Alimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
|
|
- Francine West
- 5 years ago
- Views:
Transcription
1 Alimonti_Supplementry Figure 1 hy Neo Proe 5 Proe hy/ hy/ / Neo β-tin d Reltive Protein level (% ) hy/ /- Reltive Gene Expr. (% ) hy/ /- Supplementry Figure 1 Chrteriztion of hy/ mouse emryoni firolsts (MEFs). () Shemti representtion the genomi onstrut of the hypomorphi (hy) llele hroring the neomyin ssette, nd the wild-type (), nd null ( ) lleles. The genomi sequene is depited s white line, with gry oxes representing exons 3, 4, 5 nd 6. The retngulr ox represent the Neo resistne the gry tringles represent the loxp sites. The genomi frgment (proe 6.1), used s proe for Southern lot nlysis is shown s red r. () Western lot nlysis of, hy/ nd /- MEFs showing sutle redution of protein levels in hy/ MEFs when ompred with the nd /- ells. Arevition ode used is: hy/ = mie hving hypomorphi nd llele; /- = mie hving nd null llele () Quntifition of protein level from, hy/ nd /- littermte MEFs. Error rs show S.D. from three independent experiments. (d) Quntifition of mrna levels in, hy/ nd /- MEFs. Error rs show S.D. from three independent experiments. Nture Genetis: doi:1.138/ng.556
2 Alimonti _Supplementry Figure S2 (n=3) hy/ (n=32) / (n=24) Lymph-node Averge dimeter (inh) Perentge of mie ffeted with Lymphodenopthy n= m n=4 hy/ / >22 p=.2 Time (months) p=.8 d Spleen.35 Averge weigth(gr) hy/ /- n=5 n=4.3 n= hy/ /- 1 m n=3 Spleen Lymph-node hy/ 4X.15 4X.1 /-.5 hy/ /- 4X p=.4 p=.1 4X hy/ e liver 4X kidney 4X Supplementry Figure 2 Averge size of lymph nodes nd spleen in, hy/ nd /- mie. () Lymphodenopthy disese-free survivl in the, hy/ nd /- popultion; n= numer of nimls nlyzed. (-) Anlysis nd representtive imges of the verge size of the lymph nodes () nd spleen () of the, hy/ nd /- t the time of detetion of the utoimmune disorder. n= numer of nimls nlyzed. p= sttistil signifine. Error rs show S.D. (d) Hemtoxylin nd eosin (H&E) nlysis of spleens nd lymph-nodes showing lymphosplenomegly in hy/ nd /- mie. Inset: H&E stining of spleen nd lymph-node from wild-type mouse, showing spleen with well-defined white nd red pulp nd lymph-node with well-delineted mirontomil fetures. Note the hypertive white pulp nd the prtil effement of the spleen histology of the mutnt mie. Note lso the hyper retive germinl enters with the prtil effement of the norml ortiomedullry oundries of the hy/ nd /- lymph nodes. (e) H&E nlysis shows inflmmtory infiltrtions in the liver nd kidney of the hy/ mie. Nture Genetis: doi:1.138/ng.556
3 Alimonti_Supplementry Figure 3 hy/ /- Uterine dysplsi 2X 2X Lung Cner Intestinl Polyp hy/ 2X 2X Supplementry Figure 3 hy/ mie develop tumours of different histology fter long lteny. () Representtive H&E imges of hy/ nd /- uterus showing signs of uterine dysplsi. () (Left imge) H&E stining of multi-fol lung denorinom in hy/ femle mouse. (Right imge) Intestinl polyp from 16 month old hy/ mle (see lso Tle 1). Nture Genetis: doi:1.138/ng.556
