Probiotic Bio-Three induces Th1 and anti-inflammatory effects in PBMC and dendritic cells

Transcription

1 Online Sumissions: oi:1.3748/wjg.v16.i Worl J Gstroenterol 21 July 28; 16(28): ISSN (print) 21 Bishieng. All rights reserve. ORIGINAL ARTICLE Proiotic Bio-Three inuces Th1 n nti-inflmmtory effects in PBMC n enritic cells Mn-Chin Hu, Tzou-Yien Lin, Ming-Wei Li, Mn-Shn Kong, Hung-Ju Chng, Chien-Chng Chen Mn-Chin Hu, Deprtment of Peitrics, Chng Gung Memoril Hospitl, Keelung 24, Tiwn, Chin Mn-Chin Hu, Tzou-Yien Lin, Ming-Wei Li, Mn-Shn Kong, Hung-Ju Chng, Chien-Chng Chen, Grute Institute of Clinicl Meicl Sciences, College of Meicine, Chng Gung University, Toyun 333, Tiwn, Chin Tzou-Yien Lin, Division of Infectious Disese, Deprtment of Peitrics, Chng Gung Memoril Hospitl, Toyun 333, Tiwn, Chin Ming-Wei Li, Mn-Shn Kong, Hung-Ju Chng, Chien- Chng Chen, Division of Gstroenterology, Deprtment of Peitrics, Chng Gung Memoril Hospitl, Toyun 333, Tiwn, Chin Author contriutions: Hu MC, Chng HJ n Chen CC performe the mjority of experiments; Lin TY, Li MW n Kong MS provie vitl regents n nlyticl tools, n were involve in eiting the mnuscript; Hu MC n Chen CC esigne the stuy n wrote the mnuscript. Supporte y Chng Gung Memoril Hospitl reserch project grnt CMRPG4751 n Ntionl Science Council of Tiwn grnt NSC B-182A-15-MY3 Corresponence to: Chien-Chng Chen, MD, Assistnt Professor of Peitrics, Attening physicin, Division of Gstroenterology, Deprtment of Peitrics, Chng Gung Memoril Hospitl, 12L, 5 Fu-Hsing St, Kwei-Shn, Toyun 333, Tiwn, Chin. cgj2841@yhoo.com Telephone: Fx: Receive: Mrch 12, 21 Revise: My 4, 21 Accepte: My 11, 21 Pulishe online: July 28, 21 Astrct AIM: To investigte the immune response of peripherl loo mononucler cells (PBMCs) n enritic cells (DCs) tht were stimulte y proiotic preprtions. METHODS: PBMCs were isolte, culture, n stimulte with Bio-Three ( mixture of Bcillus mesentericus, Clostriium utyricum n Enterococcus feclis ; 1 5, 1 6 n 1 7 CFU/mL for 24 h). Cytokine prouction of (1) circulting PBMCs; (2) PBMCs stimulte y proiotic preprtion; (3) monocyte-erive DCs; n (4) DC n T cell co-culture ws etermine y enzyme-linke immunosorent ssy. Phenotypic nlysis of circulting PBMCs ws lso investigte y flow cytometry. Bloo ws otine from iniviuls who consume Bio-Three (1 9 CFU/ B. mesentericus, C. utyricum n E. feclis) for 2 wk, or those who i not tke proiotics orlly. RESULTS: In culture superntnts, interferon-γ (IFN-γ) n interleukin (IL)-1 prouction increse, ut IL-4 n tumor necrosis fctor-α (TNF-α) prouction y PBMCs ecrese fter 1 n 2 wk of proiotic tretment. Flow cytometry ws lso performe on y 14 n etecte enhnce expression of CD11, HLA-DR, CD4, CD45RA, CD25, CD44 n CD69 in response to Bio-Three. Furthermore, IL-1 n IL-12 were upregulte in superntnts of monocyte-erive DCs, n IFN-γ n IL-1 were enhnce in superntnts of CD4 + T cells co-culture with DCs. CONCLUSION: Bio-Three ppere to stimulte the Th1 immune response, ownregulte pro-inflmmtory cytokines (TNF-α) n upregulte nti-inflmmtory cytokine (IL-1). Proiotics coul e effective in ctivtion of PBMCs n DCs. 21 Bishieng. All rights reserve. Key wors: Proiotics; Bio-Three; Peripherl loo mononucler cells; Denritic cells Peer reviewers: Sung-Gil Chi, Professor, School of Life Sciences n Biotechnology, Kore University, #31, Nok-Ji Builing, Seoul , South Kore; Ferenc Sipos, MD, PhD, Cell Anlysis Lortory, 2n Deprtment of Internl Meicine, Semmelweis University, Szentkirályi u. 46., Bupest 188, Hungry Hu MC, Lin TY, Li MW, Kong MS, Chng HJ, Chen CC. Proiotic Bio-Three inuces Th1 n nti-inflmmtory effects in PBMC n enritic cells. Worl J Gstroenterol 21; 16(28): Aville from: URL: com/ /full/v16/i28/3529.htm DOI: org/1.3748/wjg.v16.i July 28, 21 Volume 16 Issue 28

2 Hu MC et l. Proiotics moulte PBMCs n DCs INTRODUCTION The use of proiotics to promote humn helth hs een propose for mny yers. Mechnisms of proiotic ctions inclue effects on luminl microil ecology n immune moultion, prticulrly through lnce control of pro-inflmmtory n nti-inflmmtory cytokines [1-4]. Currently, species of lctocillus n ifiocteri re most wiely use to prevent n tret llergy n intestinl isorers; other strins such s Bcillus, Clostriium, Streptococcus, Escherichi coli n Scchromyces hve receive increse ttention. To te, the most extensively stuie n est ocumente proiotic ppliction is for the tretment of cute infectious irrhe, prevention of ntiiotic-ssocite irrhe, n llergic iseses [5-7]. Mny other enefits re lrgely unproven, incluing therpeutic use in necrotizing enterocolitis, irritle owel synrome, constiption, inflmmtory owel iseses, pouchitis, n Helicocter pylori infection [5-7]. It hs een propose tht mny effects of proiotics re meite vi immune moultion [3]. There re host-specific n strin-specific ifferences in the ctivities of proiotic cteri. Some strins cn enhnce or eliminte the ctivity of other strins in vivo [1,2,8]. Previously, most stuies tht hve reporte the eneficil effect of proiotics hve een on single strin preprtions. Few hve exmine the effect of multiple strin preprtions (e.g. VSL#3) [9,1]. Our stuy ws unertken to investigte whether Bio-Three ( mixture of Bcillus mesentericus, Clostriium utyricum n Enterococcus feclis) ffects immune regultion in humn peripherl loo mononucler cells (PBMCs). The primry effectors of the humn gut re