Supporting Materials for a 31-Day Study of Cobalt(II)chloride Ingestion in Humans: Pharmacokinetics and Clinical Effects
|
|
- Jared Byrd
- 5 years ago
- Views:
Transcription
1 Supporting Materials for a 31- Study of Cobalt(II)chloride Ingestion in Humans: Pharmacokinetics and Clinical Effects Brent L. Finley a, Kenneth M. Unice b, Brent D. Kerger c, Joanne M. Otani a, Dennis J. Paustenbach a, David A. Galbraith a, and Brooke E. Tvermoes d a Cardno ChemRisk, 11 2nd St. Suite 7, San Francisco, CA 9415, United States; b Cardno ChemRisk, 2 Stanwix St. Suite 5, Pittsburgh, PA 15222, United States; c Cardno ChemRisk, 13 Vantis Suite 17, Aliso Viejo, CA United States; d Cardno ChemRisk, 48 Pearl East Circle, Boulder, CO 831, United States. Supplement Table of Contents TABLES Table S1 Table S2 Table S3 Table S4 Table S5 Table S6 Whole Blood Cobalt Measurements (µg/l) Following Dietary Supplementation with 1 mg Co Daily for an Average of 31 s. Serum Cobalt Measurements (µg/l) Following Dietary Supplementation with 1 mg Co Daily for an Average of 31 s. Cobalt Serum Measurements for Select s. Computed Parameters Describing the Retention of Co in Whole Blood and Serum. Blood Clinical Indices for Females. Blood Clinical Indices for Males. FIGURES Figure S1 Figure S2 Figure S3 Figure S4 Figure S5 Figure S6 Figure S7 Figure S8 Figure S9 Figure S1 Figure S11 Figure S12 Figure S13 Figure S14 Figure S15 Figure S16 Figure S17 Figure S18 Figure S19 Figure S2 Figure S21 Time Course of the Average Whole Blood and Serum Cobalt Measurements Following Dietary Supplementation with Approximately 1. mg Co/day for an Average of 31 days. Relationship Between Whole Blood and Serum Cobalt Concentration During Dosing. Time Course of Estimated RBC Concentration Categorized by Gender Red Blood Cell (RBC) Counts for Each Participant Throughout the Study. Serum Thyroid Stimulating Hormone (TSH) Levels for Each Participant Throughout the Study. Serum Tree Thyroxine (T4) Levels for Each Participant Throughout the Study. Albumin Concentrations for Each Participant Throughout the Study. Total Protein Concentrations for Each Participant Throughout the Study. White Blood Cell (WBC) Counts for Each Participant Throughout the Study. Hematocrit (Hct) Percentages for Each Participant Throughout the Study. Hemoglobin (Hgb) Concentrations for Each Participant Throughout the Study. Total Iron Concentrations for Each Participant Throughout the Study. Ferritin Concentrations for Each Participant Throughout the Study. Creatine Kinase-Myocardial Band (CK-MB) concentrations for Each Participant Throughout the Study. Alanine Aminotransferase (ALT) Concentrations for Each Participant Throughout the Study. Aspartate Aminotransferase (AST) Concentrations for Each Participant Throughout the Study. Creatinine Concentrations for Each Participant Throughout the Study. Glucose Concentrations for Each Participant Throughout the Study. Normalized Lymphocyte Proliferation Response to Various Metals Before and After Co Dietary Supplementation with Approximately 1 mg Co/day Time Course of Observed Whole Blood Cobalt Measurements Compared to Cobalt Biokinetic Model Predictions. Effect of 12-Month Whole Blood or RBC Donation Frequency on the Geometric Mean of Plasma. 1
2 Table S1. Whole Blood Cobalt Measurements (µg/l) Following Dietary Supplementation with 1 mg Co Daily for an Average of 31 s. Study 1 wk Predose Pre-dose/ 1 4/5 8/9 14/16 23/24 29/33 1 wk Postdose 2 wk Postdose 6 wk Postdose 1 wk Post-dose Males A <.5 < B <.5 < d d d C <.5 < d d d D <.5 < d d d E <.5 < Average wk Post-dose Females F.5 < G <.5 <.5 a d d d H I b < / 6.3 c d d d J a a d d d Average a Missing data (-) due to error in specimen collection and/or processing. b Missing data (-) due to volunteer being unavailable for blood draw appointment. c provided both a 29 and 33 blood draw because she continued to ingest supplement after 29, which was initially scheduled to be the last day of dosing. Dosing ceased on 33. d did not participate in the additional 6 wk, 1 wk and 16 wk post-dose follow up blood draws. 2