4 Alimonti_Supplementry Figure 4 MAMMARY GLANDS lox PCR UTERUS PCR MAMMARY GLANDS UTERUS d 7k MAMMARY TUMORS e IHC in mmmry glnds 5k 7k /- Uterus 144 yy8 19 hy/- 4X 4X hy/ 5k /- 4X /- 4X hy/- 7k Uterus 5k 12 yy4 yy7 hy/- Supplementry Figure 4 hypomorphi mie develop mmmry nd uterine tumours in sene of LOH. () Sheme illustrting the PCR strtegy nd the PCR primers dopted for the LOH nlysis in the hy/ mie. () PCR nlysis of norml tissue, mmmry nd uterine tumours from, hy/ nd /- mie using the lox () nd () primers. Note tht three tumours for eh genotype were nlyzed for the LOH nlysis. (d) Southern lot nlysis of norml tissue, mmmry nd uterine tumours from, /- nd hy/- mie showing the sene of LOH in these tumours. Four tumours for eh genotype were nlyzed. (e) Representtive imges of immunohistohemistry nlysis for in the sme tumours s in (). Note tht tissues from oth hy/ nd /- mmmry epithelium show immunoretivity for. Nture Genetis: doi:1.138/ng.556
5 Alimonti_Supplementry Figure 5 hy/ Mmmry tissue H&E 1 1X 1X 1X β-tin Reltive Protein level (% ) 1X pakt 1X.5 / hy/ /- / hy/ / X.8 Supplementry Figure 5 Anlysis of pre-neoplsti mmmry glnds in ontrol nd hy/mie. () H&E nd immunohistohemistry nlysis for nd pakt in 2 months old nd hy/ virgin littermte femle mie. () (Upper pnel) Western lot nlysis for nd quntifition of protein level (Lower pnel) in two month old ontrol nd hy/ mmmry glnds showing the presene of protein levels in ll the tissues nlyzed. Error rs show S.D. from three independent experiments. Nture Genetis: doi:1.138/ng.556
6 Alimonti _Supplementry Figure d3 d2 sicontrol si Trnsripts (Reltive to Hprt) β-tin SiControl Si (d3) Reltive ell numer (OD 595 nm) 1,6 1,4 1,2 1,8,6,4,2 48 h p=.3 SiControl Si (d3) Supplementry Figure 6 A sutle down regultion of level y sirna promotes hyper-prolifertion in MMECs derived from mie of C57/BL6 pure geneti kground. (Left pnel) Down regultion of protein nd gene expression levels y seril dilutions of sirna in MMECs. (Right pnel) Prolifertion of MMECs derived from C57/BL6 mie, fter trnsfetion with the sirna dilution numer 3 (d3) in MMECs. Error rs show S.D. from three independent experiments. p= sttistil signifine. Nture Genetis: doi:1.138/ng.556
7 Alimonti _Supplementry Figure rest tumors norml rest GNF2_CDC2 GNF2_CSK1B Brest tumors PTEN Brest tumors Norml Brest Norml Brest 1,32 PTEN expression in rest tumors reltive to norml smples -1.5 Controls High PTEN expression,99,66,33 GSM85485 GSM85493 GSM85482 GSM85481 GSM8559 GSM85479 GSM85491 GSM85494 GSM85483 GSM85489 GSM85475 GSM85478 GSM85473 GSM85474 GSM85496 GSM85512 GSM8551 GSM85511 GSM8552 GSM8554 GSM85487 GSM85484 GSM8557 GSM85476 GSM8555 GSM85492 GSM85499 GSM8549 GSM85486 GSM85488 GSM8551 GSM8558 GSM855 GSM85497 GSM8548 GSM8556 GSM85477 GSM85498 GSM85495 GSM8553 GSM85514 GSM85515 GSM85513 GSM85517 GSM85516 GSM85519 GSM Ptients GNF2_CDC2 Brest tumors Norml Brest -4 4 PTEN gene expression (%) > 65 < 65-4 Numer of ptients Perentge of ptients GSM85498 (PTEN 7%) ID GSM85485 GSM85482 GSM855 GSM8548 GSM85498 GSM85495 PTEN mrna Reltive PTEN expression GSM85495 (PTEN 73%) PTEN IHC # * 4X # 2X GSM85482 (PTEN 22%) GSM85485 (PTEN 17%) # * 4X *Strom 4X # Norml epithelium Supplementry Figure 7 Chrteriztion of humn rest ner smples with