ntigenpresenting cells [APCs, incluing monocytes, mcrophges, n enritic cells (DC)], which provie nonspecific innte immune protection. APCs re responsile for etecting microes through Toll-like receptors (TLRs) n presenting their ntigenic structures to T cells. This triggering process of APCs initites signl trnsuction csce tht les to the relese of cytokines n initition of the cquire immune response [2,11,12]. Among the APCs, DCs re the most potent. These ifferentite from CD14+ monocytes in vitro in response to grnulocytemcrophge colony-stimulting fctor (GM-CSF) n interleukin (IL)-4 [1,13,14]. DCs ctivte y microes further stimulte the evelopment of T helper type 1 (Th1) n T helper type 2 (Th2) cells or regultory T cells [1,15]. Severl cytokines re involve in immune moultion. Tumor necrosis fctor-α (TNF-α) n IL-6 re pro-inflmmtory cytokines tht re involve in systemic inflmmtion n the cute phse rection [12]. IL-12 together with interferon-γ (IFN-γ) cuses shift towrs Th1 response, which fvors the evelopment of cell-meite n cytotoxic immunity [2]. Prostglnin E2 (PGE2), together with IL-4, cuses shift towrs Th2 immune response, which fvors the prouction of ntioies n the inuction of IgE n llergic responses [2]. IL-1 (n nti-inflmmtory cytokine) enhnces the genertion of regultory T (Treg) cells [1,2]. Treg cells seem to suppress or regulte effector T cell function through prouction of cytokines such s IL-1 n trnsforming growth fctor-β (TGF-β). The purpose of this stuy ws to etermine whether proiotic comintion (Bio-Three) h immunomoultory effects (ltere the phenotype of circulting lymphocytes or monocytes) in humn PBMCs. We oserve the expression of specific cytokines n chnges in PBMC phenotypes. MATERIALS AND METHODS The stuy protocol ws pprove y the Institutionl Review Bor of Chng Gung Memoril Hospitl, Tiwn, Chin. PBMC preprtion Bloo cells were seprte from pltelet-rich plsm n suspene in RPMI 164 meium. Humn PBMCs were isolte y centrifugtion of uffy cots on Lymphoprep (Nycome, Oslo, Norwy) grients. After wshing, cells were resuspene t concentrtion of cells/ml in RPMI 164 meium tht contine 1% het-inctivte fetl ovine serum. Source of loo onors All experiments were performe with cells otine from 14 loo onor volunteers. Sujects were eligile if they were in goo generl helth n were not currently tking meictions, proiotics, n other supplements. These loo onors were ivie rnomly into two groups: group A (n = 7) consume the proiotic preprtion Bio-Three CFU/ose twice ily (totl 1 9 CFU/) for 2 wk, n group B (n = 7), the negtive control, i not consume proiotics. Peripherl loo smples were otine from ech suject y venipuncture on y 7 (week 1) n y 14 (week 2). Proiotic preprtion for stimultion experiments The proiotic preprtion Bio-Three ws lyophilize mixture tht consiste of three ifferent cteri (B. mesentericus, C. utyricum n E. feclis), t concentrtion of live cteri/pcket live cteri were reconstitute in 3 ml sterile PBS without itives, n seril ilutions (1:1) were me in sterile PBS for ition to cell cultures. PBMC cultures n stimultion experiments The concentrtion of PBMCs (otine from groups A n B) ws juste to 1 5 cells/ml in complete meium, n the cells were trnsferre to 24-well pltes. Some wells were collecte for cytokine etection [y enzyme-linke immunosorent ssy (ELISA)] fter 12 h culture t 37. The remining wells were then stimulte with Bio-Three for 24 h t 37 in n tmosphere tht contine 5% CO2. Initil ose-response experiments were performe y co-culturing 1 5 (1:1), 1 6 (1:1), n 1 7 CFU (1:1) of cteri per ml (host cells: cteri rtio), respectively. Culture superntnts were collecte, n triplictes were poole n kept t -2 until nlyze y ELISA. The remining cells in the culture pltes were mixe with 353 July 28, 21 Volume 16 Issue 28

3 Hu MC et l. Proiotics moulte PBMCs n DCs TRIzol Regent (Gico Life Technologies, Crls, CA, USA) n store t -2 for gene expression nlysis. Repete thwing n freezing were voie. Cytokine etermintion Concentrtions of IFN-γ, IL-4, TNF-α, IL-1, n IL12 p7 in the superntnts of cell cultures were etermine y ELISA. All ntioies n stnrs were purchse from Phrmingen (Sn Diego, CA, USA). Costr pltes (Invitrogen, Sn Diego, CA, USA) were cote with the following cpture monoclonl ntioies (mas): nti- IFN-γ (MQ2-13A5), nti-il-4 (8D4-8), nti-il-12 p7 (2C2), nti-tnf-α (MA1), n nti-il-1 (JES3-9D7). Stnr curves were generte using recominnt humn IFN-γ, IL-4, IL-12 p7, TNF-α, n IL-1, respectively. The following iotinylte ntioies were use for etection: nti-ifn-γ (MQ2-39C3), nti-il-4 (MP4-25D2), nti-il-12 p4/p7 (C8.6), nti-tnf-α (MA11), n nti-il-1 (JES3-12G8). Smples, stnrs, iotinylte ntioies, n streptviin-horserish peroxise were ilute in high-performnce ELISA ilution uffer (Snquin, Amsterm, Netherlns). Detection of PBMC cytokine mrna expression Cytokine mrna expression in PBMCs ws evlute y rel-time polymerse chin rection (PCR). Totl cellulr RNA ws isolte from frozen culture PBMCs using TRIzol (Gico Life Technologies) ccoring to the mnufcturer s instructions. cdna ws synthesize n use s templtes for PCR using specific primers for humn IFN-γ (forwr: 5'-GCATC- GTTTTGGGTTCTCTTGGCTGTTACTGC; reverse: 5'-CTCCTTTTTCGCTTCCCTGTTTTAGCTGCTGG), IL-4 (forwr: 5'-TCTCACCTCCCAACTGCTTCC; reverse: 5'-CGTTTCAGGAATCGGATCAGC), TNF-α (forwr: 5'-AGCCAGTAGCTCATGTTGTAGCAA; reverse: 