MicroRNAs, RNA Modifications, RNA Editing. Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM
|
|
- Rhoda Francis
- 6 years ago
- Views:
Transcription
1 MicroRNAs, RNA Modifications, RNA Editing Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM
2 Expanding world of RNAs mrna, messenger RNA (~20,000) trna, transfer RNA rrna, ribosomal RNA snrna, small nuclear RNA hnrna, heterogeneous nuclear RNA mirna, microrna (~2,000) sirna, short interfering RNA pirna, piwi-interacting RNA (~20,000, role in epigenetic silencing of selfish elements) lncrna, long noncoding RNA
3 Complexity of RNAs Transcription involves overlapping, intergenic and intronic sense and antisense small and large RNAs. lncrnas may have evolved from coding RNAs and vive-versa Many new classes of regulatory RNAs remain to be discovered. In contrast to DNA, RNA is single-stranded and fold into complex biologically significant 3-dimensional structures.
4 The rise of regulatory RNA
5 micrornas: MicroRNAs (mirnas) are small ( 22 nucleotide) highly conserved noncoding RNA molecules encoded in the genomes of plants and animals that regulate the expression of genes by binding to the 3'-untranslated regions (3'-UTR) of specific mrnas. Depending on the genomic loci, mirnas can be categorized into three types: intragenic (intra-mir), intergenic (intermir), and polycistronic (poly-mir). Association of mirna-bound RNA-induced silencing complex (mirisc) with target mrnas also cause deadenylationdependent target mrna decapping and degradation.
6 mirnas and their Targets mirnas are extensively processed and are bound and presented by the RNA-induced silencing complex (RISC). The mirisc then associates with a target mrna, usually within its 3 UTR. There is complementarity between the mrna and bases 2 8 of the mirna (the seed sequence). mirnas may function only under specific conditions (e.g. particular developmental stages, stress,response to certain environmental queues and extracellular signaling). Unclear whether mirnas have one primary mrna target or whether they exert their effect by targeting multiple mrnas at once.
7 mirna binding to mrna
8 BIOGENESIS OF mirnas RISC:RNA-induced silencing complex Drosha: an RNase-III processing enzyme Dicer: an RNase-III processing enzyme The association of mirnas with their target mrnas is mediated by Argonaute (AGO) proteins within the RISC in the cytoplasm.
9 mirna versus sirna
10 mirna based gene repression Translational repression and mrna degradation contribute to mirna based gene repression. Recent evidence suggest that translational repression of mirna targets is the primary repressive mechanism (mirnas may primarily interfere with initiation of translation). The effect of mirna gene knockout is often not obvious in the phenotype under normal conditions, only to become apparent in certain cellular contexts or under stress conditions.
11 Model of mirna-mediated control of gene expression.
12
13 Anti-miRs versus mirna mimics in therapeutics LNA-modifed antimir directed against the liver-specifc mirna mir-122, which is required for replication of the hepatitis C virus (HCV)
14 RNA modifications RNA contains more than 100 distinct modifications that can modify RNA translation and splicing efficiency. Recent technical advances have revealed widespread and sparse modification of messenger RNAs with N6 -methyladenosine (m 6 A), 5- methylcytosine (m 5 C), and pseudouridine (Ψ). m 6 A is catalyzed by methyltransferase enzymes depending on flanking sequences, proximity to 3-end and secondary structure. m 6 A can be enzymatically removed by demethylase eraser enzymes (e.g. FTO). Pseudouridine sites in mrna are fewer than m 6 A, but there are more pseudouridine (pus) synthase enzymes. Pseudouridylation is thought to be irreversible. m 5 C is common in noncoding RNAs. There are marked species differences in prevalence of m 5 C in mrna: ~8000 m 5 C sites in human mrnas compared to a single mrna m 5 C site in budding yeast.