deresed PTEN expression. () Gene expression profile from ontrol nd rest humn tumour smples with low/sent PTEN expression (upper pnel). Note tht these tumours show the sme up-regultion of gene sets enrihed in the hy/ MEFs. See lso Supplementry Fig. 8 for the GSEA nlysis of the enrihed gene sets in the ptients nlyzed nd jsp?olletion=cgn for the orresponding gene set pge. () Histogrm showing the distriution of PTEN mrna expression in norml mmmry tissue (lk rs) nd tumour speimens with sutle (PTEN mrna> 65%, ornge rs) nd pronouned (PTEN mrna <65%, lue rs) redution in PTEN mrna expression. The tle shows the numer nd perentge of ptient tumour smples exhiiting sutle (>65%) or more drmti (<65%) redution in PTEN mrna expression ompred to the verge PTEN expression in the norml mmmry tissue smples (n=7). () (Left pnel) Sore of PTEN immunoretivity in suset of ptients from () with vrying levels of PTEN mrna (showed s solute signl intensity vlues nd reltive expression ompred to norml mmmry tissue smples). (Right pnels) Representtive immunohistohemistry nlysis for PTEN in iopsies showing either sutle or profound dereses in PTEN mrna (orresponding PTEN mrna level reltive to norml mmmry tissue is indited in rkets) Nture Genetis: doi:1.138/ng.556
8 Alimonti_Supplementry Figure rest tumor d 4. norml rest e f g Supplementry Figure 8. Gene expression profile in ontrol nd ptients ffeted y invsive rest ners. (Upper pnels) Enrihment plot ssessed y GSEA for GNF2_BUB1(), GNF2_CDC2 (), GNF2_CDC2 (), GNF2_MCM4 (d), GNF2_CENPE (e), GNF2_CKS2 (f) nd GNF2_CKSIB (g) gene sets in tumours smples nd in the hy/ MEFs. Genes in the linege-speifi gene sets re mrked with vertil rs, nd the enrihment sore is shown in green. (Lower pnels) Mrker genes of the GNF2_BUB1(), GNF2_CDC2 (), GNF2_CDC2 (), GNF2_ MCM4 (d), GNF2_CENPE (e), GNF2_CKS2(f) nd GNF2_CKSIB (g) gene sets, in ptients ffeted y rest ner (with deresed gene expression for PTEN) ompred to ontrols, rnked y signl to noise rtio Nture Genetis: doi:1.138/ng.556
9 Supplementry Tle 1. Primer sequenes used for genotyping, exons muttionl nlysis nd sirna experiment. GENOTYPING Forwrd 5 >3 Reverse 5 >3 TGGGAAGAACCTAGCTTGGAGG TTCCATTTGTCACGTCCTGCAC ACTCTACCAGCCCAAGGCCCGG LPTEN1 TGTTTTTGACCAATTAAAGTAGGCTGTG AAAAGTTCCCCTGCTGATGATTTGT MUTATIONAL ANALYSIS exon Forwrd 5 >3 Reverse 5 >3 1 AGTCCAGAGCCATTTCCATC TCTAGAAATGCGCCCAGAAT 2 CTAGCGTGGGAAAAGCTAA CCAAAACACATCAAAATGCAA 3 CTGTTTTAGTCCTGTGCAGC CAGGAATCCAGTTCCTCAAA 4 AGCGCAGTGTTTTTACATGA TCACCAGGCAGTAAAAGAC 5 TGGAGTGAAGAGCACAATGC CACAAAGAGGGAGGAAGGAA 6 TTTGTCTCCCTCCTCCCTCT CACCAAAATTCATTGGGTTAGC 7 GAAGTCCTTACATGGGTTGG AAGGCTTTAAGCAAAAGGTCTG 8 CACAAGGTGTTTGCCTTCAC CAGAAAAGGAAAGGCTACGC 9 AAAAGCAGTGCCCTTCAGA CCTATAACTGCAATCTGACA sirna EXPERIMENT sirna ControlsiRNA AGACCAUAACCCACCACAG AAGGAGACGAGCAAGAGAA Nture Genetis: doi:1.138/ng.556
SUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationSUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION CD169 + MACROPHAGES PRESENT LIPID ANTIGENS TO MEDIATE EARLY ACTIVATION OF INVARIANT NKT CELLS IN LYMPH NODES Ptrii Brrl, Polo Polzell, Andres Brukuer, Nio vn Rooijen, Gurdyl S.