5'-GGCACTATCAGCTGGTTGTCTGT), IL-1 (forwr: 5'-GCTGGAGGACTTTAAGGGTTACCT; reverse: 5'-CTTGATGTCTGGGTCTTGGTTCT), IL-12 (forwr: 5'-TGGATGCTATTCACAAGCTCAAGT; reverse: 5'-TGGTTTGATGATGTCTCTGATGAAG), n β-ctin (forwr: 5'-GCATGGAGTCCTGTGGCAT; reverse: 5'-CTAGAAGCATTTGCGGTGG). All experimentl smples were mplifie in uplicte. The results were normlize to β-ctin expression. Phenotypic nlysis y flow cytometry Flow cytometry ws performe on y 14 fter enrollment n etecte the expression of immune phenotype istriutions. White loo cells were stine using pnel of mas irecte ginst surfce ntigens expresse y PBMCs, lymphocytes, monocytes n the pproprite species-specific IgG isotype controls. After locking with FCγⅢ/ⅡR ntioy (CD16/CD32; Phrmingen), the cells were stine with mas irecte ginst CD4, CD45RA, CD45RO, CD14 fluorescein isothiocynte, together with one of the ctivtion mrkers: CD3, CD8, CD19, CD25, CD44, CD69, or CD11, HLA-DR (ll phycoerythrin-conjugte; Phrmingen). We nlyze 1-2 cells using FACSCliur system (Becton- Dickinson, Frnklin Lkes, NJ, USA) equippe with CellQuest softwre (Sn Jose, CA, USA). Genertion of monocyte-erive DCs CD14-positive monocytes were then purifie from the mononucler cells y mgnetic cell sorting y using positive selection ccoring to the mnufcturer s protocol (Miltenyi Biotec, Bergisch Glch, Germny). Monocytes (1 6 cells/ml) were culture in six-well pltes in enotoxin-free RPMI 164 meium supplemente with 25 U/mL recominnt IL-4 (R&D Systems, Aingon, UK) n 25 U/mL recominnt GM-CSF (R&D Systems). The cells were culture in the presence of 5% CO2 t 37 for 7. Fresh meium tht contine IL-4 n GM-CSF ws e every secon y. This proceure resulte in genertion of immture DCs tht were positive for CD11 ut negtive for CD14. Isoltion of humn CD4 + T cells n co-culture with DCs PBMCs were isolte y centrifugtion of uffy cots on Lymphoprep grients. CD4 + T cells were seprte using negtive selection ffinity columns (R&D Systems), ccoring to the mnufcturer s instructions. After seprtion, the T cells were wshe n resuspene in RPMI 164 culture meium supplemente with 5% het-inctivte humn AB serum, 1 IU/mL penicillin, 1 µg/ml streptomycin, n 2 mmol/l L-glutmine. Purifie CD4 + T cells (1 1 6 /ml) were stimulte y the comintion of immoilize nti-cd3 (1 µg/ml) n solule nti-cd28 (5 µg/ml) mas (Phrmingen). Susequently, purifie CD4 + T cells were incute with the ove DCs t rtio of /ml DCs to 1 6 /ml T cells. After 48 h of coculture, concentrtions of IFN-γ, IL-4, IL-1, n IL12 p7 in the culture superntnts were etermine y ELISA. Sttisticl nlysis Sttisticl nlysis ws performe using pire smples t test to revel significnt etween-group ifferences in cytokine prouction. In ll cses, P <.5 ws consiere s significnt. Sttisticl clcultions were performe using the GrphP Softwre Prism 3.3 (Sn Diego, CA, USA) n SPSS for Winows 12. (Chicgo, IL, USA). RESULTS Effects of Bio-Three on PBMCs isolte from loo onors To etermine the cytokine prouction of PBMCs, we exmine the superntnts of cells isolte from loo onors. Group A consume Bio-Three n group B ws negtive control. In Figure 1, IFN-γ, IL-1 n IL-12 levels were upregulte in group A, ut IL-4 n TNF-α levels were ownregulte t 1 n 2 wk fter Bio-Three consumption. This inictes tht this proiotic preprtion enhnces cytokines ssocite with Th1 (IFN-γ, IL-12) n nti-inflmmtory (IL-1) responses. In contrst, it might reuce cytokine prouction ssocite with Th2 (IL-4) n pro-inflmmtory (TNF-α) responses July 28, 21 Volume 16 Issue 28

4 Hu MC et l. Proiotics moulte PBMCs n DCs IFN-g (pg/ml) P <.5 P <.5 Week 1 Week 2 IL-4 (pg/ml) P <.5 P <.5 Week 1 Week 2 TNF- (pg/ml) 1 5 P <.5 P <.5 Week 1 Week P <.5 P < Proiotics consumption IL-1 (pg/ml) 3 2 IL-12 (pg/ml) 3 2 P < Week 1 Week 2 Week 1 Week 2 Figure 1 Effects of Bio-Three on peripherl loo mononucler cells isolte from loo onors. Concentrtions of interferon-γ (IFN-γ), interleukin (IL)-4, tumor necrosis fctor-α (TNF-α), IL-1, n IL-12 p7 in the superntnts of peripherl loo mononucler cells (PBMCs) (1 5 cells/ml) incute for 12 h were etermine y enzyme-linke immunosorent ssy. The t shown re the vlues of ifferent cytokines in the superntnts of PBMCs, which were collecte t 1 n 2 wk fter Bio-Three consumption, compre with controls. The results re presente s the men ± SD. Enhncement of IFN-γ n IL-1 levels, ut inhiition of TNF-α prouction in cteril stimultion experiments To explore the effects of proiotic cteri on PBMCs, we performe stimultion experiments with ifferent cteri t concentrtions of 1 5, 1 6 n 1 7 CFU/mL. The level of IFN-γ ws significntly higher in group A (proiotics) thn group B (negtive control) (Figures 2 n 3). Moreover, the level of IFN-γ revele ose-epenent effect of Bio-Three. There ws no significnt effect on IL-4 level, lthough it seeme slightly lower in the proiotic group. In contrst, TNF-α level ws ecrese t weeks 1 n 2 in the proiotic group (Figures 2 n 3). TNF-α level ws significntly lower in response to restimultion with 1 7 CFU/mL proiotic cteri fter 2 wk of Bio-Three consumption. The proiotic group showe increse IL-1 prouction, which ws mximl following restimultion with CFU/mL proiotic cteri t week 2. The level of IL-12 ws low in oth groups, which suggeste tht Bio-Three h no significnt effect on IL-12 prouction (Figures 2 n 3). After stimultion with Bio-Three n co-culture in vitro, the IL-12 level in superntnts of PBMCs ws upregulte (Figures 2 n 3). PBMCs cn e ctivte y in vivo stimultion (proiotic consumption) n proiotic cteri re-stimultion in vitro, which enhnce IFN-γ n IL-1 prouction, s well s ownregulte TNF-α prouction. Initil cytokine levels n immune phenotype istriution in PBMCs from loo onors Initil concentrtions of IFN-γ, IL-4, TNF-α, IL-1, n IL12 p7 in the superntnts of isolte humn PBMCs were etermine (Figure 4A) y ELISA. To etermine the effect of proiotics (Bio-Three) on PBMCs, phenotypic nlysis of immune responses ws lso stuie. Figure 4B shows tht proiotics might lter the expression of some T cell n DC surfce phenotypes compre with controls, such s CD4 + (54.2% ± 3.6% vs 43.4% ± 3.