DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5 Krt19 Krt14 Krt17 Tlr2 Myd88 Reltive expression 8 n.s. n.s. 6 totl nr olonies 4 2 WT P CD14+ Tlr2-/- P CD14+ WT P CD14- Tlr2-/- P CD14- WT P1 CD14+ Tlr2-/- P1 CD14+ Supplementry Figure 1 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. () Representtive FACS dot plot nd histogrm of CD24, CD49f nd CD61. Dt re representtive of 6 mie. () Quntittive rt-pcr on MEC popultions s indited in. Bsl mrkers: Krt5, Krt14, Krt17; Luminl mrker: Krt19; N=3 mie;, P<.5;, P<.1;, P<.5;, P<.1. Error rs represent S.E.M. One-til unpired t-test nlysis ws used. () M-CFCs were sorted sed on expression of CD24 high CD49f low/neg luminl phenotype in omintion with CD14. 2 ells luminl ells sorted for CD14 pos or CD14 neg were plted out on mtrigel in triplites. After 7-12 dys olonies were ounted nd pssged s single ell suspension gin (N= 4 mie). 4 independent experiments were performed nd the verge is shown, P=.7,.9 (NS: non-signifint). Vlues represent men ± s.d. Student s unpired t-test for independent smples ws used. WWW.NATURE.COM/NATURECELLBIOLOGY 1
Supplementry Figure 2 Phenotypi hrteriztion of mmmry epithelil ells. () Flow ytometri nlysis of mmmry epithelil ells from 6 weeks old mie of wild-type, Tlr2 / nd Cd14 / mie. Cells were gted on life nd linege negtive ells. () Immunohistohemistry on mmmry glnds from 6 weeks old mie of wild-type, Tlr2 / nd Cd14 / mie. Myoepithelil ells (Cytokertin-14 (KRT14)) nd luminl ells (E-CADHERIN) re present nd properly orgnized in oth wild-type s well s the knok out mmmry glnds. Sle r is 5 μm () Crmine Alum stining on whole mount of lttion of wild-type, Tlr2 / nd Cd14 / mie. Sle r is 1 mm. (d) Flow ytomety nlysis of mmmry epithelil ells from 6-8 weeks old mie. Cells were gted on live nd linege negtive nd stined for CD24, CD49f nd CD14, TLR4, IL- 1R1 or IL-18R1. In red is the isotype ontrol for eh speifi su-popultion, in lue is the CD14, TLR4, IL-1R1 or IL-18R1 stining. (e) Flow ytometry nlysis of Myd88 / mmmry epithelil ells, from 6 weeks old mie of Krt14-Cre neg Myd88 f/f nd Krt14-Cre pos Myd88 f/f mie. Cells were gted on life nd linege negtive ells. (f) Immunohistohemistry on mmmry glnds from 6 weeks old mie of Krt14-Cre neg Myd88 f/f nd Krt14-Cre pos Myd88 f/f mie. Myoepithelil ells (Cytokertin-14 (KRT14)) nd luminl ells (E-CADHERIN) re present nd properly orgnized in the MyD88 knokout mmmry glnd. Sle r is 5 μm. All nlyses were done with t lest 3 mie. 2 WWW.NATURE.COM/NATURECELLBIOLOGY