15 YTHDF2 increases turnover of m6a-modified mrna by promoting colocalization with decay factors.
16 Nucleotide modifications and detection strategies. Wendy V. Gilbert et al. Science 2016;352:
17 Diverse molecular functions of m6a, Ψ, and m5c in coding RNAs. Wendy V. Gilbert et al. Science 2016;352:
18 Evolving insights into RNA modifications and their functional diversity in the brain
19
20 RNA Editing versus Central Dogma A post-transcriptional regulatory mechanism that alters the RNA sequences copied from DNA. Adenosine to inosine (A-to-I) and cytidine to uridine (C-to-U) are the most common types in mammals. Inosine and uridine are read as guanosine and thymidine by the translation machinery. Thus RNA editing has the capability to alter the inherited code in DNA.
21 Cytidine deamination Adenosine deamination
22 A>I RNA editing is essential for life and normal development: Transgenic mice with reduced GluR-B editing have severe epileptic seizures and die within 2 weeks of age. Catalyzed by a family of adenosine deaminases acting on RNA (ADARs) C>U RNA editing produces a shorter isoform of ApoB in intestinal cells: The only known physiological protein recoding by C>U RNA editing which is catalyzed by APOBEC1 cytidine deaminase
23
24 Histograms showing the fold change in median expression of ADAR and ADARB1 in a cancer type compared with normal samples.
25 Inducible C>U RNA editing by APOBEC3A occurs in monocytes SDHB NBN TMEM131 Mo1 Mo2 Mo3 Ly1 Ly2
26 Candidate cytidine deaminases for inducible RNA editing in monocytes/macrophages -AID (activation-induced cytidine deaminase) is responsible for antibody hypermutations. -APOBEC3 genes play an important role in anti-viral innate immunity. -Functions of APOBEC2 and APOBEC4 are unknown.
27 In vitro cytidine deamination of SDHB RNA versus ssdna by APOBEC3A
28 Summary of various mechanisms through which RNA editing plays a role in the pathogenesis of cancer.
29 References: Baysal, B.E., Sharma, S., Hashemikhabir, S. and Janga, S.C., RNA Editing in Pathogenesis of Cancer. Cancer Research, 77(14), pp Gilbert WV, Bell TA, Schaening C. Messenger RNA modifications: Form, distribution, and function. Science Jun 17;352(6292): Morris, K.V. and Mattick, J.S., The rise of regulatory RNA. Nature reviews. Genetics, 15(6), p.423. Sand, M. (2014). The pathway of mirna maturation. mirna Maturation: Methods and Protocols, Sharma, S., Patnaik, S.K., Taggart, R.T., Kannisto, E.D., Enriquez, S.M., Gollnick, P. and Baysal, B.E., APOBEC3A cytidine deaminase induces RNA editing in monocytes and macrophages. Nature communications, 6. Wilczynska, A., & Bushell, M The complexity of mirna-mediated repression. Cell death and differentiation, 22(1), 22.
MicroRNA in Cancer Karen Dybkær 2013
MicroRNA in Cancer Karen Dybkær RNA Ribonucleic acid Types -Coding: messenger RNA (mrna) coding for proteins -Non-coding regulating protein formation Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
More informationBi 8 Lecture 17. interference. Ellen Rothenberg 1 March 2016
Bi 8 Lecture 17 REGulation by RNA interference Ellen Rothenberg 1 March 2016 Protein is not the only regulatory molecule affecting gene expression: RNA itself can be negative regulator RNA does not need
More informationTranscriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes
More informationEpigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN
Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN Institute for Brain Disorders and Neural Regeneration F.M. Kirby Program in Neural
More informationChapter 10 - Post-transcriptional Gene Control
Chapter 10 - Post-transcriptional Gene Control Chapter 10 - Post-transcriptional Gene Control 10.1 Processing of Eukaryotic Pre-mRNA 10.2 Regulation of Pre-mRNA Processing 10.3 Transport of mrna Across
More informationCircular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
More informationmirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
More informationHuman Genome: Mapping, Sequencing Techniques, Diseases
Human Genome: Mapping, Sequencing Techniques, Diseases Lecture 4 BINF 7580 Fall 2005 1 Let us review what we talked about at the previous lecture. Please,... 2 The central dogma states that the transfer
More informationNovel RNAs along the Pathway of Gene Expression. (or, The Expanding Universe of Small RNAs)
Novel RNAs along the Pathway of Gene Expression (or, The Expanding Universe of Small RNAs) Central Dogma DNA RNA Protein replication transcription translation Central Dogma DNA RNA Spliced RNA Protein
More informationDNA codes for RNA, which guides protein synthesis.
Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription
More informationGenetics. Instructor: Dr. Jihad Abdallah Transcription of DNA
Genetics Instructor: Dr. Jihad Abdallah Transcription of DNA 1 3.4 A 2 Expression of Genetic information DNA Double stranded In the nucleus Transcription mrna Single stranded Translation In the cytoplasm
More informationOverview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment
Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development
More informationPhenomena first observed in petunia
Vectors for RNAi Phenomena first observed in petunia Attempted to overexpress chalone synthase (anthrocyanin pigment gene) in petunia. (trying to darken flower color) Caused the loss of pigment. Bill Douherty
More informationCh. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
More informationUtility of Circulating micrornas in Cardiovascular Disease
Utility of Circulating micrornas in Cardiovascular Disease Pil-Ki Min, MD, PhD Cardiology Division, Gangnam Severance Hospital, Yonsei University College of Medicine Introduction Biology of micrornas Circulating
More informationAlternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins.
Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins. The RNA transcribed from a complex transcription unit
More informationCellular MicroRNA and P Bodies Modulate Host-HIV-1 Interactions. 指導教授 : 張麗冠博士 演講者 : 黃柄翰 Date: 2009/10/19
Cellular MicroRNA and P Bodies Modulate Host-HIV-1 Interactions 指導教授 : 張麗冠博士 演講者 : 黃柄翰 Date: 2009/10/19 1 MicroRNA biogenesis 1. Pri mirna: primary mirna 2. Drosha: RNaseIII 3. DCR 1: Dicer 1 RNaseIII
More informationRegulation of Gene Expression in Eukaryotes
Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression
More informationMicroRNAs and Cancer
MicroRNAs and Cancer MicroRNAs are an abundant class of small (20-25 nucleotides) non-protein coding RNAs that function as negative gene regulators. The human genome contains up to 1000 micrornas which
More informationAlan Weiner BIOCHEM 530 Friday, MEB 248 October 23, 2015 RNA structure, the ribosome, structure-based drug design
Alan Weiner BIOCHEM 530 Friday, MEB 248 October 23, 2015 RNA structure, the ribosome, structure-based drug design Crick's "Central Dogma"? DNA makes RNA makes protein Crick's "Central Dogma"? DNA makes
More informationMicroRNA and Male Infertility: A Potential for Diagnosis
Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic
More informationMarta Puerto Plasencia. microrna sponges
Marta Puerto Plasencia microrna sponges Introduction microrna CircularRNA Publications Conclusions The most well-studied regions in the human genome belong to proteincoding genes. Coding exons are 1.5%
More informationMolecular Cell Biology - Problem Drill 10: Gene Expression in Eukaryotes
Molecular Cell Biology - Problem Drill 10: Gene Expression in Eukaryotes Question No. 1 of 10 1. Which of the following statements about gene expression control in eukaryotes is correct? Question #1 (A)
More informationSmall RNAs and how to analyze them using sequencing
Small RNAs and how to analyze them using sequencing RNA-seq Course November 8th 2017 Marc Friedländer ComputaAonal RNA Biology Group SciLifeLab / Stockholm University Special thanks to Jakub Westholm for
More informationThe RNA revolution: rewriting the fundamentals of genetics
RCH Grand Rounds - June 4 The RNA revolution: rewriting the fundamentals of genetics Ken Pang Overview 1. Genetics 101 2. Recent lessons from genomics 3. The expanding world of noncoding RNAs 4. Long noncoding
More informationV16: involvement of micrornas in GRNs
What are micrornas? V16: involvement of micrornas in GRNs How can one identify micrornas? What is the function of micrornas? Elisa Izaurralde, MPI Tübingen Huntzinger, Izaurralde, Nat. Rev. Genet. 12,