%), CD45RA + (69.1% ± 4.2% vs 43.3% ± 3.6%), CD25 + (15.1% ± 2.6% vs 9.8% ± 2.3%), CD44 + (48.3% ± 3.8% vs 4.1% ± 3.2%), CD69 + (45.6% ± 2.4% vs 34.3% ± 2.7%), CD11 + (63.6% ± 4.5% vs 51.8% ± 2.8%) n HLA-DR (29.9% ± 2.7% vs 22.3% ± 2.3%). Proiotics cn enhnce expression of CD4, CD45RB, CD44, CD69, CD25, CD11 n HLA-DR, which inictes lterntion of co-stimultion with mrkers of Th cells n DCs. Effect of proiotics on expression of CD14, CD 11 n HLA-DR To etermine the effect of Bio-Three on circulting monocytes n APCs (such s DCs), phenotypic nlysis of CD14, CD 11 n HLA-DR ws lso stuie. Proiotics cn lso enhnce the expression of CD11, n HLA-DR in gting monocytes n grnulocytes (Figure 5), which inictes lterntion of co-stimultion with mrker of DCs. However, the expression of CD14 ws similr in the proiotics n control groups. Enhncement of CD4, CD45RA, CD44, CD69 n CD25 expression To etermine the effect of Bio-Three on circulting lymphocytes, phenotypic nlysis of T cells n B cells ws lso stuie. Figure 6 shows tht proiotics cn lter the 3532 July 28, 21 Volume 16 Issue 28

5 Hu MC et l. Proiotics moulte PBMCs n DCs A 11, 1 3 IFN-g (pg/ml) ,c IL-4 (pg/ml) TNF- (pg/ml) 2 1 c Proiotics Proiotics Proiotics Superntnt of PBMC culture (week 1) Superntnt of PBMC culture (week 1) Superntnt of PBMC culture (week 1) IL-1 (pg/ml) 3 2 1,c, IL-12 (pg/ml) Cell: cteri (1:1) Cell: cteri (1:1) Cell: cteri (1:1) Cell lone Proiotics Proiotics Superntnt of PBMC culture (week 1) Superntnt of PBMC culture (week 1) B Fol increse of IFN-g ,,c Fol increse of IL Fol increse of TNF c Proiotics. Proiotics. Proiotics Superntnt of PBMC culture (week 1) Superntnt of PBMC culture (week 1) Superntnt of PBMC culture (week 1) Fol increse of IL ,,,c Fol increse of IL ,,, Cell: cteri (1:1) Cell: cteri (1:1) Cell: cteri (1:1) Cell lone Proiotics Proiotics Superntnt of PBMC culture (week 1) Superntnt of PBMC culture (week 1) Figure 2 Effects of Bio-Three re-stimultion on cytokine prouction of peripherl loo mononucler cells isolte t 1 wk fter consumption, compre with controls. Peripherl loo mononucler cells (PBMCs) (1 5 cells/ml) were stimulte t host cell: cteri rtio of 1:1, 1:1 n 1:1. A: At 24 h fter cteril stimultion, cell culture superntnts were collecte n cytokine levels were etermine y enzyme-linke immunosorent ssy; B: The remining cells in the culture pltes were mixe with TRIzol Regent, n cytokine mrna expression ws nlyze y rel-time polymerse chin rection. The fol increses were compre to tht of control cells, which ws set t 1. The columns represent the mens n the error rs inicte the SD. P <.5, P <.1 vs control cells; c P <.5, P <.1 vs controls t the sme host cell:cteri rtio. IFN-γ: Interferon-γ; IL-4: Interleukin-4; TNF-α: Tumor necrosis fctor-α July 28, 21 Volume 16 Issue 28

6 Hu MC et l. Proiotics moulte PBMCs n DCs A IFN-g (pg/ml) ,, c IL-4 (pg/ml) TNF- (pg/ml) c Proiotics Proiotics Proiotics Superntnt of PBMC culture (week 2) Superntnt of PBMC culture (week 2) Superntnt of PBMC culture (week 2) IL-1 (pg/ml) 3 2 1,, IL-12 (pg/ml) ,c Cell: cteri (1:1) Cell: cteri (1:1) Cell: cteri (1:1) Cell lone 1 c Proiotics Proiotics Superntnt of PBMC culture (week 2) Superntnt of PBMC culture (week 2) B Fol increse of IFN-g ,,,c Fol increse of IL Fol increse of TNF c.5 Proiotics. Proiotics. Proiotics Superntnt of PBMC culture (week 2) Superntnt of PBMC culture (week 2) Superntnt of PBMC culture (week 2) Fol increse of IL ,,,c Fol increse of IL ,,,c Cell: cteri (1:1) Cell: cteri (1:1) Cell: cteri (1:1) Cell lone Proiotics Proiotics Superntnt of PBMC culture (week 2) Superntnt of PBMC culture (week 2) Figure 3 Effects of Bio-Three re-stimultion on cytokine prouction in peripherl loo mononucler cells isolte t 2 wk fter consumption, compre with controls. Peripherl loo mononucler cells (PBMCs) (1 5 cells/ml) were stimulte t host cell: cteri rtio of 1:1, 1:1 n 1:1. A: At 24 h fter cteril stimultion, cell culture superntnts were collecte n cytokine levels were etermine y enzyme-linke immunosorent ssy; B: The remining cells in the culture pltes were mixe with TRIzol Regent, n cytokine mrna expression ws nlyze y rel-time polymerse chin rection. The fol increses were compre to tht of control cells, which ws set t 1. The columns represent the mens n error rs inicte the SD. P <.5, P <.1 vs control cells; c P <.5, P <.1 vs controls t the sme host cell:cteri rtio. IFN-γ: Interferon-γ; IL-4: Interleukin-4; TNF-α: Tumor necrosis fctor-α July 28, 21 Volume 16 Issue 28