3 Table S2. Serum Cobalt Measurements (µg/l) Following Dietary Supplementation with 1 mg Co Daily for an Average of 31 s. Study 1 wk Predose Pre-dose/ 1 4/5 8/9 14/16 23/24 29/33 1 wk Postdose 2 wk Postdose 6 wk Postdose 1 wk Post-dose Males A <1. < B <1. < d d d C <1. < a d d d D <1. < d d d 16 wk Post-dose E <1. < Average Females F a < G <1. < d d d H <1. < a I b < / 8.2 c d d d J a a a a d d d Average a Missing data (-) due to error in specimen collection and/or processing. b Missing data (-) due to volunteer being unavailable for blood draw appointment. c provided both a 29 and 33 blood draw because she continued to ingest supplement after 29, which was initially scheduled to be the last day of dosing. Dosing ceased on 33. d did not participate in the additional 6 wk, 1 wk, and 16 wk post-dose follow up blood draws. 3
4 Table S3. Cobalt Serum Measurements for Select s. Co serum samples analyzed by Quest Diagnostics were sent to a third party analytical lab for Co analysis. In general, there was good agreement between the Co concentrations reported by the two laboratories. Study Study Date Outside Laboratory Concentration (µg/l) Quest Concentration (µg/l) E 29/ H 29/ H 23/ C 1 wk post-dose I 2 wk post-dose B 2 wk post-dose F 2 wk post-dose G 2 wk post-dose J 2 wk post-dose D 2 wk post-dose
5 Table S4. Computed Parameters Describing the Retention of Co in Whole Blood and Serum. The rate of Co elimination from whole blood and serum fit best to a two-phase exponential decay model with a biologic half-life of T 1 andt 2 for the fast and slow elimination phase, respectively. The elimination rate constant for phase one and phase two of the model is represented by λ 1 and λ 2, respectively. The fraction eliminated by each component of the model is represented by a 1 and a 2, respectively. Based on the reporting limits of the assay and known background concentrations of Co in serum and whole blood of unexposed individuals, we set the constraints of the exponential decay curve to plateau at.5 µg/l and.4 µg/l for Co in whole blood and serum, respectively, in order to calculate an approximate elimination half-life. Matrix Whole blood a 1 (unitless) λ 1 (day -1 ) T 1 (days) a 2 (unitless) λ 2 (day -1 ) T 2 (days) A H E F Serum A H E F Whole Blood Average Serum Average
6 Table S5. Blood Clinical Indices for Females. Data are represented as the mean ± standard deviation of individual results. Student s two-tailed paired t-test was used to assess the effects of dietary Co supplementation on blood chemical indices, and significant differences were not observed unless noted by superscript b. When calculating the mean, one-half of the reporting limit was used for values reported to be less-than the reporting limit. Parameter Unit Average Baseline (n = 9) 14/16 (n = 5) 29/33 (n = 5) 1 wk post-dose (n = 5) 2 wk post dose (n = 5) Reference Range* Albumin U/L 4.5 ± ± ± ±.18 b 4.4 ±.8 b Total Protein mg/dl 7.2 ± ± ± ± ±.23 b WBC 1 3 /μl 5.77 ± ± ± ± ± RBC 1 6 /μl 4.42 ± ± ± ± ± Hct % 39.8 ± ± ± ± ± Hgb g/dl 13.2 ± ± ± ± ± TSH mlu/l 2.27 ± ± ± ± ± Free T4 ng/ml 1.4 ± ± ± ± ± Total Iron μg/dl 12 ± 28.3 c 72.4 ± ± ± 28.9 b 86.8 ± Ferritin ng/ml 26 ± ± 1.6 b 16.6 ± 11.4 b 14.8 ± 1.5 b 17. ± 11.2 b CK-MB ng/ml.93 ± ± ±.19. ± ±.6-5. ALT U/L 12.7 ± ± ± 1.48 b 1. ± 3. b 12.4 ± AST U/L 15.2 ± ± ± ± ± Creatinine mg/dl.79 ±.9.85 ±.6.81 ±.8.85 ±.1.81 ± HDL Cholesterol mg/dl 66.4 ± ± Total Cholesterol mg/dl 2 ± ± Triglycerides mg/dl 12 ± ± <1 Glucose mg/dl 91.6 ± ± ± ± ± *The reference range is defined as the minimum and the maximum reference value from Quest Diagnostic Laboratories as determined in adult females. a Individual baseline values for 1 wk pre-dose and pre-dose/day 1 draw were averaged unless otherwise noted. b Significant difference in blood chemical indices before and after Co dosing at specific time point (p <.5), however the mean value after dosing was within the reference range. c The average baseline is the mean ± SD of the 1 wk pre-dose draw because there was a significant difference between the 1 wk pre-dose draw and the pre-dose/ day 1 draw; as such the two baseline values were not averaged. 6