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our
More informationProkaryotes and eukaryotes alter gene expression in response to their changing environment
Chapter 18 Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development and is responsible for differences
More informationHigh AU content: a signature of upregulated mirna in cardiac diseases
https://helda.helsinki.fi High AU content: a signature of upregulated mirna in cardiac diseases Gupta, Richa 2010-09-20 Gupta, R, Soni, N, Patnaik, P, Sood, I, Singh, R, Rawal, K & Rani, V 2010, ' High
More informationIntrinsic cellular defenses against virus infection
Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses
More informationGene Regulation Part 2
Michael Cummings Chapter 9 Gene Regulation Part 2 David Reisman University of South Carolina Other topics in Chp 9 Part 2 Protein folding diseases Most diseases are caused by mutations in the DNA that
More informationTRANSCRIPTION. DNA à mrna
TRANSCRIPTION DNA à mrna Central Dogma Animation DNA: The Secret of Life (from PBS) http://www.youtube.com/watch? v=41_ne5ms2ls&list=pl2b2bd56e908da696&index=3 Transcription http://highered.mcgraw-hill.com/sites/0072507470/student_view0/
More informationLesson Flowchart. Why Gene Expression Regulation?; microrna in Gene Regulation: an overview; microrna Genomics and Biogenesis;
micrornas Lesson Flowchart Why Gene Expression Regulation?; microrna in Gene Regulation: an overview; microrna Genomics and Biogenesis; How do micrornas function? micrornas and complex cellular circuits;
More informationTranscription and RNA processing
Transcription and RNA processing Lecture 7 Biology 3310/4310 Virology Spring 2018 It is possible that Nature invented DNA for the purpose of achieving regulation at the transcriptional rather than at the
More informationSantosh Patnaik, MD, PhD
Santosh Patnaik, MD, PhD Assistant Member Department of Thoracic Surgery Roswell Park Cancer Institute 20 October 2016 History Biogenesis Nomenclature Tissue specificity Mechanisms of action MicroRNA targets
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationTable S1. Quantitative RT-PCR primers
Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg
More informationhe micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003)
MicroRNAs: Genomics, Biogenesis, Mechanism, and Function (D. Bartel Cell 2004) he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) Vertebrate MicroRNA Genes (Lim et al. Science
More informationLecture 4 Regulation of Initiation: mrna-binding
Institut für Biochemie und Molekulare Medizin Lecture 4 Regulation of Initiation: mrna-binding Michael Altmann FS 2010 Regulation of mrna binding to ribosomes mrna structure Cap accessibility RNA secondary
More informationEukaryotic small RNA Small RNAseq data analysis for mirna identification
Eukaryotic small RNA Small RNAseq data analysis for mirna identification P. Bardou, C. Gaspin, S. Maman, J. Mariette, O. Rué, M. Zytnicki INRA Sigenae Toulouse INRA MIA Toulouse GenoToul Bioinfo INRA MaIAGE
More informationIslamic University Faculty of Medicine
Islamic University Faculty of Medicine 2012 2013 2 RNA is a modular structure built from a combination of secondary and tertiary structural motifs. RNA chains fold into unique 3 D structures, which act
More informationmicrornas (mirna) and Biomarkers
micrornas (mirna) and Biomarkers Small RNAs Make Big Splash mirnas & Genome Function Biomarkers in Cancer Future Prospects Javed Khan M.D. National Cancer Institute EORTC-NCI-ASCO November 2007 The Human
More informationSmall RNAs and how to analyze them using sequencing
Small RNAs and how to analyze them using sequencing Jakub Orzechowski Westholm (1) Long- term bioinforma=cs support, Science For Life Laboratory Stockholm (2) Department of Biophysics and Biochemistry,