7 Hu MC et l. Proiotics moulte PBMCs n DCs A IFN-g (pg/ml) IL-4 (pg/ml) TNF- (pg/ml) PBMC group PBMC group PBMC group 5 5 Bio-Three consumption group 4 4 IL-1 (pg/ml) 3 2 IL-12 (pg/ml) PBMC group PBMC group B SSC-H A.5 R FSC-H 35 79% 77% CD CD19 83% 81% CD4 54% 43% 35 46% 48% 35 69% 43% 35 19% 17% 35 15% 9.8% CD CD45RA CD45RO CD % 3.2% 35 63% 51% 35 29% 22% 35 48% 4% 35 45% 34% CD CD HLADR CD CD69 Figure 4 Mesuring initil cytokine levels n etermining immune phenotype istriutions in peripherl loo mononucler cells isolte from loo onors. A: Initil concentrtions of interferon-γ (IFN-γ), interleukin (IL)-4, tumor necrosis fctor-α (TNF-α), IL-1, n IL-12 p7 in the superntnts of humn peripherl loo mononucler cells (PBMCs) were etermine y enzyme-linke immunosorent ssy. The results re presente s the men ± SD. Sttisticlly significnt ifferences compre with the controls ( P <.5); B: To etermine the effect of Bio-Three on PBMCs, phenotypic nlysis of the immune response ws stuie. The soli histogrm shows the control results, n the unshe re shows the level of expression of co-stimultory molecules fter Bio-Three consumption. The t shown re representtive of three experiments performe. Proiotics might enhnce expression of CD4, CD45RB, CD44, CD69, CD25, CD11 n HLA- DR, which inictes lterntion of co-stimultory mrkers of T helper cells n enritic cells. expression of some T-cell surfce phenotypes compre with controls, such s CD4 + (63.2% ± 4.6% vs 45.6% ± 3.1%), CD45RA + (69.2% ± 3.9% vs 42.3% ± 2.6%), CD25 + (13.2% ± 2.5% vs 8.7% ± 2.1%), CD44 + (47.3% 3535 July 28, 21 Volume 16 Issue 28

8 Hu MC et l. Proiotics moulte PBMCs n DCs SSC-H ult-qiu..5 R % 45% Figure 5 Flow cytometry results for CD14, CD11 n HLA- DR expression on monocytes n grnulocytes. Proiotics cn enhnce expression of CD11 n HLA-DR y gting monocytes n grnulocytes. The soli histogrm shows results for controls, n the unshe re shows the level of expression of costimultory molecules fter Bio-Three tretment. The t shown re representtive of three experiments performe FSC-H CD % 3.3% % 21% CD HLADR SSC-H ult-qiu..5 R FSC-H % 79% CD CD19 84% 83% CD4 63% 45% % 47% % 42% % 18% % 8.7% CD CD45RA CD45RO CD % 39% % 32% CD CD69 Figure 6 Flow cytometry results for CD3, CD4, CD45RA, CD45RO, CD8, CD19, CD25, CD44, CD69 expression on peripherl lymphocytes. The soli histogrm shows the results for controls, n the unshe re shows the level of expression of co-stimultory molecules fter Bio-Three tretment. The t shown re representtive of three experiments performe. Bio-Three might lter the expression of T-cell surfce phenotype, such s CD4, C45RA, CD44, CD69, n even CD25. ± 3.6% vs 39.8% ± 3.8%) n CD69 + (56.6% ± 2.3% vs 32.1% ± 2.6%). Flow cytometry showe tht proiotic tretment ws ssocite with ltere expression of CD4 (Th cells), CD45RA (nïve T cells), CD25 (Treg cells), 3536 July 28, 21 Volume 16 Issue 28

9 Hu MC et l. Proiotics moulte PBMCs n DCs 3 3 IL-1 (pg/ml) 2 1 IL-12 (pg/ml) 2 1 group group Monocyte-erive enritic cells (7 fter culture) Monocyte-erive enritic cells (7 fter culture) Figure 7 Interleukin-1 n interleukin-12 p7 levels in the superntnts of monocyte-erive enritic cells. The t shown re the levels of cytokines in the proiotic group (lck r), n control group (white r) collecte on y 7 fter Bio-Three consumption. Bio-Three upregulte interleukin (IL)-1 n IL-12 p7 levels in the superntnts of monocyte-erive enritic cells. The results re presente s the men ± SD. Sttisticlly significnt ifferences compre with the controls ( P <.5). CD44 n CD69 (T-cell ctivtion mrkers) on lymphocytes, ut there ws no significnt effect on the expression of CD3, CD8 or CD45RO. Effect of proiotics on monocyte-erive DCs To etermine the effect of proiotics on DCs, we isolte monocytes n culture them t 37 for 7. In the culture superntnts from monocyte-erive DCs, IL-1 n IL-12 levels were upregulte in the proiotic group compre to the control group (Figure 7). This inictes tht Bio-Three cn stimulte monocyte-erive DCs to prouce more IL-1 n IL-12. Proiotics enhnce cytokine levels ssocite with Th1 n Treg cells in CD4 + T cells co-culture with DCs To explore the effect of proiotic consumption on DC n CD4 + T cell ifferentition, we use cell culture moel to stuy cytokine levels in the superntnts of CD4 + T cells co-culture with monocyte-erive DCs. Bio-Three upregulte IFN-γ (ssocite with Th1) n IL-1 (ssocite with Treg cells) levels in the superntnts of DCs n CD4 + T cells co-culture for 48 h (Figure 8). DISCUSSION The role of intestinl microflor s moultor of the immune response hs een stuie intensively in recent yers. Lctocillus species re the most well-stuie oth in vitro n in vivo, n coul hve clinicl importnce in inucing phgocytosis n IgA secretion, moifying T-cell responses, enhncing Th1 responses, n ttenuting Th2 responses [2,15-17]. However, how intestinl microes interct with the mucosl immune system remins uncler [15]. The ility of ifferent strins of Lctocillus to inuce prouction of key cytokines such s IL-12 n IL-1 vries mrkely [2,8]. The functionlly ifferent CD4 + Th cell susets known s Th1 n Th2 hve ifferent cytokine profiles. The Th1/Th2 prigm is relevnt to the pthogenesis of severl pthologicl conitions n provies the rtionle for the evelopment of new strtegies for treting n preventing iseses. The evelopment of polrize Th1 or Th2 responses epens on environmentl fctors [e.g. ose of ntigen, nture of the immunogen, n cytokines (IL-4, IL-12 or interferons) t the time of ntigen presenttion], or on other