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationSUPPLEMENTARY INFORMATION
oi:1.138/nture1138 Supplementl Figure 1 Inflmmtory Monoytes Host ells CCR2 CCL2 Disseminting Tumor Cells Metstsis Assoite Mrophges VEGF Extrvstion & Metstti Seeing Supplementl Figure 1 The t from this
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationSUPPLEMENTARY INFORMATION
DOI:.3/n95 Thymus Kiney (kd) TA T7 T TA T7 T Hert TA T7 T: +Dox Cylin B (kd) Thymus Kiney Hert TA T5 T TA T5 T TA T5 T: +Dox Cylin B Poneu S Poneu S CnB T7 CnB T Thymus (kd) + Liver Colon + + (kd) Thymus
More informationSUPPLEMENTARY INFORMATION
doi:.8/nture98 : hr NEMO :5 hr IKK IKK NF-κB p65 p5 p65/-rel NF-κB p65 p5 p65/-rel Cytoplsm Cytoplsm p65/p5 Nuleus Nuleus NEMO IKK IKK d : hr > : hr p65/-rel NF- p65 p5 Cytoplsm Cytoplsm p65/p5 p65/-rel
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationSUPPLEMENTARY INFORMATION
DOI:./n BJ RAS:ER Herrnz et l Supplementry Figure HFFF RAS:ER.. mrna Expression..... ILα ILβ IL IL CCL INH VEGF mrna Expression..... ILα ILβ IL IL CCL INH VEGF + OHT Torin NVP-BEZ + OHT shmtor. shmtor.
More informationTbp. Per Relative mrna levels Circadian Time. Liver weight/ body weight (%) n.s. Pernull
Liver weight/ ody weight (%) Dy Body weight (g) Reltive mrna levels Reltive mrna levels Reltive mrna levels Reltive mrna levels Dy Per1 Per2 Per3 Tp 8 2 8 2. 6 2 8 12162 Cirdin Time 3 2 1 2 1 1 8 12162
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationSUPPLEMENTARY INFORMATION
2 weeks high holesterol diet 2 weeks high holesterol diet 2 weeks high holesterol diet 2 μm Mrophges Crystls Hoehst μm Mrophges Crystls Hoehst Hoehst Crystls Mrophges 2 μm 2 μm Supplementry Fig. 1: Erly
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationSUPPLEMENTARY INFORMATION
Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationProtein tyrosine phosphatase 1B deficiency or inhibition delays ErbB2-induced mammary tumorigenesis and protects from lung metastasis
Protein tyrosine phosphtse 1B defiieny or inhiition delys ErB2-indued mmmry tumorigenesis nd protets from lung metstsis Sofi G Julien 1,5, Ndi Dué 1,6, Mihelle Red 1, Jnie Penney 1, Mrilene Pquet 2, Yongxin
More informationSupplementary Information Titles
Supplementry Informtion Titles Journl: Nture Medicine Article Title: Corresponding Author: Modelling colorectl cncer using CRISPR-Cs9-medited engineering of humn intestinl orgnoids Toshiro Sto Supplementry
More informationPrimers used for real time qpcr
Supplementry Tble 1. Primers used for rel time qpcr Gene Accession number Forwrd/reverse primers Tgfα Tgfβ1 Hgf Cyclin A2 Cyclin B1 Cyclin D1 Cyclin E1 FoxM1 p21 Lrt Cyp26A1 CrbpI Rrβ Bcmo1 Bcmo2 NM_31199
More informationA mouse Mecp2-null mutation causes neurological symptoms that mimic Rett syndrome. 1kb. pa 1 pa 2 wildtype allele 11kb. S/pA. loxp.