7 Table S6. Blood Clinical Indices for Males. Data are represented as the mean ± standard deviation of individual results. Student s two-tailed paired t-test was used to assess the effects of dietary Co supplementation on blood chemical indices, and significant differences were not observed unless noted by superscript b. When calculating the mean, one-half of the reporting limit was used for values reported to be less-than the reporting limit. Parameter Unit Average Baseline (n = 1) 14/16 (n = 5) 29/33 (n = 5) 1 wk post-dose (n = 5) 2 wk post dose (n = 5) Reference Range* Albumin U/L 4.7 ± ± ± ± ± Total Protein mg/dl 7.1 ± ± ± ± ± WBC 1 3 /μl 4.91 ± ± ± ± ± RBC 1 6 /μl 4.62 ± ± ± ±. b 4.63 ± Hct % 43.2 ± ± ± ± 2.9 b 43.3 ± Hgb g/dl 14.4 ± ± ± ± 1.15 b 14.5 ± TSH mlu/l 2.8 ± ± ± ± ± Free T4 ng/ml 1.28 ±.16 c 1.35 ± ± ±.18 b 1.24 ± Total Iron μg/dl 113 ± ± 23.4 b 67.4 ± 11.6 b 11 ± ± Ferritin ng/ml 18 ± 13 c 142 ± 94.9 b 156 ± ± ± 82.1 b 2-38 CK-MB ng/ml 1.7 ± ± ± ± ± ALT U/L 36.4 ± ± ± ± ± AST U/L 25.9 ± ± 4.88 b 23.6 ± ± 4.83 b 23. ± Creatinine mg/dl 1.6 ± ± ± ± ± HDL Cholesterol mg/dl 54.8 ± ± Total Cholesterol mg/dl 198 ± ± Triglycerides mg/dl 261 ± ± <1 Glucose mg/dl 9.3 ± ± ± ± ± *The reference range is defined as the minimum and the maximum reference value from Quest Diagnostic Laboratories as determined in adult females. a Individual baseline values for 1 wk pre-dose and pre-dose/day 1 draw were averaged unless otherwise noted. b Significant difference in blood chemical indices before and after Co dosing at specific time point (p <.5), however the mean value after dosing was within the reference range. c The average baseline is the mean ± SD of the 1 wk pre-dose draw because there was a significant difference between the 1 wk pre-dose draw and the pre-dose/ day 1 draw; as such the two baseline values were not averaged. 7
8 Cobalt Concentration ( g/l) Cobalt Concentration ( g/l) Figure S1. Time Course of the Average Whole Blood and Serum Cobalt Measurements Following Dietary Supplementation with Approximately 1. mg Co/day for an Average of 31 s. A. Average Co Whole Blood ( ) and Serum Concentrations ( ) in Males. B. Average Co Whole Blood ( ) and Serum ( ) Concentrations in Females. The error bars represent the standard error of Co whole blood or serum concentration. A) Males 8 Whole Blood Serum // // Elapsed Time Since Beginning of Dosing (s) 8 B) Females Whole Blood Serum 6 // 2 // Elapsed Time Since Beginning of Dosing (s) 8
9 Cobalt Serum (µg/l) Figure S2 Relationship Between Whole Blood and Serum Cobalt Concentration During Dosing y = 1.392x R² = Cobalt Whole Blood (µg/l) 9
10 Figure S3. Time Course of the Average Estimated Cobalt RBC Concentration Categorized by Gender. Average Estimated Co RBC Concentration in Males ( ) and Females ( ). The error bars represent the standard error of Co whole blood or serum concentration. Dietary supplementation was approximately 1. mg Co/day for 3-31 days, and RBC concentration was estimated from whole blood concentration, serum concentration and average hematocrit values for each volunteer. The error bars represent the standard error of Co whole blood or serum concentration. 1
11 Free T4 (ng/dl) TSH (mlu/l) TSH (mlu/l) RBCs ( x 16 /µl) RBCs ( x 16 /µl) Figure S4. Red Blood Cell (RBC) Counts for Each Participant Throughout the Study. A. Males; B. Females. RBC counts show no significant change during dosing for males or females and all data are within the normal reference ranges during dosing. The upper and lower end of the reference range is denoted by the broken black lines. A. B. A B C D E Figure S5. Serum Thyroid Stimulating Hormone (TSH) Levels for Each Participant Throughout the Study. A. Males; B. Females. TSH counts show no significant change during dosing for males or females and all data are within the normal reference ranges during dosing. The upper and lower end of the reference range is denoted by the broken black lines. A. A B C D E B Figure S6. Serum Free Thyroxine (T4) Levels for Each Participant Throughout the Study. A. Males; B. Females. T4 counts show no significant change during dosing for males or females and all data are within the normal reference ranges during dosing. The upper and lower end of the reference range is denoted by the broken black lines. A. A B C D E B
12 Total Protein (g/dl) Total Protein (g/dl) Albumin (U/L) Albumin (U/L) Figure S7. Albumin Concentrations for Each Participant Throughout the Study. A. Males; B. Females. The upper and lower end of the reference range is denoted by the broken black lines. A. 5.5 A B C D E B Figure S8. Total Protein Concentrations for Each Participant Throughout the Study. A. Males; B. Females. The upper and lower end of the reference range is denoted by the broken black lines. A. A B C D E B