Limiting dilutions o f mmmmry epithelil ells. # of Lin Tlr2 Cd14 WT Neg ells KO KO 25K 15/2 4/9 1/6 1K 15/18 1/1 /1 5K 9/14 3/2 3/1 2.5K 6/11 2/2 2/12 1.25K /12 /16 /8 # of ells WT Tlr4 KO 1K 5/8 4/1 5K 4/6 3/1 2.5K 6/11 1/1 log frtion nonresponding 1..8.6.4.2. d # of ells WT Il-1r1 Il-18r1 KO KO 25K 15/2 12/12 5/6 1K 15/18 11/16 3/8 5K 9/14 1/16 5/9 2.5K 6/11 11/16 3/9 1.25K /12 3/14 /7 Group Tlr4 Group WT 2 4 6 8 1 dose (numer of ells) Genotype MRU frequeny WT 1/5741 Tlr4 KO 1/185 ±SE 328-149 8948-36227 p-vlue.85 e # of Lin Neg ells WT Tlr2 KO Ink4A- Arf KO Tlr2 KO Ink4A- Arf KO 25K 3/4 4/9 7/7 6/6 1K 5/8 1/1 12/2 5/1 5K 4/6 3/2 9/19 4/13 2.5K 6/11 2/2 3/14 2/12 1.25K /12 /16 2/6 1/4 f log frtion nonresponding 2.5 2. 1.5 1..5. Group Ink4 Arf KO Group TLR2 KO Group TLR2 KO/Ink4 Arf KO Group WT 5 1 15 2 25 dose (numer of ells) Genotype MRU frequeny WT 1/8322 Tlr2 KO 1/42476 Ink4-Arf KO 1/8691 Tlr2 KO Ink4-Arf KO 1/11515 ±SE 4928-1455 22714-79433 64-1258 791-18698 p-vlue <.1 N.S. N.S. Supplementry Figure 3 Limiting dilutions of mmmry epithelil ells. In order to determine the MRU frequeny of eh donor genotype we injeted sorted ells, s indited from donor mie of 1 to 14 weeks old mie in lered mmmry ft pds of three weeks old reipients. Reipient mie were syngenei C57BL/6J mie. Numers of suessful out growths nd numers of totl injetions re shown for eh dilution nd genotype. MRU frequeny nd onfidene ws determined y ELDA grph nd nlysis. ) Rw numers for limiting dilutions of Tlr2 / nd Cd14 / lin neg MECs for figure 4. -) Rw numers for limiting dilutions of Tlr4 / lin neg MECs, inluding ELDA nlysis. Dt for WT (N=25 smples), Tlr4 -/- (N=3 smples) pooled from 3 independent experiments. P=.85. d) Rw numers for limiting dilutions of Il-1r1 / (N=74 smples) nd Il-18r1 / lin neg (N=39 smples) MECs. e-f) Limiting dilutions of Ink4-Arf +/+ Tlr2 +/+ (WT), Ink4-Arf +/+ Tlr2 / (Tlr2 KO), Ink4-Arf / Tlr2 +/+ (Ink4-Arf KO) nd Ink4-Arf / Tlr2 / (Ink4-Arf KO Tlr2 KO) lin neg MECs, inluding ELDA grph nd nlysis. Dt for WT (N=41 smples), Tlr2 -/- KO (N=75 smples), P<.1, Ink4-Arf KO (N=66 smples), P=N.S. nd Ink4-Arf KO Tlr2 KO (N=45 smples), P=N.S. re pooled from 4 independent experiments. WWW.NATURE.COM/NATURECELLBIOLOGY 3
Single ell gene expression of MRU: wildtype versus Tlr2-/- MRU ells Trp53--287 Lgr5--89 Gt3--683 Krt5--549 Krt14--87 Supplementry Figure 4 Single ell gene expression of MRU. Single ell expression showing expression of wild-type (lk) nd Tlr2 / (red) MRUs for figure 3e. Cells were doule sorted nd sujeted to multiplexed single ell rt-pcr. Normlized Ct vlues s visulized y ompring the distriution of Ct vlues in histogrms. () Gene tht ws signifintly up-regulted in Tlr2 / ells s ompred to wild-type ells. () Genes tht were signifintly down-regulted in Tlr2 / s ompred to wild-type ells. Eh nlysis ws done on 2 different mie. 4 WWW.NATURE.COM/NATURECELLBIOLOGY