unefine fctors tht minly ffect so-clle nturl immunity [18]. Th1-ominte responses re potentilly effective in ericting infectious gents, incluing those hien within the host cells. In our stuy, proiotics upregulte IFN-γ levels n moertely ownregulte IL-4 in the superntnt of culture PBMCs, which suggests tht proiotics enhnce the Th1 immune response n suppress the Th2 immune response. The effects of consuming proiotics other thn lctic ci cteri re reltively unexplore. Bcillus strins re use in the tretment of irrhe [19]. Aitionlly, they hve ntimicroil ctivities, inuce secretory IgA, IFN-γ, IL-12, IL-1 n TGF-β prouction, stimulte CD4 + T cell prolifertion, n suppress IL-4 levels [2,21]. The clinicl n immunomoultory effects of Clostriium n Enterococcus species re well ocumente in niml moels. Hetinctivte C. utyricum enhnce IFN-γ prouction, polyclonl ntioy formtion, n phgocytosis in mouse moel [22,23]. Moreover, culture superntnts of C. utyricum TO-A ownregulte TLR4 expression in humn colonic epithelil cells [24]. Feeing E. fecium SF68 to mice hs een ocumente to ntgonize Giri intestinlis infection n increse the percentge of CD4 + T cells in the Peyer s ptches n spleen [25]. It hs lso een suggeste tht equte E. fecium fter ntiiotic tretment improves the intestinl ecosystem, n therey prevents the shift to Th2 immunity in neontl mice [26]. The present stuy focuse on the proiotic mixture Bio-Three of B. mesentericus, C. utyricum n E. feclis. We speculte tht ech species of Bio-Three woul moify the immune function ifferently, thus leing to more complex effects. To te, few stuies hve exmine the clinicl effects of Bio-Three. One stuy hs foun tht Bio-Three prevents enterohemorrhgic Escherichi coli O157: H7 infection in rits [27]. Another hs foun tht Bio-Three is effective in ptients with ulcertive colitis tht is refrctory to conventionl therpy [28]. Aministrtion of Bio-Three to infnts chnges the composition of 3537 July 28, 21 Volume 16 Issue 28

10 Hu MC et l. Proiotics moulte PBMCs n DCs IFN-g (pg/ml) 3 2 IL-4 (pg/ml) group group 48 h fter DC-CD4 + cells co-culture 48 h fter DC-CD4 + cells co-culture 3 3 IL-1 (pg/ml) 2 1 IL-12 (pg/ml) 2 1 group group 48 h fter DC-CD4 + cells co-culture 48 h fter DC-CD4 + cells co-culture Figure 8 Interferon-γ, interleukin-4, interleukin-1, n interleukin-12 p7 cytokine profile of superntnts of humn CD4 + T cells co-culture with enritic cells. The t shown re the levels of cytokines in the proiotic group (lck r), n control group (white r). Bio-Three upregulte interferon-γ (IFN-γ) n interleukin (IL)-1 levels in the superntnts of CD4 + T cells co-culture with enritic cells t rtio of 1:4 for 48 h. The results re presente s the men ± SD. Sttisticlly significnt ifferences compre with the controls ( P <.5). intestinl flor n ecreses serum enotoxin prouce y potentilly pthogenic microorgnisms [29], n proly reuces infectious complictions fter pncreticouoenectomy [3]. In the present stuy, Bio-Three inuce IL-1 prouction n increse the numer of Treg cells (CD4 + n CD25 + T lymphocytes). IL-1 moultes immune responses y proiotic cteri [2,15,31] y inhiiting synthesis of IL-2, IL-12 n TNF-α prouce y cells such s APCs n Th1 cells [1,12,32]. Increse IL-1 prouction might explin why Bio-Three inhiits TNF-α prouction, which cn e hrmful t high levels [3,33]. IL-12 plys centrl role in promoting the Th1 response [2,1]. Specific strins of Lctocillus enhnce IL-12 prouction y humn mononucler cells [34,35]. However, in our stuy, this effect ws limite proly ecuse of strins in Bio-Three were not stimultory. Other explntions inclue inhiition y IL-1, shorter time of stimultion in vitro (24 h), n inequte ose (roun 1 9 orgnisms/). In previous stuies, ily oses of (ut not < 1 9 ) orgnisms of proiotic lctic ci cteri conferre physiologicl enefits [36,37]. In the present stuy, IL-12 level in oth groups ws low, therefore, the influence of Bio-Three ose on IL-12 prouction shoul e further investigte. Notly, not ll proiotics species cn inuce IL-12 prouction. We use previously pulishe metho (1 5, 1 6 n 1 7 CFU/mL cteri co-culture with PBMCs (1 5 /ml) for 1 (the rtio of cteri:pbmc ws 1:1, 1:1 n 1:1) to investigte how the concentrtion of cteri ffects cytokine prouction [35,38,39]. A prior stuy hs emonstrte tht Lctocillus ose-epenently stimultes PBMC expression of cytokines [39]. In our system, the optimum ose ws roun CFU/mL, which ws lmost sttisticlly significnt (P <.5). However, cytokine prouction ws less t the highest concentrtion (1 8 CFU/mL cteri, t not shown), which suggeste tht stimultion of PBMCs ws not fully ose-epenent. This inconsistency etween the responses to Bio-Three n Lctocillus my hve een ue to species ifferences. Moreover, the possiility tht highly concentrte cell eris inuces poptosis, eletion, or cell eth of PBMCs shoul e consiere. In our experiment, CD4 +, CD45RA + n CD25 + T lymphocytes were upregulte, wheres CD14 + cells showe no significnt chnge. DCs re CD11 + cells tht cn ifferentite from CD14 + monocytes [1,4]. The expression of CD11 + cells in our stuy suggeste tht they were increse y exposure to Bio-Three. DCs regulte the evelopment of T cell responses, especilly the polriztion of such responses [1,2]. It hs een emonstrte tht exposure to proiotic cteri upregultes mrkers of DC mturtion, such s HLA-DR n memers of the B7 fmily (CD8, CD86) [1,31,41-44]. High ut not low oses of proiotic orgnisms inuce DC mturtion, which suggests tht ifferent intrcellulr signl July 28, 21 Volume 16 Issue 28