13 Hgb (gm/dl) Hgb (gm/dl) Hct (%) Hct (%) WBC (1 3 /µl) WBC (1 3 /µl) Figure S9.White Blood Cell (WBC) Counts for Each Participant Throughout the Study. A. Males; B. Females. The upper and lower end of the reference range is denoted by the broken black lines. A. A B C D E B Figure S1. Hematocrit (Hct) Percentages for Each Participant Throughout the Study. A. Males; B. Females. The upper and lower end of the reference range is denoted by the broken black lines. A. B. A B C D E Figure S11. Hemoglobin (Hgb) Concentrations for Each Participant Throughout the Study. A. Males; B. Females. The upper and lower end of the reference range is denoted by the broken black lines. A B C D E
14 CK-MB (ng/ml) CK-MB (ng/ml) Ferritin (ng/ml) Ferritin (ng/ml) Total Iron (µg/dl) Total Iron (µg/dl) Figure S12. Total Iron Concentrations for Each Participant Throughout the Study. A. Males; B. Females. The upper and lower end of the reference range is denoted by the broken black lines. A B C D E Figure S13. Ferritin Concentrations for Each Participant Throughout the Study. A. Males; B. Females. The upper and lower end of the reference range is denoted by the broken black lines. A B C D E Figure S14. Creatine Kinase-Myocardial Band (CK-MB) Concentrations for Each Participant Throughout the Study. A. Males; B. Females. The upper and lower end of the reference range is denoted by the broken black lines. Results below the limit of detection are plotted as 1/2 the detection limit. A B C D E * B was asymptomatic at his two week post-dose draw, however, follow up cardiac test were performed; the additional labs did not suggest cardiac damage. 14
15 Creatinine (mg/dl) Creatinine (mg/dl) AST (U/L) AST (U/L) ALT (U/L) ALT (U/L) Figure S15. Alanine Aminotransferase (ALT) Concentrations for Each Participant Throughout the Study. A. Males; B. Females. The upper and lower end of the reference range is denoted by the broken black lines. A B C D E Figure S16. Aspartate Aminotransferase (AST) Concentrations for Each Participant Throughout the Study. A. Males; B. Females. AST concentrations show no significant change during dosing for males or females and all data are within the normal reference ranges during dosing. The upper and lower end of the reference range is denoted by the broken black lines Voluntee r A B C D E Figure S17. Creatinine Concentrations for Each Participant Throughout the Study. A. Males; B. Females. The upper and lower end of the reference range is denoted by the broken black lines. A B C D E
16 Glucose (mg/dl) Glucose (mg/dl) Figure S18. Glucose Concentrations for Each Participant Throughout the Study. A. Males; B. Females. The upper and lower end of the reference range is denoted by the broken black lines. 1 A B C D E
17 Stimulation Index Figure S19. Normalized Lymphocyte Proliferation Response to Various Metals Before and After Cobalt Dietary Supplementation with Approximately 1 mg Co/day. Proliferation assays were performed using separated peripheral blood mononuclear cells (PBMCs) collected from 3- milliliters of peripheral blood. Proliferation was determined by [3H]-thymidine (Amersham International, Arlington Heights, IL) incorporation rates. The average proliferation measurement for each metal treatment was normalized to the proliferation measurement of non-treated control cells isolated from that same individual, generating a stimulation index (SI). The SI was then used to compare lymphocyte reactivity (sensitivity) to various metals before and after dosing. According to Orthopedic Analysis, the manufacturer of the assay, a stimulation index (SI) greater than two indicates a positive result, meaning that lymphocytes were reactive to the metal.the graph illustrates the averaged normalized lymphocyte transformation response to each metal. The lymphocyte transformation test shows no significant change in lymphocyte response before and after dosing (paired Student s t-test, p >.5). Ten volunteers are included in each group; five males and five females Average Pre-dsoe Average Post-dose