Antiody nd/or shrna medited lokde of TLR2, CD14, MYD88 nd IRAK1 1.2 ontrol TLR-2 Rel. Tlr2 exp..8.4 CD14 d. shcontrol shtlr2-1 shtlr2-2 15 Myd88 Irk1 MDA-MB-468 MDA-MB-231 Reltive expression fold redution 1 5 e 1 shcontrol shtlr2-1 MCF7 shtlr2-2 f shmyd88 #4 shmyd88 #7 15 shirk1 #1 shirk1 #4 Il-1 nr. of herry pos olonies 8 6 4 2 Reltive expression fold redution 1 5 shmyd88 #4 shmyd88 #7 shirk1 #1 shirk1 #4 Control shmyd88 #4 shmyd88 #7 shirk1 #1 shirk1 #4 Supplementry Figure 5 Antiody nd/or shrna medited lokde of TLR2, CD14, MYD88 nd IRAK1. () Representtive exmples olony formtion on mtrigel of primry ER neg rest ner ells (N=4). Sle r is 2 μm. Cells were treted with ontrol ntiody or with neutrlizing TLR2 nd CD14 ntiodies. (-) Two rest ell lines were trnsdued with the lentivirus to knokdown TLR2 nd fter puromyin seletion ells were plted out nd stined with rystl violet lue fter 9 dys in ulture. Dt re representtive of 2 experiments. Sle r is 1 m. (d) MDA-MD-231 ells were trnsdued with ontrol or indited shrna nd knok-down effiieny ws determined y qpcr. All shrna medited knok-down onstruts resulted in 4 to 12x redution of its trget mrna. Dt re representtive of 2 experiments. (e) Knok-down of MYD88 nd IRAK1 in the rest ell line MCF7. After trnsdution ells were sorted for Cherry nd plted out on mtrigel in triplite to determine olony forming pity. The numer of olonies on mtrigel is shown nd representtive photo of the olonies is shown. N=6 smples pooled from 2 independent experiments., p<.1. Sle r is 2 μm. Vlues represent men ± s.d. Student s unpired t-test for independent smples ws used. (f) MYD88 nd IRAK1 knok down resulted in deresed expression of the NF-KB trget gene IL-1B inditing tht the knok down resulted in deresed NF-KB tivity. Dt re representtive of 2 experiments. WWW.NATURE.COM/NATURECELLBIOLOGY 5
TLR2 Immonohistohemistry on norml nd tumor olon tissue Norml Colon Colon Tumors Supplementry Figure 6 TLR2 immunohistohemistry on norml nd tumor olon tissue. () 1X mgnifition of immunohistohemistry for TLR2. Boxed is norml olon tissue, the rest re olon tumors. Sle r is 2 μm () 4X mgnifition of immunohistohemistry for TLR2 of olon tumors. Sle r is 5 μm. 6 WWW.NATURE.COM/NATURECELLBIOLOGY
Genome editing the Tlr2 lous using CAS9 humn TLR2 lous, Chromosome 4 Exon 2 Exon 3 +47 +944 +2344 sgrna Trgeting vetor E283 homologous reoomintion -638 Pp1 +47 +2344 Pp1 Pp2 +2643 Pp2 E283 M49 Genomi juntion of HR with genomi DNA Primer set 1 juntions: TLR2 outside HR TTTTGGGTAAATCTGAGAGCTGCGATAAAGTCCTAGGTTCCCATATTTAA CMV-Cherry-pA TGGAATATGCAGCCTCCGGATTGTTCGCGTTAAGATACATTGATGAGTTT Primer set 2 juntions: CMV-Cherry-pA AAACTCATCAATGTATCTTAACGCGAACAATCCGGAGGCTGCATATTC TLR2 outside HR onstrut TTTGGGTAAATCTGAGAGCTGCGATAAAGTCCTAGGTTCCCATATTTAA Supplementry Figure 7 Genome editing the Tlr2 lous using CAS9. () Shemti of the trgeted region of humn TLR2 lous nd trgeting strtegy. sgrna uts round +944. The homologues reomintion (HR) ssette hs left rm (inluding the E283 muttion) nd right rm. In etween there is CMV Cherry pa ssette (yellow ox) in the nti sense orienttion. Primer pirs (Pp1 & Pp2) re shown to detet homologues reomintion. () Region of the sgrna omplementry to the protosper. ) Sequened region show orret integrtion of HR onstrut s determined y sequening the genomi juntions. WWW.NATURE.COM/NATURECELLBIOLOGY 7