More informationMicroRNAs: a new source of biomarkers in radiation response. Simone Moertl, Helmholtz Centre Munich
MicroRNAs: a new source of biomarkers in radiation response Simone Moertl, Helmholtz Centre Munich The RNA World mrna rrna coding snorna trna scarna RNA snrna noncoding lincrna rasirna RNAi anti-sense
More informationEukaryotic mrna is covalently processed in three ways prior to export from the nucleus:
RNA Processing Eukaryotic mrna is covalently processed in three ways prior to export from the nucleus: Transcripts are capped at their 5 end with a methylated guanosine nucleotide. Introns are removed
More informationTranscription and RNA processing
Transcription and RNA processing Lecture 7 Biology W3310/4310 Virology Spring 2016 It is possible that Nature invented DNA for the purpose of achieving regulation at the transcriptional rather than at
More informationBio 111 Study Guide Chapter 17 From Gene to Protein
Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and
More informationProcessing of RNA II Biochemistry 302. February 18, 2004 Bob Kelm
Processing of RNA II Biochemistry 302 February 18, 2004 Bob Kelm What s an intron? Transcribed sequence removed during the process of mrna maturation Discovered by P. Sharp and R. Roberts in late 1970s
More informationPost-transcriptional regulation of an intronic microrna
Post-transcriptional regulation of an intronic microrna Carl Novina Dana-Farber Cancer Institute Harvard Medical School Broad Institute of Harvard and MIT Qiagen Webinar 05-17-11 Outline 1. The biology
More informationADAR editing in double-stranded UTRs and other noncoding RNA sequences
Review ADAR editing in double-stranded UTRs and other noncoding RNA sequences Heather A. Hundley 1,2 and Brenda L. Bass 1 1 Department of Biochemistry, University of Utah, Salt Lake City, UT 84112, USA
More informationRNA (Ribonucleic acid)
RNA (Ribonucleic acid) Structure: Similar to that of DNA except: 1- it is single stranded polunucleotide chain. 2- Sugar is ribose 3- Uracil is instead of thymine There are 3 types of RNA: 1- Ribosomal
More informationGeneration of antibody diversity October 18, Ram Savan
Generation of antibody diversity October 18, 2016 Ram Savan savanram@uw.edu 441 Lecture #10 Slide 1 of 30 Three lectures on antigen receptors Part 1 : Structural features of the BCR and TCR Janeway Chapter
More informationTranscriptome-wide analysis of microrna expression in the malaria mosquito Anopheles gambiae
Biryukova et al. BMC Genomics 2014, 15:557 RESEARCH ARTICLE Open Access Transcriptome-wide analysis of microrna expression in the malaria mosquito Anopheles gambiae Inna Biryukova 1*, Tao Ye 2 and Elena
More informationL I F E S C I E N C E S
1a L I F E S C I E N C E S 5 -UUA AUA UUC GAA AGC UGC AUC GAA AAC UGU GAA UCA-3 5 -TTA ATA TTC GAA AGC TGC ATC GAA AAC TGT GAA TCA-3 3 -AAT TAT AAG CTT TCG ACG TAG CTT TTG ACA CTT AGT-5 NOVEMBER 2, 2006
More informationMicroRNA therapeutics for cardiovascular disease. Eva van Rooij, PhD Hubrecht Institute, KNAW and University Medical Center Utrecht, The Netherlands
Original Article Heart Metab. (2014) 65:4-8 for cardiovascular disease Eva van Rooij, PhD Hubrecht Institute, KNAW and University Medical Center Utrecht, The Netherlands Correspondence: Eva van Rooij,
More informationResearch Article Base Composition Characteristics of Mammalian mirnas
Journal of Nucleic Acids Volume 2013, Article ID 951570, 6 pages http://dx.doi.org/10.1155/2013/951570 Research Article Base Composition Characteristics of Mammalian mirnas Bin Wang Department of Chemistry,
More informationRNA Processing in Eukaryotes *
OpenStax-CNX module: m44532 1 RNA Processing in Eukaryotes * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you
More informationEpigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1
Epigenetics: The Future of Psychology & Neuroscience Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Nature versus Nurture Despite the belief that the Nature vs. Nurture
More informationMetabolic programming. Role of micrornas. M Elizabeth Tejero, PhD Laboratory of Nutrigenetics and Nutrigenomics INMEGEN Mexico City
Metabolic programming. Role of micrornas M Elizabeth Tejero, PhD Laboratory of Nutrigenetics and Nutrigenomics INMEGEN Mexico City Outline Overview on micrornas (mirnas) Role of mirnas in metabolic programming
More informationPROTEIN SYNTHESIS. It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.
PROTEIN SYNTHESIS It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.» GENES = a sequence of nucleotides in DNA that performs
More informationOCCUPATIONAL HEALTH CONSIDERATIONS FOR WORK WITH VIRAL VECTORS
OCCUPATIONAL HEALTH CONSIDERATIONS FOR WORK WITH VIRAL VECTORS GARY R. FUJIMOTO, M.D. PALO ALTO MEDICAL FOUNDATION ADJUNCT ASSOCIATE CLINICAL PROFESSOR OF MEDICINE DIVISION OF INFECTIOUS DISEASES AND GEOGRAPHIC
More informationRegulation of microrna biogenesis and turnover by animals and their viruses
Cell. Mol. Life Sci. (2013) 70:3525 3544 DOI 10.1007/s00018-012-1257-1 Cellular and Molecular Life Sciences REVIEW Regulation of microrna biogenesis and turnover by animals and their viruses Valentina
More informationREGULATED AND NONCANONICAL SPLICING
REGULATED AND NONCANONICAL SPLICING RNA Processing Lecture 3, Biological Regulatory Mechanisms, Hiten Madhani Dept. of Biochemistry and Biophysics MAJOR MESSAGES Splice site consensus sequences do have
More informationMicroRNA dysregulation in cancer. Systems Plant Microbiology Hyun-Hee Lee
MicroRNA dysregulation in cancer Systems Plant Microbiology Hyun-Hee Lee Contents 1 What is MicroRNA? 2 mirna dysregulation in cancer 3 Summary What is MicroRNA? What is MicroRNA? MicroRNAs (mirnas) -
More informationEPIGENETIC CHANGES IN RADIATION- INDUCED GENOME INSTABILITY AND CARCINOGENESIS: POWER, PROMISE AND OPPORTUNITIES
EPIGENETIC CHANGES IN RADIATION- INDUCED GENOME INSTABILITY AND CARCINOGENESIS: POWER, PROMISE AND OPPORTUNITIES Olga Kovalchuk, MD/PhD University of Lethbridge, AB, Canada Sources of radiation exposure:
More information1. Identify and characterize interesting phenomena! 2. Characterization should stimulate some questions/models! 3. Combine biochemistry and genetics
1. Identify and characterize interesting phenomena! 2. Characterization should stimulate some questions/models! 3. Combine biochemistry and genetics to gain mechanistic insight! 4. Return to step 2, as
More informationCancer Problems in Indonesia
mirna and Cancer : mirna as a Key Regulator in Cancer Sofia Mubarika 2 nd Symposium Biomolecular Update in Cancer PERABOI Padang 18 Mei 2013 Cancer Problems in Indonesia 1. Chemoresistency / recurrency
More informationHepadnaviruses: Variations on the Retrovirus Theme
WBV21 6/27/03 11:34 PM Page 377 Hepadnaviruses: Variations on the Retrovirus Theme 21 CHAPTER The virion and the viral genome The viral replication cycle The pathogenesis of hepatitis B virus A plant hepadnavirus
More informationMolecular Mechanism of MicroRNA-203 Mediated Epidermal Stem Cell Differentiation
University of Colorado, Boulder CU Scholar Undergraduate Honors Theses Honors Program Spring 2011 Molecular Mechanism of MicroRNA-203 Mediated Epidermal Stem Cell Differentiation Sarah Jackson University
More informationnumber Done by Corrected by Doctor Ashraf
number 4 Done by Nedaa Bani Ata Corrected by Rama Nada Doctor Ashraf Genome replication and gene expression Remember the steps of viral replication from the last lecture: Attachment, Adsorption, Penetration,
More informationMorphogens: What are they and why should we care?