18 Cobalt Whole Blood Concentration (µg Co/L) Figure S2. Time Course of Observed Whole Blood Cobalt Measurements Compared to Cobalt Biokinetic Model Predictions for Whole Blood Concentrations. Mean Co whole blood concentrations measured during dosing compared to the biokinetic model predictions assuming a 61% GI absorption rate for all volunteers, a 24% GI absorption rate for males, and 81% GI absorption rate females. The best fit GI absorption rate for each group was determined using the least squared errors approach. 6 All s (mean) Males (mean) Females (mean) All (best fit oral absorption during dosing = 61%) Males (best fit oral absorption during dosing = 24%) Females (best fit oral absorption during dosing = 81%) s 18
19 Percent Decrease in Ferritin From Figure S21. Effect of 12-Month Whole Blood or RBC Donation Frequency on the Geometric Mean of Plasma Ferritin by Males and Females from the Cable et al. (211) Study Compared to Ferritin Loss in the Male and Female s from This 31- Study. The percent decrease is a comparison of ferritin levels at the 1 week pre-dose draw and two week post-dose draw. Each gray circle represents one male from the 31-day study and each gray square represents a female from the 31-day study. A comparable decrease in ferritin levels was observed in the males and females from the 31-day study as was observed in the volunteers studied by Cable et al. (211). % 1% 2% 3% % % 6% 7% 8% Females < Females >= Males 31- Males 31-day Females 9% 1% Donations in last 12 months 19
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationSupplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More information*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:
Rick Gold, Certified FDN Practitioner Gold Functional Wellness, Inc. Web: http://goldfunctionalwellness.com/ Phone: (561)270-6364 Email: Rick@goldfunctionalwellness.com Schedule a consultation: https://snapappointments.com/listing/38c
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationEvaluation of new MiniCollect Z Serum (Separator) Tubes
Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationROUTINE LAB STUDIES. Routine Clinic Lab Studies
ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not
More informationProvided by MedicalStudentExams.com NORMAL LABORATORY VALUES
NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.
More informationEvaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube
Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More informationAnalyte Specimen Demographic Reference Range Units
Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationStability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
More informationVITROS MicroSlide Assay Summary
ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More informationASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationE#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women
442 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /., No.+*,..,..0 (,**1) 18 E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women Mutsumi Motouri, Ran Emilie Yoshise, Hiroaki Matsuyama, Tomohiro
More informationHemochromatosis Information KIT for NEWBIES
Hemochromatosis Information KIT for NEWBIES Your KIT includes first steps for a complete diagnosis, next steps for appropriate treatment, next steps to inform family members and helpful items developed
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300
Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness
More informationRoutine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
More informationMed Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments
Med Chem 535P ~ Diagnostic Medicinal Chemistry General Comments Most blood chemistry and serology assays are performed automatically. Larger clinical laboratories often use sophisticated analyzers that
More informationWeight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationWeight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationParkview Health Laboratories Health Fair Information
FAX SHEET.doc Thank you for choosing Parkview Health Laboratories (PHL) for your laboratory needs. We value the opportunity in providing laboratory services for your specific group or organization. PHL
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More informationBlood Test Results Report
Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationEvaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.