1 Nture Pulishing Group http://genetis.nture.om A mouse Mep2-null muttion uses neurologil symptoms tht mimi Rett synrome Jky Guy 1, rin Henrih 1, Megn Holmes 2, Jonne E. Mrtin 3 & Arin ir 1 1 Nture Pulishing
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.18/nture129 ontrol-dna -DNA CD49 Blood Lung e.98 +/-.9.71 +/-.2.29+/-.1 2.9 +/-.6 Bsophils (x1 )/ml 4 Bsophils ( x1 ) d f 45. 22.5 15 75 ontrol-dna ontrol-dna -DNA -DNA
More informationSupplementary Information
Supplementry Informtion A new lss of plnt lipid is essentil for protetion ginst phosphorus depletion Yozo Okzki 1, Hitomi Otsuki 1, Tomoko Nrisw 1, Mkoto Koyshi 1, Storu Swi 2, Yukiko Kmide 1, Miyko Kusno
More informationSonic Hedgehog promotes proliferation of Notch-dependent monociliated choroid plexus tumour cells
Soni Hedgehog promotes prolifertion of Noth-dependent monoilited horoid plexus tumour ells Li Li, Ktie B. Grusm,2, Jun Wng 3, Melody P. Lun 4,5, Jsmin Ohli 6, Hrt G. W. Lidov 4, Moni L. Clihio 4, Erling
More informationSupplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2
Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationSupplementary Information
Supplementry Informtion Non-nonil prevents skeletl ging n inflmmtion y inhiiting NF-κB Bo Yu, Ji Chng, Yunsong Liu, Jiong Li, Kreen Kevork, Khli Al Hezimi, Dn T. Grves, No-Hee Prk, Cun-Yu Wng Supplementry
More informationSUPPLEMENTARY INFORMATION
TM TM tip link horizontl top connectors 1 leucine-rich (21 %) otoncorin-like 1809 ntigenic peptides B D signl peptide hydrophoic segment proline/threonine-rich (79 %) Supplementry Figure 1. () The outer
More informationSupplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More informationSingle-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
More informationSupplementary Figure S1_Cottini
Supplementry Figure S1_Cottini γ-h2a.x Krp OCIMy5 KMS11 Krps62 RPMI8226 INA6-1 µm Cleve C3 γ-h2a.x DAPI Merge OCIMy5 H929 JJN3 UTMC2 KMS11 KMS12PE KMS18 KMS2 RPMI8226 INA6 U266 KMS34 Krps62 1 2 3 4 5 6
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationnestin ironetin p75 s1 CNS SKPs Dermo-1 +ve SKPs CNS H2O SCGs Skin Di. SKPs TH SHOX2 GAPDH NCAM D H Figure S1, Immunoytohemil nlysis o SKP spheres ulture rom neontl mouse (nestin, ironetin, S-1) or rt
More informationsupplementary information
DOI:.38/n83 k Mouse Ch8 lous 8 9 Stop CHD8L 75 CHD8L Chromoomins Helise/ATPse omin DNA ining omin 5 kd NIH 3T3 MEF 93T HeL HCT UOS SOS.. CHD8L IB: CHD8 8 5 L S Reltive mrna mount 3... Reltive mrna mount.8.