11 Hu MC et l. Proiotics moulte PBMCs n DCs ing pthwys re ctivte y high oses [1,45]. As escrie ove, the level of HLA-DR ( mrker of immune stimultion), which prticiptes in DC signling, is usully enhnce. In the present stuy, Bio-Three h n enhncing effect on expression of HLA-DR. Furthermore, co-culture with DCs n CD4 + T cells, showe upregultion of IFN-γ (ssocite with Th1 cells) n IL-1 (regultory cytokine) in the superntnts. To te, the rel pthwys of proiotic immunomoultory effects re not fully unerstoo, n some types of immune cells tht re prime y proiotics might e the connection etween in vivo n in vitro stimultion. We propose tht PBMCs re involve in the in vivo sensitizing effect of Bio-Three n further in vitro stimultory effects. The monocyte-erive DC trnsformtion might ply key role in the mechnism of proiotic immunomoultion. DCs re the most potent APCs tht re prime y proiotic cteri, n they re the principl stimultors of nïve T cells to rive further immune responses. In conclusion, we foun tht proiotics (Bio-Three) increse expression of IFN-γ (ssocite with Th1 cells), increse IL-1 prouction (nti-inflmmtory cytokine), n ecrese TNF-α level. The optimum concentrtion of Bio-Three for cytokine prouction ws roun CFU/mL. It is resonle to speculte tht Bio-Three reirecte the immune system towr n nti-inflmmtory phenotype, rther thn n ggressive immune response, even t reltively low ose (1 9 orgnisms/ for 2 wk). Furthermore, the short term in vivo (2 wk) n in vitro (24 h) exposure ws proly sufficient to promote Th1 cell response n HLA-DR expression on DCs. COMMENTS Bckgroun There is incresing evience tht proiotic cteri influence host immune function, ut the immune response in humn peripherl loo fter proiotic consumption is little known. Proiotic proucts, however, re usully consume y the generl popultion, ut not much is known out the effects tht they hve on the immune system in helthy ults. Reserch frontiers It is not fully clrifie how proiotics exert their eneficil effects, ut one of the most prole mechnisms is the moultion of host immune responses. The possile ction mechnism coul e the ility to inuce cytokines tht further regulte innte n ptive immune responses. Innovtions n rekthroughs The present stuy ws esigne to explore the immune response of peripherl loo mononucler cells (PBMCs) in vivo fter stimultion y proiotic preprtion, such s cytokine prouction n phenotypic nlysis of circulting PBMCs. The uthors lso investigte cytokine prouction of (1) PBMCs stimulte y proiotic preprtion; (2) monocyte-erive enritic cells (DCs); n (3) co-culture DCs n T cells. Applictions The uthors foun tht the proiotic preprtion Bio-Three (Bcillus mesentericus, Clostriium utyricum n Enterococcus feclis) coul irect immune responses to either Th1 or nti-inflmmtory response. More etile informtion on the cytokine ptterns elicite y proiotic cteri coul help in esigning proiotic preprtions for specific preventtive or therpeutic purposes. Peer review This is well-written pper with promising results tht coul e the sis of forthcoming new reserch on the therpeutic n immunomoultory effects of proiotics. REFERENCES 1 Msen K. Proiotics n the immune response. J Clin Gstroenterol 26; 4: Vrl O. Immunologicl effects of proiotics with specil reference to lctocilli. Clin Exp Allergy 23; 33: Isoluri E, Süts Y, Knknpää P, Arvilommi H, Slminen S. Proiotics: effects on immunity. Am J Clin Nutr 21; 73: 444S-45S 4 Klliomäki MA, Isoluri E. Proiotics n own-regultion of the llergic response. Immunol Allergy Clin North Am 24; 24: , viii 5 Michil S, Sylvester F, Fuchs G, Issenmn R. Clinicl efficcy of proiotics: review of the evience with focus on chilren. J Peitr Gstroenterol Nutr 26; 43: Lemerg DA, Ooi CY, Dy AS. Proiotics in peitric gstrointestinl iseses. J Peitr Chil Helth 27; 43: Ouwehn AC. Antillergic effects of proiotics. J Nutr 27; 137: 794S-797S 8 Christensen HR, Frøkier H, Pestk JJ. Lctocilli ifferentilly moulte expression of cytokines n mturtion surfce mrkers in murine enritic cells. J Immunol 22; 168: Biiloni R, Feork RN, Tnnock GW, Msen KL, Gionchetti P, Cmpieri M, De Simone C, Srtor RB. VSL#3 proiotic-mixture inuces remission in ptients with ctive ulcertive colitis. Am J Gstroenterol 25; 1: Drkes M, Blnchr T, Czinn S. Bcteril proiotic moultion of enritic cells. Infect Immun 24; 72: Krlsson H, Lrsson P, Wol AE, Ruin A. Pttern of cytokine responses to grm-positive n grm-negtive commensl cteri is profounly chnge when monocytes ifferentite into enritic cells. Infect Immun 24; 72: Krlsson H, Hessle C, Ruin A. Innte immune responses of humn neontl cells to cteri from the norml gstrointestinl flor. Infect Immun 22; 7: Roriguez AV, Bigorí MD, Alvrez S, Cstro GR, Oliver G. Phosphtiylinositol-specific phospholipse C ctivity in Lctocillus rhmnosus with cpcity to trnslocte. FEMS Microiol Lett 21; 24: Rnolph GJ, In K, Roini DF, Steinmn RM, Muller WA. Differentition of phgocytic monocytes into lymph noe enritic cells in vivo. Immunity 1999; 11: Niers LE, Timmermn HM, Rijkers GT, vn Bleek GM, vn Uen NO, Knol EF, Kpsenerg ML, Kimpen JL, Hoekstr MO. Ientifiction of strong interleukin-1 inucing lctic ci cteri which own-regulte T helper type 2 cytokines. Clin