5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:
More informationCLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800)
ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts 01886 (800) 665-2575 MICROBIOLOGY Bacteriology Aerobic Culture and Identification Antibiotic Susceptibility Testing Direct Antigen Detection Gram Stain
More informationGRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
More informationVariable Included. Excluded. Included. Excluded
Table S1. Baseline characteristics of patients included in the analysis and those excluded patients because of missing baseline serumj bicarbonate levels, stratified by dialysis modality. Variable HD patients
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationWhat are enzyme markers?
What are enzyme markers? Enzymes are highly specialized complex proteins that aid chemical changes in every part of the body. For example, they help break down food so your body can use it effectively.
More informationAdams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS
Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation
More informationDIABETES AND LABORATORY TESTS. Author: Josephine Davis
DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following
More informationEfficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled
Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationPaper DM05 Using Empirical Rules in Quality Control of Clinical Laboratory Data
Paper DM05 Using Empirical Rules in Quality Control of Clinical Laboratory Data ABSTRACT Faustino Daria, Jr. Senior Statistical Programmer Kendle International, Inc. Cincinnati, OH A statistical programmer
More informationSMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test
More informationINDIANA HEALTH COVERAGE PROGRAMS
INDIANA HEALTH COVERAGE PROGRAMS PROVIDER CODE TABLES Medical Review Team s Due to possible changes in Indiana Health Coverage Programs (IHCP) policy or national coding updates, inclusion of a code on
More informationBasic Blood Chemistry, by Sharlene Peterson CLASS: G610
Basic Blood Chemistry, by Sharlene Peterson CLASS: G610 This is your test but do not try to fill in the blanks! We created a Test Answer Sheet which is easy to download, fill in the answer, and email.
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationPOSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION LANCET KENYA LIMITED UPPERHILL NAIROBI LABORATORY Co. Reg. No.: C168507 Facility Accreditation Number: is a South African National Accreditation System accredited laboratory
More informationBiochemistry Adult Reference Ranges
Certified correct on 28/06/2016 Biochemistry Adult Reference Ranges Test Reference range Units Reference range from Traceable to standard reference material Albumin 35 50 g/l Pathology IRMM ERM-DA470k/IFCC
More informationFactors affecting oxygen dissociation curve
P a g e 1 Factors affecting oxygen dissociation curve As you know, hemoglobin contains 4 heme molecules that bind 4 oxygen molecules (8 atoms). These 4 heme molecules, however, do not bind oxygen all at
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationLab Values Explained. working at full strength. Other possible causes of an elevated BUN include dehydration and heart failure.
Patient Education Lab Values Explained Common Tests to Help Diagnose Kidney Disease Lab work, urine samples and other tests may be given as you undergo diagnosis and treatment for renal failure. The test
More informationPFIZER INC. These results are supplied for informational purpose only. Prescribing decisions should be made based on the approved package insert.
Public Disclosure Synopsis Protocol A3924 4 November 24 Final PFIZER INC. These results are supplied for informational purpose only. Prescribing decisions should be made based on the approved package insert.
More informationBiometric Wellness Screening Modality Comparison Venipuncture vs. Fingerstick vs. Qcard Dried Blood Spot Method collection options
Biometric Wellness Screening Modality Comparison Venipuncture vs. Fingerstick vs. Qcard Dried Blood Spot Method options The following is a review of 3 methods of blood : venipuncture, fingerstick, and
More informationMEMORANDUM. These reference ranges are effective immediately but sample requirements remain unchanged currently.
MEMORANDUM Originating Department Chemical Pathology Issued By: Issued To: Subject: Details: Dr. Shari Srinivasan All Laboratory Service Users Change in Chemical Pathology Analysers Dear Colleague, As
More informationA test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.
Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These
More informationB. PANITUMUMAB DOSE LEVEL 0 No dose reduction 1 Level -1 2 Level Other, specify in comments for this cycle
Radiation Therapy Oncology Group Phase II Study Pre-operative Chemo- Radiation + Panitumumab for Potentially Operable Lung Cancer Concurrent Summary Form AMENDED DATA YES INSTRUCTIONS: Submit all pages
More informationUTHEALTH HOUSTON CCTS BIOBANK VARIABLE LIST
Please check the requested variables:, and/or. Obtained at Initial Hospital Recruitment Demographics: Age Gender Marital Status Ethnicity Race Height (inches) Weight (pounds) Main language spoken Socioeconomic
More informationPostanalytical phase
Postanalytical phase Test request POSTANALYTICAL Result interpretation PHASE Result Sampling Black box: the lab And the RESULT is created The technician approves the result; it is transferred to the lab
More informationPediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS
Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Victoria Higgins, MSc Candidate CALIPER Project The Hospital for Sick Children, Toronto, Canada
More informationSITA 100 mg (n = 378)
Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationGeneral Chemistry Scheme Guide
General Chemistry Scheme Guide Copyright WEQAS. All rights reserved. No part of this document may be reproduced or utilised in any form without permission from WEQAS Contents. Scheme details and repertoire.....
More informationModule 7 Your Blood Work
Module 7 Your Blood Work Every month you will need to collect a sample of your blood just before you start dialysis, and depending on your doctor s recommendation, at the end of your dialysis treatment.
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationKathryn Jones 8/11/2015
1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry
More informationBiometric Wellness Screening Modality Comparison Venipuncture vs. Fingerstick vs. Qcard Dried Blood Spot Method collection options
Biometric Wellness Screening Modality Comparison vs. vs. options The following is a review of 3 methods of blood : venipuncture, fingerstick, and Qcard Dried. This information is provided to help employers
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationno concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis
TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your
More informationSMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Patient Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test results.
More informationLaboratory Issues David Winsemius, MD, MPH Heritage Laboratories/HooperHolmes
Laboratory Issues David Winsemius, MD, MPH Heritage Laboratories/HooperHolmes Age and Gender: Association with Analytes The following Age-Sex distribution slides all have a common format: Males on left,
More informationProgram Analyte Unit Target Limit Absolute SD %
Andrology Sperm Count 1.0E06/mL Peer Group Mean SD 2 Sperm Morphology % normal Peer Group Mean SD 2 Sperm Viability % viable Peer Group Mean SD 2 Endocrinology Cortisol µg/dl Peer Group Mean % of Target
More informationEvaluation of VACUETTE SECONDARY Tubes
Evaluation of VACUETTE SECODARY Tubes Background VACUETTE SECODARY Tubes are used as a secondary container for aliquoting, storing and transporting blood, blood components and urine from the primary tube
More informationSMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationACCREDITATION DOCUMENT
Accreditation No: Awarded to Dow Diagnostic Reference and Research Laboratory (DDRRL), Dow University of Health Sciences Suparco Road Gulzar e Hijri KDA Scheme-35, Karachi, Pakistan. The scope of accreditation
More information15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Serra AL, Poster D, Kistler AD, et al. Sirolimus and kidney
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationManufacturer Report for Siemens Unassayed Chemistry Lot Exp 30 Jun 2018
Acetaminophen Enzymatic, colorimetric µg/ml.09 0..0.09 0..0 0. 0. 0. 0. 9.. 9.0 0.9.0..9.. Albumin Bromcresol Purple (BCP) g/dl.0 0.0..0 0.00.. 0.0.. 0.09..9 0.0..9 0.0..0 0.0..0 0.0. Alkaline Phosphatase
More informationTypes of Statistics. Censored data. Files for today (June 27) Lecture and Homework INTRODUCTION TO BIOSTATISTICS. Today s Outline
INTRODUCTION TO BIOSTATISTICS FOR GRADUATE AND MEDICAL STUDENTS Files for today (June 27) Lecture and Homework Descriptive Statistics and Graphically Visualizing Data Lecture #2 (1 file) PPT presentation
More informationForm 8: Post Transplant Annual Followup
Page 1 of 8 Patient Details Hidden Show Show/Hide Annotations Stickies: Toggle All Toggle Open Toggle Resolved Form 8: Post Transplant Annual Followup Toggle Question Year/Info Print this Form t Started
More informationBLOOD WORK: A USEFUL TOOL FOR MONITORING HIV
BLOOD WORK: A USEFUL TOOL FOR MONITORING HIV A PUBLICATION FROM Information, Inspiration and Advocacy for People Living With HIV/AIDS MAY 2007 Lab tests, or blood work, can give important clues about your
More information