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationSUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationLETTER. Impaired hydroxylation of 5-methylcytosine in myeloid cancers with mutant TET2
doi:.8/nture98 Impired hydroxyltion of -methylytosine in myeloid ners with mutnt TET Myunggon Ko {, Yun Hung {, Ann M. Jnkowsk, Utz J. Ppe,, Mmt Thilini, Hozef S. Bndukwl, Jungeun An {, Edwrd D. Lmperti,
More informationSupplementary Information
Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
More informationLesions of prefrontal cortex reduce attentional modulation of neuronal responses. and synchrony in V4
Lesions of prefrontl ortex reue ttentionl moultion of neuronl responses n synhrony in V4 Georgi G. Gregoriou,, Anrew F. Rossi, 3 Leslie G Ungerleier, 4 Roert Desimone 5 Deprtment of Bsi Sienes, Fulty of
More informationRestoration of p53 function leads to tumour regression in vivo. p53 locus. Targeting vector DTA LSL. Targeted allele
Vol 445 8 Ferury 27 oi:1.138/nture5541 Restortion of funtion les to tumour regression in vivo Anre Ventur 1, Dvi G. Kirsh 1,2, Mrgret E. MLughlin 1, Dvi A. Tuveson 1, Jn Grimm 3, Lur Lintult 1, Jmie Newmn
More informationN6-methyladenosine (m6a) is the most prevalent messenger
https://oi.org/8/s556-8-7- m 6 A mrna methyltion regultes tivity to promote the prolifertion n tumorigeniity of enometril ner Jun Liu,,, Mrk A. Ekert,, Bryn T. Hr,,, Song-Mei Liu,, Zhike Lu,, Kngkng Yu,,5,
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationRegulatory T cells prevent catastrophic autoimmunity throughout the lifespan of mice
Regultory T ells prevent tstrophi utoimmunity throughout the lifespn of mie Jeong M Kim 1, Jeffrey P Rsmussen 1 & Alexnder Y Rudensky 1,2 Mie lking the trnsription ftor ( ) lk regultory T (T reg ) ells
More informationSUPPLEMENTARY INFORMATION
DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3
More informationSupplementary Figure 1 a
% DAPI + Are Supplementry Figure 1 MOI 1 MOI.5 MOI.25 5 4 3 MOPC MOPC, LCMV reltive VL4 expression 2 1 d1 d2 d3 MOI.125 MOI.625 untreted Supplementry Figure 1: LCMV replictes in MOPC without ffecting cell
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationInhibiting Stat3 signaling in the hematopoietic system elicits multicomponent antitumor immunity
2 Nture Pulishing Group http://www.nture.om/nturemediine Inhiiting Stt3 signling in the hemtopoieti system eliits multiomponent ntitumor immunity Mrin Kortylewski 1,4, Miej Kujwski 1,4, Tinhong Wng 2,
More informationSUPPLEMENTARY INFORMATION
doi:.38/nture277 d 25 25 2 Time from sound onset (ms) 25 25 2 Time from sound onset (ms) Firing rte (spikes/s) Firing rte (spikes/s).8.6..2 e f g h.8.6..2 Frtion of neurons Frtion of neurons N = 53 2 2
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationSupplemental Figures and Legends
Supplementl Figures n Legens Epigeneti trgeting of Hegehog trnsriptionl output through BET romoomin inhiition Yujie Tng 1,2, Shrreh Gholmin 2, Simone Shuert 1,2, Mine I. Willrson 3, Alex Lee 4, Prtiti
More informationToolkit for evaluating genes required for proliferation and survival using tetracycline-regulated RNAi
Toolkit for evluting genes required for prolifertion nd survivl using tetryline-regulted RNAi Johnnes Zuer,5, Ktherine MJunkin,,5, Christof Fellmnn,4, Luks E Dow, Meredith J Tylor, Gregory J Hnnon 3 &
More informationAJ PUTT. Hematology. Chemistry. Species: Canine Gender: Female Year of Birth: 2013 Client: PUTT