Morphogens: What are they and why should we care? Historic, Theoretical Mechanism of Action Nucleoprotein: the specific trophic cellular material extracted from the cell nucleus. DNA and RNA which regulates
More informationGenetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
More informationChapter 11 How Genes Are Controlled
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Biology: Concepts & Connections, Sixth Edition Campbell, Reece, Taylor, Simon, and Dickey Copyright 2009 Pearson Education, Inc. Lecture by Mary
More informationNOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION. Ana M. Martinez
NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION Ana M. Martinez Switching from Repression to Activation: MicroRNAs can Up-Regulate Translation. Shoba Vasudevan, Yingchun Tong, Joan A. Steitz AU-rich
More informationProcessing of RNA II Biochemistry 302. February 13, 2006
Processing of RNA II Biochemistry 302 February 13, 2006 Precursor mrna: introns and exons Intron: Transcribed RNA sequence removed from precursor RNA during the process of maturation (for class II genes:
More information(,, ) microrna(mirna) 19~25 nt RNA, RNA mirna mirna,, ;, mirna mirna. : microrna (mirna); ; ; ; : R321.1 : A : X(2015)
35 1 Vol.35 No.1 2015 1 Jan. 2015 Reproduction & Contraception doi: 10.7669/j.issn.0253-357X.2015.01.0037 E-mail: randc_journal@163.com microrna ( 450052) microrna() 19~25 nt RNA RNA ; : microrna (); ;
More informationAlternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6
Alternative splicing Biosciences 741: Genomics Fall, 2013 Week 6 Function(s) of RNA splicing Splicing of introns must be completed before nuclear RNAs can be exported to the cytoplasm. This led to early
More informationProcessing of RNA II Biochemistry 302. February 14, 2005 Bob Kelm
Processing of RNA II Biochemistry 302 February 14, 2005 Bob Kelm What s an intron? Transcribed sequence removed during the process of mrna maturation (non proteincoding sequence) Discovered by P. Sharp
More informationMicroRNAs: molecular features and role in cancer.
MicroRNAs: molecular features and role in cancer. Elodie Lages, Hélène Ipas, Audrey Guttin, Houssam Nesr, François Berger, Jean-Paul Issartel To cite this version: Elodie Lages, Hélène Ipas, Audrey Guttin,
More informationWeb-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.
1 of 17 12/10/2003 11:33 AM Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm, Room 438 Library Admin Building
More informationProtein Synthesis
Protein Synthesis 10.6-10.16 Objectives - To explain the central dogma - To understand the steps of transcription and translation in order to explain how our genes create proteins necessary for survival.
More informationRNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
More informationBiol115 The Thread of Life"
Biol115 The Thread of Life" Lecture 9" Gene expression and the Central Dogma"... once (sequential) information has passed into protein it cannot get out again. " ~Francis Crick, 1958! Principles of Biology
More informationImprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821
Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes
More informationToday. Genomic Imprinting & X-Inactivation
Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic
More informationChapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression Differential Expression of Genes Prokaryotes and eukaryotes precisely regulate gene expression in response to environmental conditions In multicellular eukaryotes,
More informationTranscriptome profiling of the developing male germ line identifies the mir-29 family as a global regulator during meiosis
RNA BIOLOGY 2017, VOL. 14, NO. 2, 219 235 http://dx.doi.org/10.1080/15476286.2016.1270002 RESEARCH PAPER Transcriptome profiling of the developing male germ line identifies the mir-29 family as a global
More informationCRS4 Seminar series. Inferring the functional role of micrornas from gene expression data CRS4. Biomedicine. Bioinformatics. Paolo Uva July 11, 2012
CRS4 Seminar series Inferring the functional role of micrornas from gene expression data CRS4 Biomedicine Bioinformatics Paolo Uva July 11, 2012 Partners Pharmaceutical company Fondazione San Raffaele,
More informationAnalysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note
Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer Application Note Odile Sismeiro, Jean-Yves Coppée, Christophe Antoniewski, and Hélène Thomassin
More informationMCB 102 Third Exam Spring 2015
MCB 102 Third Exam Spring 2015 Problem 1 Problem 2 Problem 3 Problem 4 Problem 5 Problem 6 Problem 7 Problem 8 Problem 9 Problem 10 (14 points) (9 points) (10 points) (9 points) (5 points) (6 points) (7
More informationBasis and Clinical Applications of Interferon
Interferon Therapy Basis and Clinical Applications of Interferon JMAJ 47(1): 7 12, 2004 Jiro IMANISHI Professor, Kyoto Prefectural University of Medicine Abstract: Interferon (IFN) is an antiviral substance
More informationBreast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
More informationreported to underlie diverse aspects of biology, including developmental timing, differentiation, proliferation, cell death, and metabolism.
1100 MicroRNA in Cancer: The Involvement of Aberrant MicroRNA Biogenesis Regulatory Pathways Genes & Cancer 1(11) 1100 1114 The Author(s) 2011 Reprints and permission: sagepub.com/journalspermissions.nav
More informationThe Blueprint of Life: DNA to Protein. What is genetics? DNA Structure 4/27/2011. Chapter 7
The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the study of genes, how they carry information, how they are replicated, how they are expressed NA Structure
More informationThe Blueprint of Life: DNA to Protein
The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the y; study of genes, how they carry information, how they are replicated, how they are expressed 1 NA
More informationLife Sciences 1A Midterm Exam 2. November 13, 2006
Name: TF: Section Time Life Sciences 1A Midterm Exam 2 November 13, 2006 Please write legibly in the space provided below each question. You may not use calculators on this exam. We prefer that you use
More informationDSB. Double-Strand Breaks causate da radiazioni stress ossidativo farmaci
DSB Double-Strand Breaks causate da radiazioni stress ossidativo farmaci DSB e CROMATINA Higher-order chromatin packaging is a barrier to the detection and repair of DNA damage DSBs induce a local decrease
More informationPosttranscriptional regulation of the microrna-17-92a cluster
Posttranscriptional regulation of the microrna-17-92a cluster Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften vorgelegt beim Fachbereich Biowissenschaften (FB15) der Goethe Universität
More informationRemoval of Shelterin Reveals the Telomere End-Protection Problem
Removal of Shelterin Reveals the Telomere End-Protection Problem DSB Double-Strand Breaks causate da radiazioni stress ossidativo farmaci DSB e CROMATINA Higher-order chromatin packaging is a barrier to
More informationMicroRNAs: novel regulators in skin research
MicroRNAs: novel regulators in skin research Eniko Sonkoly, Andor Pivarcsi KI, Department of Medicine, Unit of Dermatology and Venerology What are micrornas? Small, ~21-mer RNAs 1993: The first mirna discovered,
More information