Exp Allergy 25; 35: Pochr P, Gosset P, Grngette C, Anre C, Tonnel AB, Pestel J, Mercenier A. Lctic ci cteri inhiit TH2 cytokine prouction y mononucler cells from llergic ptients. J Allergy Clin Immunol 22; 11: Pessi T, Süts Y, Hurme M, Isoluri E. Interleukin-1 genertion in topic chilren following orl Lctocillus rhmnosus GG. Clin Exp Allergy 2; 3: Del Prete G. The concept of type-1 n type-2 helper T cells n their cytokines in humns. Int Rev Immunol 1998; 16: Mzz P. The use of Bcillus sutilis s n ntiirrhoel microorgnism. Boll Chim Frm 1994; 133: Ciprni G, Tosc MA, Milnese M, Cligo G, Ricc V. Cytokines evlution in nsl lvge of llergic chilren fter Bcillus clusii ministrtion: pilot stuy. Peitr Allergy Immunol 24; 15: Urci MC, Bressollier P, Pinchuk I. Bcillus clusii proiotic strins: ntimicroil n immunomoultory ctivities. J Clin Gstroenterol 24; 38: S86-S9 22 Murym T, Mit N, Tnk M, Kitjo T, Asno T, Mizuochi K, Kneko K. Effects of orlly ministere Clostriium 3539 July 28, 21 Volume 16 Issue 28

12 Hu MC et l. Proiotics moulte PBMCs n DCs utyricum MIYAIRI 588 on mucosl immunity in mice. Vet Immunol Immunopthol 1995; 48: Wng GR, Chen HY, Chen CH, Yeh MY, Mikmi Y. Immunopotentiting ctivity of Clostriium utyricum in mice. Proc Ntl Sci Counc Repu Chin B 1996; 2: Isono A, Ktsuno T, Sto T, Nkgw T, Kto Y, Sto N, Seo G, Suzuki Y, Sito Y. Clostriium utyricum TO-A culture superntnt ownregultes TLR4 in humn colonic epithelil cells. Dig Dis Sci 27; 52: Benycou J, Pérez PF, Rocht F, Sun KY, Reuteler G, Antille N, Humen M, De Antoni GL, Cvini C, Blum S, Schiffrin EJ. Enterococcus fecium SF68 enhnces the immune response to Giri intestinlis in mice. J Nutr 25; 135: Suo N, Yu XN, Ai Y, Oym N, Sono J, Kog Y, Kuo C. An orl introuction of intestinl cteri prevents the evelopment of long-term Th2-skewe immunologicl memory inuce y neontl ntiiotic tretment in mice. Clin Exp Allergy 22; 32: Tchikw T, Seo G, Nkzw M, Sueyoshi M, Ohishi T, Joh K. [Estimtion of proiotics y infection moel of infnt rit with enterohemorrhgic Escherichi coli O157:H7] Knsenshogku Zsshi 1998; 72: Tsu Y, Yoshimtsu Y, Aoki H, Nkmur K, Irie M, Fuku K, Hosoe N, Tk N, Shiri K, Suzuki Y. Clinicl effectiveness of proiotics therpy (BIO-THREE) in ptients with ulcertive colitis refrctory to conventionl therpy. Scn J Gstroenterol 27; 42: Uro M, Fujimoto T, Lne GJ, Seo G, Miyno T. Does proiotics ministrtion ecrese serum enotoxin levels in infnts? J Peitr Surg 1999; 34: Nomur T, Tsuchiy Y, Nshimoto A, Yuski H, Tkii Y, Nkgw S, Sto N, Knyshi C, Tnk O. Proiotics reuce infectious complictions fter pncreticouoenectomy. Heptogstroenterology 27; 54: Hrt AL, Lmmers K, Brigii P, Vitli B, Rizzello F, Gionchetti P, Cmpieri M, Kmm MA, Knight SC, Stgg AJ. Moultion of humn enritic cell phenotype n function y proiotic cteri. Gut 24; 53: e Wl Mlefyt R, Arms J, Bennett B, Figor CG, e Vries JE. Interleukin 1(IL-1) inhiits cytokine synthesis y humn monocytes: n utoregultory role of IL-1 prouce y monocytes. J Exp Me 1991; 174: Henerson B, Poole S, Wilson M. Microil/host interctions in helth n isese: who controls the cytokine network? Immunophrmcology 1996; 35: Mohmzeh M, Olson S, Klin WV, Ruthel G, Demmin GL, Wrfiel KL, Bvri S, Klenhmmer TR. Lctocilli ctivte humn enritic cells tht skew T cells towr T helper 1 polriztion. Proc Ntl Ac Sci USA 25; 12: Miettinen M, Mtikinen S, Vuopio-Vrkil J, Pirhonen J, Vrkil K, Kurimoto M, Julkunen I. Lctocilli n streptococci inuce interleukin-12 (IL-12), IL-18, n gmm interferon prouction in humn peripherl loo mononucler cells. Infect Immun 1998; 66: Donnet-Hughes A, Rocht F, Serrnt P, Aeschlimnn JM, Schiffrin EJ. Moultion of nonspecific mechnisms of efense y lctic ci cteri: effective ose. J Diry Sci 1999; 82: Schiffrin EJ, Brssrt D, Servin AL, Rocht F, Donnet- Hughes A. Immune moultion of loo leukocytes in humns y lctic ci cteri: criteri for strin selection. Am J Clin Nutr 1997; 66: 515S-52S 38 Cmpieri M, Gionchetti P. Bcteri s the cuse of ulcertive colitis. Gut 21; 48: Helwig U, Lmmers KM, Rizzello F, Brigii P, Rohleer V, Crmelli E, Gionchetti P, Schrezenmeir J, Foelsch UR, Schreier S, Cmpieri M. Lctocilli, ifiocteri n E. coli nissle inuce pro- n nti-inflmmtory cytokines in peripherl loo mononucler cells. Worl J Gstroenterol 26; 12: Drkes ML, Lu L, Suotin VM, Thomson AW. In vivo ministrtion of flt3 lign mrkely stimultes genertion of enritic cell progenitors from mouse liver. J Immunol 1997; 159: Bnchereu J, Steinmn RM. Denritic cells n the control of immunity. Nture 1998; 392: Lngenkmp A, Messi M, Lnzvecchi A, Sllusto F. Kinetics of enritic cell ctivtion: impct on priming of TH1, TH2 n nonpolrize T cells. Nt Immunol 2; 1: Mellmn I, Steinmn RM. Denritic cells: specilize n regulte ntigen processing mchines. Cell 21; 16: Chen CC, Chiu CH, Lin TY, Shi HN, Wlker WA. Effect of proiotics Lctocillus ciophilus on Citrocter roentium colitis: the role of enritic cells. Peitr Res 29; 65: Smits HH, Engering A, vn er Kleij D, e Jong EC, Schipper K, vn Cpel TM, Zt BA, Yznkhsh M, Wiereng EA, vn Kooyk Y, Kpsenerg ML. Selective proiotic cteri inuce IL-1-proucing regultory T cells in vitro y moulting enritic cell function through enritic cellspecific intercellulr hesion molecule 3-gring nonintegrin. J Allergy Clin Immunol 25; 115: S- Eitor Wng JL L- Eitor Kerr C E- Eitor Lin YP 354 July 28, 21 Volume 16 Issue 28