Speies: Cnine Gender: Femle Yer of Birth: 2013 Client: PUTT Requisition #: 9034-12 Aession #: W2152816 Aount Code: 72364 Veterinrin: CARTER Pnel/Profile: Tik Pnel Add-on Senior Profile with L 4Dx Plus
More informationSupplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells
Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz
More informationRESEARCH ARTICLE. Supplemental Figure 5
11.5 2 2 11. RESEARCH ARTICLE RBC ( 1 12 /L) 1.5 1. 9.5 PLT ( 1 9 /L) 1 16 14 HGB (g/l) 19 1 17 16 9. 12 4 4 46 Cellulr & Moleulr Immunology dvne online pulition, PCV (%) 44 MCV (fl) 46 44 ; doi:1.13/mi.214.16
More informationa3 Chains of type V collagen regulate breast tumour growth via glypican-1
Reeive 5 Aug 16 Aepte De 16 Pulishe 19 Jn 17 3 Chins of type V ollgen regulte rest tumour growth vi glypin-1 Guorui Hung 1, Goxing Ge 1,w, Vlerio Izzi & Dniel S. Greenspn 1 DOI: 1.138/nomms1351 OPEN Periellulr
More informationOrigin of Triple hi and Triple lo T reg cells Triple hi and Triple lo T reg cells present in the thymus (Fig. 2a) could represent CD4 + GITR CD4 PD-1
Affinity for self ntigen selets with distint funtionl properties Len Wyss 1,2, Brin D Stdinski 3, Crolyn G King 1, Sonj Shllenerg 4, Nihols I MCrthy, Jun Young Lee 6,7, Krsten Kretshmer 4,8, Luigi M Terrino
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationYAP transcriptionally regulates COX-2 expression and GCCSysm-4 (G-4), a dual YAP/COX-2 inhibitor, overcomes drug resistance in colorectal cancer
Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 DOI.86/s346-7-6-3 RESEARCH Open Aess trnsriptionlly regultes expression nd GCCSysm-4 (G-4), dul / inhiitor, overomes drug resistne in oloretl
More informationChow KD CR HFD. Fed Fast Refed
Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
More informationThymidylate synthase gene polymorphism determines response and toxicity of 5-FU chemotherapy
The Phrmogenomis Journl (2001) 1, 65 70 2001 Nture Pulishing Group All rights reserved 1470-269X/01 $15.00 www.nture.om/tpj ORIGINAL ARTICLE Thymidylte synthse gene polymorphism determines response nd
More informationregulates stem cells through Wnt/β-catenin signalling
LETTERS O regultes stem ells through Wnt/β-tenin signlling Jolly Mzumdr,,7, W. Timothy O Brien, Rndll S. Johnson, Joseph C. LMnn, Jun C. Chvez 5, Peter S. Klein nd M. Celeste Simon,, Stem ells reside in
More informationLETTERS. Chfr is required for tumor suppression and Aurora A regulation
25 Nture Pulishing Group http://www.nture.om/nturegenetis Chfr is required for tumor suppression nd Auror A regultion Xiohun Yu 1, Ktherine Minter-Dykhouse 1, Liviu Mlurenu 2, Wei-Meng Zho 3, Dongwei Zhng
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationDGCR8 is essential for microrna biogenesis and silencing of embryonic stem cell self-renewal
7 Nture Pulishing Group http://www.nture.om/nturegenetis DGCR is essentil for mirorna iogenesis n silening of emryoni stem ell self-renewl Yngming Wng, Rostislv Mevi, Collin Melton, Ruolf Jenish & Roert
More informationInhibition of mtor induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease
Inhiition of mtor indues utophgy nd redues toxiity of polyglutmine expnsions in fly nd mouse models of Huntington disese Brind Rvikumr 1,6, Corlie Vher 1,6, Zdenek Berger 1,2, Jnet E Dvies 1, Shouqing
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi: 1.138/nnno.211.41 Sili nd titnium dioxide nnoprtiles use pregnny omplitions in mie Kohei Ymshit, Ysuo Yoshiok, Kzum Higshisk, Kzuy Mimur, Yuki Morishit, Mstoshi Nozki, Tokuyuki
