Nanoparticle-Assisted Transcutaneous Delivery of a Signal Transducer and Activator of Transcription 3-Inhibiting Peptide Ameliorates Psoriasis-like Skin Inflammation Jin Yong Kim 1,5, Jinhyo Ahn 3,4, Jinjoo
Supplemental Information. Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection. Cell Host & Microbe, Volume 15
Cell Host & Microbe, Volume 15 Supplemental Information Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection Arya Khosravi, Alberto Yáñez, Jeremy G. Price, Andrew Chow, Miriam Merad, Helen
Expanded View Figures
Gregory T Ellis et al Lung damage by monocyte TRIL allows coinfection EMO reports Expanded View Figures % survival Clinical score Influenza Matrix /HPRT (log ) CFU/L (log ) 3 irway early.7.7 + h Survival
NMED-A65251A. Supplementary Figures.
NMED-A65251A Supplementary Figures. Sup. Fig. 1. ILC3 cells are the main source of in obese mice a. We gated on T cells (upper panels) or T cells (lower panels), and examined production. b. CD45 + - IL-13
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Nature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
Balancing intestinal and systemic inflammation through cell type-specific expression of
Supplementary Information Balancing intestinal and systemic inflammation through cell type-specific expression of the aryl hydrocarbon receptor repressor Olga Brandstätter 1,2,6, Oliver Schanz 1,6, Julia
The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
Supplementary information
Supplementary information Supplementary Figure S1: Ex[Ca 2+ ]-induced IL-1ß production of monocytes primed with different TLR ligands IL-1ß release of CD14+ monocytes in response to stimulation for 16
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Supplementary Figure 1. Successful excision of genes from WBM lysates and
Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was
Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8
1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,
Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation
SUPPLEMENTARY INFORMATION Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation Samantha Arokiasamy 1,2, Christian Zakian 1, Jessica Dilliway
SUPPLEMENTARY RESULTS
SUPPLEMENTARY RESULTS Supplementary Table 1. hfpr1- Flpln-CHO hfpr2-flpln-cho pec 50 E max (%) Log( /K A) Log( /K A) N pec 50 E max (%) Log( /K A) Log( /K A) n ERK1/2 phosphorylation fmlp 9.0±0.6 80±7
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of
SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI
Supplementary Fig. 1: TBR2+ cells in different brain regions.
Hip SVZ OB Cere Hypo Supplementary Fig. 1: TBR2 + cells in different brain regions. Three weeks after the last tamoxifen injection, TBR2 immunostaining images reveal a large reduction of TBR2 + cells in
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
Control 7 d cold 7 d CL
Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with
Acquisition of Radiation Resistant Ability in Non- Irradiated Cells by Secreted Factors from Low Dose Irradiated Cells
Nagoya University Acquisition of Radiation Resistant Ability in Non- Irradiated Cells by Secreted Factors from Low Dose Irradiated Cells Jun Kumagai a *, Akane Oohashi b and Genro Kashino c a Institute
Supplementary Table 1: LP/J C57BL/6 cgvhd scoring. Each category: coat
Supplementary Tables Supplementary Table 1: LP/J C57BL/6 cgvhd scoring. Each category: coat condition, skin condition, weight, posture, mobility, and vitality are individually scored and summed to achieve
* * * * Supplementary Figure 1. DS Lv CK HSA CK HSA. CK Col-3. CK Col-3. See overleaf for figure legend. Cancer cells
Supplementary Figure 1 Cancer cells Desmoplastic stroma Hepatocytes Pre-existing sinusoidal blood vessel New blood vessel a Normal liver b Desmoplastic HGP c Pushing HGP d Replacement HGP e f g h i DS
Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced
Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis implicating regulation of energy metabolism Xu-Guang Jiang 1,2,, Kai Sun 1,3,4,5,, Yu-Ying Liu 1,4,5, Li Yan 1,4,5,
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;
Two projects. Innate immunity, human gene6cs and resistance to infec6on. HAMLET; a new type of tumor- killing molecular complex
Two projects Innate immunity, human gene6cs and resistance to infec6on HAMLET; a new type of tumor- killing molecular complex Innate immune signaling Toxins d Capsule Metabolic genes Metalbinding proteins
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed
Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c)
1 Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c) Serum IgG1 (a), IgM (b) and IgG2 (c) concentrations in response to papain immediately before primary immunization (day
Acute and Delayed Effects of ARS: An Animal Model Research Platform to Assess Efficacy of Medical Countermeasures
Acute and Delayed Effects of ARS: An Animal Model Research Platform to Assess Efficacy of Medical Countermeasures Thomas J. MacVittie, Ph.D. Ann M. Farese, M.S. Melanie Cohen, B.A. Allison Gibbs, B.S.
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
ASSUMPTIONS AND DETAILS OF CALCULATIONS FOR FATTY ACID KINETICS
1 1 1 1 1 1 0 1 ASSUMPTIONS AND DETAILS OF CALCULATIONS FOR FATTY ACID KINETICS Our hypothesis was that many sources of palmitate (NEFA, lipogenesis, diet) could contribute to newly-synthesized VLDL-TG
Know Your Feed What to feed when and why. Ian Williams, Forage Specialist, Pioneer Brand Products
Know Your Feed What to feed when and why Ian Williams, Forage Specialist, Pioneer Brand Products 3 Basic Truths Truth 1: NZ nutrition is not that complicated Truth 2: Most NZ cows lack 1 thing Truth 3:
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,