More informationGene expression phenotypic models that predict the activity of oncogenic pathways
3 Nture Pulishing Group http://www.nture.com/nturegenetics Gene expression phenotypic models tht predict the ctivity of oncogenic pthwys Erich Hung,, Seiichi Ishid,7, Jennifer Pittmn,3, Holly Dressmn,,4,
More informationBraf V600E cooperates with Pten loss to induce metastatic melanoma
Brf V6E oopertes with Pten loss to indue metstti melnom Dvid Dnkort 1,5,6, Dvid P Curley 2,6, Roert A Crtlidge 1, Betsy Nelson 2, Anthony N Krnezis 3, Willim E Dmsky, Jr 2, Mingjin J You 4,5, Ronld A DePinho
More informationOlfactory behavior and physiology are disrupted in prion protein knockout mice
Olftory ehvior nd physiology re disrupted in prion protein knokout mie Clire E Le Pihon 1, Mtthew T Vlley 1, Mgdlini Polymenidou 2,3, Alexnder T Chesler 1, Botir T Sgdullev 1,3, Adrino Aguzzi 2 & Sturt
More information% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %
Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts
More informationSupplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationActivation of Akt as a Mechanism for Tumor Immune Evasion
The Amerin Soiety of Gene Therpy originl rtile Ativtion of Akt s Mehnism for Tumor Immune Evsion Kyung Hee Noh 1, Te Heung Kng 1, Jin Hee Kim 1, Sr I Pi 2, Ken Y Lin 3, Chien-Fu Hung 4, T-C Wu 4 7 nd Te
More informationresidual wild type band (Supplementary Fig. 5c) that may be explained by the presence of
doi:1.138/nture9387 Supplementry Text RANK deletion in tumors nd Cre effects. Southern lotting of the tumors tht developed in RANK mm femles showed deletion of RANK, leit we oserved some residul wild type
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationARTICLES. Mediators of vascular remodelling co-opted for sequential steps in lung metastasis
Vol 1 April 7 doi:1.13/nture57 ARTICLES Meditors of vsulr remodelling o-opted for sequentil steps in lung metstsis Gorv P. Gupt 1, Don X. Nguyen 1, Anne C. Ching 1,, Pul D. Bos 1, Juliet Y. Kim 1, Cristin
More information11/7/2011. Disclosures. Psoriatic Arthritis (PsA) DC-STAMP I II III IV. None
unstimulte stimulte 11/7/11 Ientifiction of Unique Suset + (Denritic Cell-Specific Trnsmemrne Protein) T cells with Th17 Signture in Psoritic rthritis () Ptients Disclosures None Y.H. Chiu, E.M. Schwrz,
More informationInsulin-like Growth Factor-binding Protein-7 (IGFBP7): A Promising Gene Therapeutic for Hepatocellular Carcinoma (HCC)
originl rtile The Amerin Soiety of Gene & Cell Therpy Insulin-like Growth Ftor-inding Protein-7 (IGFBP7): A Promising Gene Therpeuti for Heptoellulr Crinom (HCC) Dong Chen 1, Ayesh Siddiq 2, Luni Emdd
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationReduced expression of cytokeratin 4 and 13 is a valuable marker for histologic grading of esophageal squamous intraepithelial neoplasia
J Med Dent Sci 2012; 59: 17-28 Originl Article Reduced expression of cytokertin 4 nd 13 is vlule mrker for histologic grding of esophgel squmous intrepithelil neoplsi Mski Tkshim 1), Hiroshi Kwchi 1),
More informationControl vector. HA-Elfn2. HA-Elfn1
Control vector c HA-Elfn2 HA- Control vector HA-Elfn2 HA- nti- nti-ha Hippocmpus (CA3) PV DAPI SOM DAPI Hippocmpus (dentte gyrus) PV DAPI SOM DAPI Supplementry Figure 1. Specificity of the nti- ntiody
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More information